Equus_caballus Locus SRCAP
snOPY snoRNA Orthological Gene Database
Equus_caballus SRCAP
Equus_caballus
SRCAP
13
SNORA30
8630..8758
30158
GAGACGGCGGCGGCCATTTTGGTGAGGCCTCGGAAGCGGCGGCGGCGGTTCGCTGGCAG
TAGCGTCTCTCATTTTTCCCACCCACCGCCCGCATCTCTGTGCCGTGAGAGGAGGCACTG
GAAGCAAGGCGGTGGCAGTAGCCACGGGCCCCAGGGGAATTTTAAAGGGCCGCGAGGCGG
CGGCCAAAGAGGGGGCCCTCCCCGCTCCTCGGGCGAGAGGGGGGGGTGGGNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCCGGAGGCTGTTCGGGCGG
GCGCCATTAGAAGACTGGCTGAGAGAGAGACCAAGCCGGCCGGCACTGGATCCAGGCGCG
TTTTCTTCTCCCTCTCGGCCATCTGCGCACGCGTGCATGAGCGAGCGAGCGGAACCCTGA
GAGACAGACCCAGGGTGGCTTCTTCTCGCCCAGCCAATCTCAGCACACCTCCTTCCCCTC
AAGGACCGCGGGAAGACGAAAGGAGCGGCGTGGGACAAGTAGTCTGGGCGCGTGCCCCAC
ATATACAGTCAGGGACCAGGAACTGGCGGGCACAAACCCTCCCTTATCTCAGCTTTTCTC
GGTCTGTGGGTGGTGGGGGGGCTGCCTGACGGGCAGGCTTTTCAGACCTGCGACCCTCGT
GTGCGTGGGTTTGAGGTTCTGGCGGGAGCCCCCAGACGGTGCGCGCAGCCGGCTCACTCC
GCCTCTAGTCGCGCACGCGCGGGCCCCTCCCCCCAGCCTGTCGCACACGTTGGGTGGGGT
GGGAGTCTAGGAGGGGGCGGGGCTATCTTAGGGCTGGTGGCAACTTGGGACAGAGGTCAG
GGGTCACGCTGGGTCAGTCTGTTGGGAGGAGTTGGGAGACAGTAATGAAGCCTGGGGTCA
AGAGTTCAGGCTTCTTGGATTCTGGTTAGCTTGGGTCCTGGGAATCTGTTGTGGAGGAGG
GAGTGAATCAAAGGCAGCACCGTGGTAAAGGAATTTCCTTAAACTGAGGAAACACTTCCG
GGCCTTGTGTGGATTTACTCTACCTGTTTCCGGGGTCTGGTGCTTGGCTGTGCGCCCTTC
CTCATATCTGAGTGCTCCTCTAGTCTCTTGCTGTAGTTCTTGTGCTTGGGGAAGTGTCTT
ACGGTCCAGGTACAGCAGGCACAGGGCCCTGCCCTGAGGAAGGGTGGATTCTCCTGTGAC
TGTGTTCAGCTCTCACTGGAAAGGTGAGCAGGCTCCCAGGCAGCCAGCGCCTTTTGAGCT
TCTGGATGTGACAGCTTTTTTTGCATTATTTGCCCTCCACTGAGTAGTTGGAGCCTTTTA
CACTTAAGCTTTTTAAACTTTTTTTTCTTCACTTCCCTGTTCTCCCCCCCAGCCAGAATT
TTATGTCCCTAAGGAATTGTGTTTTCACAAAGTGTACTTTGCTTTCGTTTTTCCGAAATG
TGAACTTTTCCTACTACTATAACTCTTGTCAGTCTTTAGACTGATTTGGGTATATTTAAA
AGCCTTCAAAGCTGGTGTAAAGAAGGCTTTGATGGATGTTGGTAAATATGGATTGGTTCC
TCACTGTTGCTGTCTCCCCTTCTGTTTGTTTCAGGCGTGATTCCCCTCAGTACGGCGGCA
CCGTGGAAGTACAGACTTTCACAGGGAGTGTGGTCTCAGCTCACACAGGTGAGGATGCAG
ATACCGTTTTGTGTATTGGTGCTAATGGGAGAAGTGTTTGAGGTAATTAGAGAAATTTTA
GGTTAATGACTTGTGGTTTGAAAATAGTGGTGCAAGAACACAATTGGGGCTATGGTTAGA
GAAAGATCTGATCATCCTGACTCTACCAAGGAGAGTAGCATACTCGCCATCATTTTGGCA
TCAGATCACCTAGGTTTAAGGTCTCTTTCTACCACTTCCTTACTGTGTGATCTTATGCAA
ACCATTTGACCTTGTTATGTTCTGATCTTCTCCTTTATAAAATAAAGGAAATATTAGAGT
GTAAGCTCCATTTAGGTCAGGGGTCTTTTCTGTATGGTTTTGTCCTCAGTATGTAGAAGG
AACTAAATAAACATTTATTATAGCATGAAAAGTACCTGGTTCATAGGGTAGATGTGAGGA
TTATAGAACACATCAAGTAAGCACTTAGTATTTGACACATAGTAGATGCTCAAGAAATGT
AGGGTATAATCACTGTCTTCATTTATCTTTATTCTTTATGTGACTCGTAGTTTTTTAAAA
GATTCTTTAATCTTTTAAAATCTAATTTCTACTGTTTTTACCTTACTTAAGGTGCTCCAG
AGGCCAGTGGACCTGAGCGGAGACTGGGACGCCCTAGTGGGCCCCGGGCCCTGGAAGGCG
GGTCCCGGTGGCCGGTGGCCCAGAATGAGGCCAGCTCCCAGCATGCCCTGCAGCCGGACG
CCAGCCCCTCGGCCAGCAGCAGTGGTGACAACGACCCAGTCATTCTACAGGCATCCAAAG
AGGAGCCTGGGAGTGGGACCATGCAGAGCAGCCCCTCCCCTGCTCACCCTCAGCTCCCAA
TCCTGCATTCACAGGTTTGAAAGTGGAGAGGGCTCCTCTGTTTCTGCTTCTCTGTTTCTG
TTTCAGAGGGCTACTGGCTCTGAGGCAGAAGAAATGTGGCAGGTCTTAGTAATATTGCCA
TGATCCTGGCTCCCTAGGTAGCTGAGTTTGGAGAAAGTTTGCTGTTAAAGTGGGCCGTCA
GGCCTGTTGCATGTTCACATTTTACTTGACAGTAGTGGAACATCGATCTCTAAGAGTGTG
GGAACTCCTTATTACCTGAAAAAGGTTGAATTAGGCCAGATTGGAAATGGAGGTTGGGAC
AACATGCTTCTAAGACTGTGCTTTGAGAACAGCTCAGTTTGTTTCGGAACTGGAACAAGG
TAAGCGTTGTGGATGATGCGTAGTGTTCATTTTTTTCCTCATAGGGAAATAAAGGGGATG
GGGAAAAAAATCATGGCTTTTGAAACTGAGTAGACCTCAGTTTGCGTTACGTCAGACTTT
TGATGGTTATGGATTTTATATTTATAATTTTCCTGAGCAGCTGGGAAATTTTGCAACATG
TAGTCTTTTGTTATTTAGCTGAGGTAAGAATTTGACTGGCATACTTTGAGGCTTGTGTGC
TAAAGTGAATTTCGTGAGTTCCCTCTCACTGTCCACATTTAAGTAGGATTTTGTTCTCTA
CTTTTTACTGCTTGTGCAGTACCTTGTAAAGTAGTAGGTGGGTGTTTGAAAACAGTGACC
AACCCCCTTTCCCACCTCCCACCTCTCTAGTAAAGGAAACTACCAAGGCTTATCATGATT
GTAGAGGTTTAGGTGATTTTGGTTTTTTTGATGCCCTTTGAATTTAGTGGTAGCTCACAT
TTATTTGCGTAGGTGAATCTGCCATGCTTGCTCTGAAAAGGAGGGAAAAATAGGGAGTTG
TTTATGTGAGTGAAATCATTGAGGTTCTGAAAGGATCATTAAAAATATGAAATCATACGC
TATAGTAGTATTCTTGGATTTGGGAACTGCATAAATGTCAGGCTATAACTTCTCTTGCAT
GCCAAGCATCTGCCATAAACTTGGCTCTGCCATATTGAGCCCCTTATTAAAACTTTATTC
CAAATGTTTGTGTTTATAAAAATAAGGTTGATGTCTTACTCCAGAGGTTTTTTTTTGTGA
AGATAGAAGGAAATAGTGTACTTAAAACTTGTGATACAGTGCTAAGGATTCATTTTATGT
ATCATTCTCCCCTTTTCTAGATGGTGTCGGACGGCATGACAGGCAGCAATCCTGTGTCCC
CTGCCTCATCCAGTTCCCCAGCCTCTAGTGGGGCAGGTGGCATCTCCCCCCAGCATATAG
CTCAAGATTCCTCTCTGGATGGACCTCCAGGGCCCCCAGATGGTGCCACAGTGCCCCTGG
AGGGGCTTAGCTTACCCCAGGCTGCTGACCTGGCTAACAAGGGCCCAAAATGGGAGAAGA
GCCATGCTGAGATTGCAGAGCAGGCCAAGCATGTACGTATTGGGAAGACCCGTGAGAATT
CTTGGGAGTCTTCTTCCCTGAACTCCTATGTCCCATGGGTATTTTACATTTCTTTCCTGT
CATGGATTTAGAGTATAGGCTCTGCCTTAACTTATATGATCTTGAGCAAGTCACTTGAAC
TCTGAGCGTCATTTCCTTTTCTATAAAATAGGGATGGTTTAATAGTTTATAGGTTGGTAA
GAGGTTTAAATTAAAGGAGAAAATAGACATGCAAGTGCTTTGTAAACTGTAAGGTTCTTA
AGATGTACTGGTTTCTACTTCTCATTTCTATCCTGTAGCCTCTTTTACACTTTTCCAGTG
GTAAGTGTGGTTTCTAAGCCAGCAGCAGCAGCATCACCTGGCAATTTGTTAGAACTGCAA
ATTCTTGGTACCCCTCTTCCCCCTACCCATTTAAACTGTAGGGTGGGGGCCGGCTTGGTG
GCGCAGCGGTTAAGTGCACATGTTGTGCTTCTTTGGCAGCCCAGGGTTCGCTGGTTCGGA
TCCTGGGTGAGGACATGGCACTGCTTGGCAAAAGCCATACCGTGGTAGGTGTCCCACATG
TAAAGTAGAGGAGGATAGGCACGGATGTTAGCTCAGGGCCAGTCTTCCTCAGCAAAAAGA
GGAGGATTGGCAGCAGTTAGCTCAGGGCTAATCTTCCTTAAAAAAAATAAATAAATAAAC
TGTAGGGGTGGGCCCCAGCAATCTGTCTGAAAAAGCCCACCAGATGGTTCTGATGGATAC
TCAAATTTGAGGGCCATTAGTCTAATACCCATGTCTCTTGATGTTTCCTTCACCATCAGG
CCATTTAGTTCCCTGTCTCATTTCTGGCTGTCATTTCCTCTGATTTAGGGTTTGCTTTTT
TTTTTGATGTCCACACCCGGGATCCGAACTGACGAACCCCAGGCCTCCGAAGTGGTGATT
TAGTTTTTGTCAAGAGAGGACAAGAATATTGAGGGCCGTTGTCCTTTTTTTAGTCACCTC
CGTTAAAGAAAATTTCAAATGCTTTCATTTTTTTCCTTATGAAATATAATCAGTGTAGAA
ACAGTGTTACCTTTTTGTCATACTAACCATTATTAATCTTTTTGTGTGTAACTTTTCAGT
ATTTTCCACAGAAAAATAGATTTTTACAAAAATAGCATTTTTTTTTTTAAGATTTTATTT
TTTTCCTTTTTCTCTCCAAAGCCCCCTGGTACATGGTTGTATATTGTTCATTGTGGGTCC
TTCTAGTTGTGGCATGTGGGACATTGCCTCAGCGTGGTTTGATGAGCAGTGCCATGTCTG
TGCCCAGGATTCGAACCAACGAAACACTGGGCCGCCTACAGTGGAGCATGTGAACTTAAC
CACTCGGCCACGGGGCCAGCCCCAAAAAATAGCATTTTTTAAAAACAAAGGATTGTGTAA
ATTGGGTTGTATAGTGTATTTCTAAGTATGAATATACTGTTGCGTAAGTAGAATTCTACA
GTGATGAAGATCCCTTGTATCTAGAATCAGTAAAGAAGCCTGTACTTCTTGTGTCTCTGT
GAAACTACCCTTGGGATATGTTTTCCCAAGTCTCATCTATATTCATGGGGCATGGAGATT
GTGTGATATAATGGAAAGAGCATGAAGTCTGATGTCTAGAGTCGCTAGACCTATTTTTAA
TTCCTAGCTCTTACACTTCCCGGCTGTGTGATCTCAAGTAAATCACTTAATCTCCCTGAT
ACTCTTACTTACCTGTAGAGAGTAGAATATCTCTCTGCAGAATATCTCTACTCAGAGAGT
AGAATATTCAGCCATGGTCATGAAGTGGAGTATATGTCTAGTAAGTTGGTTGACCTAGCT
CTCTCCTTAGGAGGCTGAGATTGAGACTCGGATTGCGGAGCTGCGGAAGGAGGGTTTCTG
GTCACTGAAGAGGCTGCCTAAAGTACCTGAGCCTCCCCGCCCCAAAGGCCACTGGGACTA
TCTATGTGAGGAGATGCAGTGGCTCTCTGCTGACTTTGCTCAGGAGCGTCGTTGGAAACG
GGGTGTGGCCCGTAAGGTATATCCTCAACTGGGCCTACCTTCCATTTCAGGTTTGCTTTT
CCTTAACAGGTGGGTTGGTTGGAAGGGAATCAAACATAACAGTGGTAGGGTGCCTATTAA
TGCACATAATGTCGAGGCAAGCGCTGACTTCCCAGATTTTTTGGCCTTGATTATTCTCTT
TGCTTTTGACTTTGGGAGGGGGCAGGAGTCTGGCCTTGGAGTATTTTCACGTTGGTCCCT
CATTCCCACAGGTGGTGCGCATGGTGATCCGGCACCACGAGGAGCAGCGGCAGAAAGAGG
AACGGGCCCGGAGGGAGGAGCAGGCCAAGCTGCGCCGAATTGCCTCCACCATGGCCAAGG
ATGTCAGGCAGTTCTGGAGCAGCGTGGAGAAGGTAGGCAGCAAGGATTGGGAAAGGGAAA
CGCATTGGGTTTGTTGGGTAGCATGGTAACAGGAATGGTCAAAATTTCTCTTTGAGAAAG
TGAATATTACAATTTCAAGCAATTCTGATGACATTGCTGTTGTGCATTGGACCTTTCTAG
CATTGAGTGCTTTGAAGAAGAAAGAAGTACAGTGGAAAAATATGGGCCCTGCCTTTGGGG
GTTGTTAATAGGTCTTCTGGACCCCACTAGGCCATCTGTCCTTTGCAGCACATTAAGCAT
GCTTTTTTTTTTTTTTTTTAAAGATTTTATTTTTTTCCTTTTTCTCCCCAAAGCCCCCCG
GTACATAGTTGTATATTCTTTGTTGTGGGTCCTTCTAGTTGTGGCATGTGGGACGCTGCC
TCAGAGTGGTCTGATGAGCAGTGCCATGTCCGCGCCCAGGATTCGAACCAACGAAACACT
GGGCCGCCTGCAGCGGAGCTCGCGAACTTAACCACTTGGCCACGGGGCCAGCCCCAAGCA
TGCTTTTTTCTAAAACCTGCCAGTGCCATTTACCTACTTACATACTGTCAAAGTTCTCAT
TAATTAAGCTGTTGCCGTATATTAAGTTGAATTGTTTCTTAAGTACTATGTGGCTTCTGT
CTACATTTTCAGTTTTATCTCTGCCAGTTCCTTTCCTCTCTTTTCCACTTCAGACATACT
TTCTTTCGCACGTCCCTGGCTATTTACGCATGCTCTTTCTATTGCTGAGAATGCCTTTCT
CCTCATTTCCACTTAGGGAACACCTACTTAATCTTTTTAAGATTCAGTTCCAAACACGTT
TGCAAATCTTTCTCTGCTGCCTAAAGTTAAGCTGGCTCTTTCCCTGTGCCCCCTTTGTGC
TTTCCTCAGAAGCACCTTTAAGGTCATTTAACTCTTCCTGAAAAATCAACCCAGAGCCTA
GCATACAGGAGGCTTCCCTAAATGTTGAGTGAAAGAGTACATGAATAAAAGATTATCTTG
GTGACCTGTCCATTTCATGTTTGTGGCAGGTGGTGCAATTCAAGCAACAGTCCCGACTCG
AGGAAAAGCGCAAAAAAGCTCTGGACTTGCACCTGGACTTCATTGTGGGGCAAACTGAAA
AGTACTCAGACCTTCTGTCTCAGAGCCTCAACCAGCCGCTAGCCTCCAGCAAAGCTGGCT
CTTCTCCTTGCCTTGGCTCTTCCTCAGCTGCCTCTAGTCCTCCACCCCCAGTTGCCCGGC
TGGATGATGAAGGTTTGTGTCCTCTTTGGCTCTGTTACTCTTCCTCATGTACCCTTTCCA
GAGCTGAAAACCCACCCTGTGGCTTGCAGGGCCCCGTGGACTTTGTGACCTTGTTCTCCT
GCTATAGATGGGGACTTCCAACCCCAAGAGGAGGAGGAAGAGGATGATGAGGAGACAATT
GAGGTTGAAGAACAGCAGGAAGGCAATGATGCAGAGACCCAGAGACGTGAGATTGAGCTG
CTTCGACGTGAGGGAGAACTGCCACTGGAAGAGCTGCTCCGTTCCCTCCCCCCTCAGCTG
CTAGGAGGGCCTTCCAGCCCCTCGAGAACCCCCTCATCTCGTGATAGTGACACCCGAGAT
GGGCCTGAAGAAGGTGGTGAAGAAGAGCCTTCTCAGGTGTTGAAGGTATAGGCAGAAAGG
GTAGAGGGAAGGCTCAGAGTGGGAGCAGAGGGAGAGGTTAAAGGATTGAGTTCTGGTCTG
TAAGATTGGTCCTGGTTTTCAGAAGTCCTCCCTGGTTAAGGGCAATTGAGCTCTCATTTG
GGCATGGATAGGGAAGAATCTAGGTTTGGGGCAAGTTATAGTCTGAAATGAACAGAGTTT
CTGCTGCTGTAGAAGAGTGTACTGTATTAGAATTGCTTTGTGACGTTGAAAAAATTCTTA
TTCTGGCCCTTGTTACTTCCATGAAATGGAGTACTAATACTAATACTCCGTTACTGCTTT
GTAGGTTTGGAGCTGGGATGGTAACCTTGAAGTCTGTTTTGGACCTGAGCTCTCTGTTTC
TCCATAAATCTGAGTGCATGCGGATGGTGTTGGGGGCTTGTATTTCTTATCTAGCACTTT
CACAGGTCCTCCCCCAGACAGTTGGGCCAGGATTTGGTAGCTGGTGCTGAAAGAAAACCC
TTGATTGCATCCTTGCCCTGGGACTGTGCCAGTGGCAGCTGTCACTCAAGGGGACAGGGA
GACTGTTTTCTGACATCTTACTTAACATTGTGCCTTTCTCTTGCTGCTCTAACCTTGGGC
CCTTTCCCTTTTCATCCTTTGCCATACAGGTAAAGCCCACACCCTCCTCTGTCACACAGT
GCAACAAAAAACCTTGGCATGCAGATGAGGATGACGAAGAGTTTACTGCCAATGAGGATG
AAGGTCAGGCCTGTTCTTTTTATCGTGTTGCCCCTTACTCTTGAATTGTCTGGACCTAAT
TTTTCAGGTTTTCTCACCTCTTCTATTTGGACTGTGTCCTATGCCTCTGTCCCCACTGAT
CTTGCTTCATTCTCTTTCCTAGCGGAGGATGAAGAGGACACCATCGCAGCTGAGGAGCAG
TTGGAAGGGGAGGTGGATCATGCCATGGAGCTGAGCGAGTTGGCTCGAGAAGGTGACACT
CGCCTGACGTTTTACTGAGCATCCACTTGGTATCTCCTCTGTGCAGAATGTCAGGGATAA
AGCGATGAATAAGACACTTTTTATCCCCCCGGAGGGACTCCAGATCTGAAGACAAAGGTT
TAAAAATGAATAATTATAAGTACATTATGATGACTGGTTATGATGGAAGTTTGAACAAAG
TGATGTGAGAGCTCGGTGGAGAGGAGAGCCGTTGGAAGATGATAGTGGCTATGTTTGACT
TGTACCTTAAAAGGGGGGTTCATGAGACTGATACTGTCCTTCCCAGCAGAAGGCAGCACT
ATCCATGGTTCTAGCCCAGGTTGTAGGGCTTGGCTTTAGTAGCTGGTGCTGAAAGTAAAC
TCTTAGCTCCCCTCGGACCTGGGCCTAGCAGTGACTACAGAAACCTAGGTAAAATGAACT
GGCACCACTTAGACTTCCTCTTCTCCCTTCTCTTCGAAGTACCCAAAAGCTTACTTTGTT
TCTTTTCCAGGTGAGCTGTCTGTGGAGGAGCTACTGCAGCAGTATGCAGGAGCCTATGCT
TCTGATGCCTCTGCACCAGGTTCTGGGAGTAGTGAAGAGGAAGATGAAGATGAGGTTGAG
GCTAACAGCTCTGACTTTGAACCAGAGGGGGCCACAGAAGCTGAAGAGGCTCCTCAAGAG
GATAGTAGCAGTCAGTCAGGTGACTGTGTGGTCACAAGGCAGGAGCTGGGGAGGGCAGGC
ACTAGAGAAGCAGGTATGGTGAGCACTAAGCCTTGGTCTTGTGCTTTAGACTCTGCTGAG
GAGCAGAGCGAGGATGAGGAAGATGAGCATTCAGAGGAGGAGGAAACAAGTGGAAGTTCA
GAATCAGAAGAATCTGAATCTGATGAATCTGAGGAGTCCCAATCACAGAGCCAAGCAGAT
GAGGAAGAGGAGGAAGATGATGACTTTGGGGTGGAGTACTTGCTTGCCCGGGATGAAGAA
CGGAGTGAGGTAGATGGTGGCAGTGGACCTCCCACCCCTGGGCCCACCACCACTCTAGGC
CCTAAGAAAGAAATTACTGACATCGCTGCAGCAGCTGAAAGTCTCCAGCCCAAGGGTTAC
ACCTTGGCCACTACCCAGGTATCCCCAAGCCTCAGCTTTTGCTTTCTCATATCTTGACTC
TTCTGTTTCTCACTGATGACAGATGCCTCAGTTCCACAGTGACACGTCTTTTCCTCCCTA
CCAGGTGAAGACACCCATCCCCCTGCTCTTGCGGGGCCAGCTCCGGGAGTACCAACACAT
TGGGCTGGACTGGCTGGTTACTATGTATGAGAAGAAGCTTAATGGCATTCTTGCTGATGA
GATGGGGCTAGGCAAAACAATCCAGACCATCTCCCTGCTTGCCCACTTGGCTTGTGAGAA
AGGTAACTAGGCAGGGCCCTTTCTCTTGGGTCTCCTTGGCCAGCTCCCTGAGAAGCTTGT
TTAATGGTGACTCTAGCTGCAGGATGGTGAAACACTCACTCTTTTCCTGCTGTCTTAGTA
CCTTCATTGACTCTGGACCGTAACTGTAGAGAGAGACCAGCATAGGTGCTAAGATTCTTA
GAAAGGGCCATTAGGATAGAGTGGTCAGGGTTAGACCTGGGGAACCAGAACTCCAAGGTT
TATGTTTCCTTATCTCTCATTCTTTTTTTTTTTTTTTTAAATTTCTCTGTTTAAAATCTT
TCTGAACCTTATTTTTTTTAACTGAGGTATAATTGACACACAGCATTATATTGGTTTGAG
GCGTACAACGTAATGATTCAAAATTTGTATACATTGCTAAATGATTGGCAAAATAAGTTA
ATTAACATCATCATCATACATAGTTATAGAAAAATTCTTATGTTGAGAACTTTTAAGATC
TACTCTCTTAGCAACTTTCCATTGCAATACACTATTATTAACTATAATCACCATGTTGTA
CATCTCTCATCCTTTTGCTAAACAGGTAACTGGGGTCCCCATTTGATCATTGTTCCCACC
AGTGTGATGTTGAATTGGGAAATGGAGCTGAAACGTTGGTGCCCTAGCTTTAAAATCCTC
ACTTACTATGGAGCCCAGAAAGAGAGGAAGCTCAAGCGGCAGGTTCGTTCCACCATGTGA
TCCCCCCATCAGTGCCTCTTTTACTGTTAGGCCCTTTCCTCAGATGAGTTCCTTTCCCTC
CTGTTTCTGTTGCTCTGTTCTGTACTTGGGACTTTTCTGATTTCTGTCCCTTGAAAACCT
TAGCATGTCTTCCCTTGCCGTTTCTTTTCTTTTCACCCCACTATCTCCTGCTTTCTCCTG
ATACTTCAGGGCTGGACCAAGCCCAATGCCTTCCATGTGTGTATCACGTCTTACAAGCTG
GTGCTGCAGGACCACCAGGCCTTCCGCCGCAAGAATTGGCGCTATCTCATTCTGGATGAG
GCTCAGAACATCAAGAACTTCAAGTCACAGCGCTGGCAATCACTGCTCAATTTCAACAGG
TGGAGATGGAGATGGGAATTTGTGGGAGGGTTGACTAGGCCTGAAAGTTAGGATGCTTGG
AAGGTTGGGCCTTGCTGACCATCCTCCCTCTAAATCCCTCTGTCTCTTTGCAGCCAGAGA
CGCCTGCTCCTGACAGGAACTCCCTTGCAGAACAGTCTTATGGAGCTGTGGTCCTTGATG
CACTTTTTGATGCCCCATGTCTTCCAGTCTCATCGGGAGTTCAAAGAATGGTTCTCTAAC
CCCCTAACTGGCATGATTGAGGGCAGCCAAGAGTACAATGAAGGTCTAGTCAAACGCCTC
CACAAGGTAGGGCCTGTGACAGTTTGTCAACAGTATTGGAAATAGTGAGGAACTAAAGGC
GACACCCAGAAAACCCTTAGGGAGAGAGAAGTCAGTGCTAAGCTGATTTCACCAATTGTC
ATGCTGCGGTGTTCTAGTGACTAACCCTGGAAATTGAGTGACCTCAACTTAGTCATCATT
CTACTTGTCTTCTTTAATGGTGACATTTCTCTTCTTATTCTCTGAGTAGAATAATACTGT
TGCTTGGTCCCTGCTTAGATTTCTCTTTACCTGGCTTTCCTCAGCTTCATATTTTTGTTT
TGTTCTCTTTTCTTGTTTGTTTGTTTTCTCTGGCTCCTTTTCTTTTGTCCAGCTTTTAAA
TAACATCTCTCAGCATTCTGATCTTTACTTTTTTTTGAAGAAGATTAGCCCTGAGCTAAA
ATCTGCTGCCAATCGTCCTCTTTTTTATATATGGGGCACCTACCACAGCATAGCTTGCCA
AGCGGTGCGATGTCCACACCTGGGATCCGAACCAGCCAACCCCAGGCCCGCCAAAGCGGA
AGGTGCACACTTAACTGCTGTGCCACTGGGCTGGCCCCTGATCTTTACTTTTTTGTTTCC
CAATGTACATATCTTACAGGTTTACTCATTCATGAGGCTTTAAAGACTCTCCAGTTTGTA
TTTTTAATCTCTTGACTCTCTAGATCACTTGACTTGTATTTCAGTTTCTGACTTGATGTC
TTTAATTGAAAGTTCCTCTTGAACTCACTCTGTTCTAAGTCAAACATCTCAAGCCTTATA
GTCTATTATTTCGACTCCATTTTGGTCAGTCACACCATCATTTTGGTAAATCAAACTAGA
AACCAAGAAGTCTTCCTTAACTATACCTCTTCCCTCCCTTCTTTCATTTCTTCCACGTCA
ACTTGATCACTGTGTCCTATCAGATTTTACCTCCTGAGATCTCAGATTTGCCTTTTGTTA
TCTATGCTGCTGTGACTGCCACAATTTTTGTTCTTAGCTTCTATCCTGGATTTGTTTTTG
TAATCTCGTAAATTTACACTTACTCCTTGAAATGTAATTTGAGTCATCCCTCTTGCATAG
TTAGTTGCTCTGCCCTCAGTGCTTCCTTTTATTGCTTCTTATGTTGTGGTATCATCATCT
TTATATCTGTCTCCTTCAGCAGACAGTAAATTCCTCGAGAGGAGGGCTGTCATCTGATTT
ATCTGTGTGATTGGTTGCTGGCATGCTGCATGGCTCCATGAATGTTTACTGATGGACTAA
GCCAGTGCTCAGCCAGTCATGGGGCCAAGACCCAGCTAAAGGGGCTAGGCTGGGTCTCAG
TGCCCGCTGTTCTCCTGTCAGCCTCCTGCTTATTTGCTTTTAGGTTTTGCGGCCTTTTTT
GCTGCGCCGAGTTAAGGTGGATGTTGAGAAGCAGATGCCTAAAAAGTATGAGCATGTTAT
CCGCTGCCGGCTCTCCAAGCGCCAACGCTGTCTCTATGATGACTTCATGGCACAGACTAC
GTAAGGGAGGACTGAGGGTGGGCCCTGGGACCCTAGATTAGAGCAGAGGTGACTGTCAGG
CTGCCTTATTTATTTTCCCTCTCTCCCAGAACTAAGGAGACACTAGCCACGGGCCATTTC
ATGAGCGTCATCAACATTTTGATGCAGCTGCGAAAAGTCTGCAATCATCCAAACCTGTTT
GACCCTCGACCTGTTACCTCCTCTTTCATCACCCCAGGCATCTGCTTCAGCACCGCCTCT
CTGGTGCTAAGGGCCACTGATGTCCACCCCCTCCAGGTAAGTAGGTGCCCCCAGGGTTAG
GGGCCCTACCTCAACCCTGCCTGCCCCTCTTTTCTTTAGGCTAGAGTCTGACCTTTTGTA
TCTTTACTTCTCCTGTCTTCTTAGAACTATTCCCCTAGTTTCTTTGTTTTCTAGCTGTGT
GTACTTTAGGCAAACTAATTACTAACCTCTAACCCTGAATTTGCTTGGCCTTCAAAACAG
GGATTATAAGGCCTATTCTGCAGTGTGTTTTTGAGAGTTGTGTTAATGTTTTTGGAAGTG
CCTGGCATATTAATAATACTTAAATATTATTTTGTTTTCCTACTTCTTCTTTTTGGCCAC
CCCCCCAATTTTTGTTTTTATTGTGGTAAAATGCACATAACAAATTTTACCATTTTAACC
ACTTTTAAGCATGTAGTTCGTTGGCATTAAGTACATTCACATTGTTCTGCAACCATCACC
ACCATCCATCTTCAGAACTTTTGTCATCTTTCCAAACTGAAGCTCCATACCCATTAAATA
ATAACTCCCCATTCTTGCCCTCCCCTTCAACCCTTTCTGTCTCTATAAATTTGACTACTC
TAGGTACTTCATGTCAATGGATCGTATAGTATTTGTCCTTTTGTGCCTGGCTTATTTTGC
TTTGCTGAATGTCTTCAAGGTTCATCCATGTTGTAGCATTGTATCAGGAGCTCCTTTTTA
ATATTGGGTAATATTCTGTTTTGTGCGTGTGTGTGTGTGTGTATATGTACATACATACGT
ACATACATACATGCACGTATTTCACATTTTGTTTATCCCTTCACCTGTCAGTGGACACTT
GGGTTGCTTCCACCTTTTGGCTGTCATGAATAATACCACTATGAACATAGGTGTACAAAT
ATCTGTTCGAGTCCCTGCTTTAAATTTTTTTGCGTCTGTACTCAGAAGTGGAATTGCTGG
ATTGTATGGTAATTCTGTGTTTAATTTTTTGAGTAACTGCCATACTGTTTTCTGTAGTGG
CTACACCATTTTACATTCCCACCAACAGTTCACAAGGGTTCTAATTTCTTTATATCATTG
ACCACACCTCTTATTTTGTTTTGTGTTTTTTTAAGGATTGCCACCTGGGCGAACAACTGT
TGCCAATTTTTTTTTTTTTTTTCCTGCTTTATCTCCCCAACTCCCCCTCCCCCCGTATAT
AGTTGTATATCTTAGTTGCAGGTCCTTTAGTTGTGGGATATGGGACGCCGCCTCAGCGTG
GCCTGACGAGCAGTGCCATGTCTGCACCCAGGATCAGAACCCTGGACCACCGCAGTGGAA
CGCGCGAACTTAACCACTTGGCCATGGAGCCGGCCCCTTATTTTTTTTTTTAGGATTTTA
TTTTTTTCCCCCAAAGCCCCCCGGGTACATAGTTGTATATTCTTTGTTGTGGGTCCTTCT
AGTTGTGGCATATGGGGATGCTGCCTCAGCGTGGCTTGATGAGCAGTGCCATGTCCGCGC
CCAGGATTCGAACCAATGAAACACTGGGCCACCTGCGGCAGAGCGCGCGAACTTAACCAC
TCAGCCGTGGGGCCAGCCCCTTATTTTGGTTTTTTGCTAATAGCTATCTCGAGTATTAGG
TGGTACCTCACTGATTTTGATTTTCGTTTCCCTAATGATTAGTGATATTGAGCATCTTTT
CATGTACTTATTATATATTTTCTTCAGAGAAATGACTATTCAAGACTTTTGCTGATTTTT
TCATTGGGTTGTTTGTGTTTTTGTTGTTGAGTTGTAGAAGTTCTTTGTATAGTCTGGATG
TTAACCCCTTACCGGATACATGATTTGCAAATACTGTCTTGTTCCACTCTGTGGGTTGCC
TTTTCACTCTGTACATAGTGTCCTTTAATGCAGCCTAATTTATCGATTTGTTGTTGTTGT
TGTTGCCTTTACTTTTGGTGTCATATCCAAGAAATCATTGCCACACTGGCCCCTTTGACA
TCATGCTTTTGTGTTCCTTTTTTGTGCCAGCGGATAGACATGGGTCGCTTTGATCTTATT
GGCCTGGAGGGTCGTGTCTCTAGATATGAGGCTGACACATTTCTACCCCGACACCGCCTC
TCCCGCCGGGCACTGCTCGAGGTTGCTACTGCTCCTGACCCCCCACCCCGGCCCAAGCCA
GTCAAGATGAAGGTCAACAGGTACTAGGGCTGAGGAATAAGGGGATGGGTGCCTAGAAAA
AGTGGCTACAGCTGCCTGGGGGGAGTTGGGGTGAAAAGGAAAGAGTTGGAGGCTAGGCCA
GAATGTTTGTATGGAATGGATGCAAAATACTATGGATGGATTGGGGGAGAGAATAAGTAG
AAGTGGGTCCCACGCCTTTGTATTTGTCACTGATTTTTTTTTCCCCCTCCCTCTGTTTGG
TGCTTTTTGGTTATCTTGAATTTCTTTCCCTCTTTCTCCTTTGTGTCTTTTTCCTCTCCT
CACTTTGCTTTTATAATCTCTGTCTGTCTGCATCATCTTCCTTATTCCTTTCTTTTCCTA
ATCCTTATTCTCCCTTTACCCCCTACCCACTCCCTTGTTTTTTGCTCACAGGATGCTGCA
GCCAGTGCCCAAGCAAGAAGGCCGGACAGTGGTGGTGGTGAACAGCCCACGGACCCCCCT
GGGCCCTGTCCCAGTTCGACCCCCTCCAGGCCCTGAGCTCTCAGCCCCGCCTACCCCTGG
CCCGACCCCCCCAGTGCTGCCAGCACCACTGATGGTGTCAGCCTCACCTGCTGGGCCCCC
GCTTATTCCAGCATCCCGGCCTCCTGGCCCTGTTCTGTTGCCCCCACTGCAACCAAACAG
TGGTCCTCTACCCCAGGGTGAGTTGCAAAGGAGCCAGGATACTGGGGGGGTGCTTCAGGC
GATTGTTCAGATTGGGAAAGAAGTAATGAAATTAGTGTTTGAGCAGCTGGGTTGGAGTCA
GGGGTGTGGTGTTTGACGGGCTGGAAAGGAGTATGTATGGAGCCTTCTGGGAGCAGGCTA
AGGCTCTAGTCAGGGTATATCTGACAGGTGTTTGCTTTGTGTCTACAGTGTTGCCATCCC
CCCTGGGGGTCCTGAGTGGGACCTCACGGCCTCCCACGCCAACCCTGTCCCTGAAGCCGG
CCCCACCTGCCCCTGTTCGCCTGAGCCCTGCCCCACCCCCAGGCTCTTCCAGCCTTTTGA
AGCCCCTGACAGTACCACCAGGCTACACCTTCCCTTCTGCTGCTGCCACCACCACCTCTA
CGACCATAGCCACTGCTCCCACCACAGCAGTGCCAGCACCTACTCCTGCATCACAGCGCC
TCATCCTGTCTCCTGATATGCAGGCTCGCCTGCCTTGTAAGTTCCCAGGGCTCTGTGAGG
GTGAGAGACTTGAGATGGAGGAAGGCTTATATGCCATGGAGCTGTAGAAGAAAAGCTTGG
GAATATGAGAGTATCAAATTCTAGGTAGCTAATATATGTTAGGTATTTTGCCACACATTG
GTAATTCATAATCAAGTAAGAGCCCTTGAGGAGTTCACAGTCTGGTGGAGGAGATAACAC
ATGGATAAATAAATAGTGGTAAGCCTAGCAAGAGAAAATTGTTTGGGATAAAAGGGCAGT
GTAGAGGAGGGGGTGGTGATTAGCTCAGTATGGTAGCAGGCCATTAGAGGATGTGAAGGA
GATGGTTAGGCAGACAAGTGGGCTTGGAAGGAGTAAGTAGCATGTCAAAAGTTCAAAGGC
TGTAGATTAAGACCAAGTTTGTTGGAATATGGTAAATTGAGGGGATGGGTCGGAGGAACT
GGAGACGTGTGCCTCATGAGGGTCTGAGAAGTGGTGTTGAACAGAGTGAGCGCTGTGTAC
ATTAAGCCCCTTCTTTGTTCATAGCAGGTGAAGTGGTCAGCATCGGGCAGTTGGCCTCAC
TGGCACAACGTCCAGTGGCTAGTGCAGGGGGAAGCAAACCTCTCACCTTCCAAATCCAGG
GCAACAAGCTGACTTTGACTGGTGCCCAGGTGCGCCAGCTTGCTGTGGGGCAGCCCCGCC
CGCTGCAAAGTAGGTAAAACCCACCCCCGTCCTGCCTTTTTCCTCCTCTTCCTTGTCCCC
TTGTTTTTGTGGCTCTTCAGATGTCAGCCTTTATGTTTCTTTCCCTAGCTTTTGGTGGGT
GGGGCCAAGGGGAATGGTTGGAGGGGGTCTTTTAATAAAGGTAGGGATGAGGTCATTCTA
GAAAAGTTATCTTCTCTCTATTCTTTCTTTCTCCTCTTGCCCTTGCCTCTGTCCTCCTCC
AGCTGATGGCTGCTTCTCTCTCTCTTTCTCTCTTCCCTTAACCCAGGGAATGTGGTGCAC
CTGGTGTCAGCAGGGGGGCAGCACCACCTCATCAGCCAGCCTGCCCATGTGGCCCTCATC
CAGGCCGTGGCCCCGACCCCTGGCCCTACCCCTGTCTCTGTGCTGCCTTCTTCGACCCCC
AGCACCACCCCTGCCCCTACTGGCCTCAGCCTTCCGCTTGCTGCTAACCAGGGTGAGGCT
CCTGGCCTTCCTACTTACTTAGCCCTTGCTGGCCTTGGTCTTTCCAGGCATACCGTGGGC
TACTGTCTGTCCAGCCTTCCCTCAGTGTTGCTTTCCCTAGCCAGTATCTTGGATATCTTT
CTGCTACCCTTTCCTGCCCCTGGACTACTTCTATCCTTTGGGTCTCTTGTTTCTTTTCTA
CCTTCCCCTCAATGTAGCTTCCTCTTGCAGTGCCACCAACCATGGTGAATAATACAGGCG
TGGTGAAGATTGTAGTGAGACAGGCCCCTCGGGATGGACTGACTCCTGTTCCTCCGTTGG
CCCCAGCACCCCGACCTCCAAGCTCTGGGCTTCCAGCTGTGTTGACTCCACGCCCCACAT
TAACCCCTGGCCGACTACCCACACCTACTCTGGGTACTGCCCGGGCCCCCATACCCACGT
CCACTCTGGTGAGGCCCCTTCTCAAGCTGGTCCACAGTCCTTCGCCCGAAGTCAGTGGTG
AGTCCAGGTGGCTGAGGCCAGAAATTTTTGTCAGGAATGGAGATAGGGTGGCCCTGAGGG
TTTCTTAGTCACGACAGATCTCTTAATTATCAGCATACTGATTCATTTTGCAGTGAGCCC
CAGAACTGGGCTGTGGAGCCCTTGCCTAATTCCAAGATACATTTCTTGGATCCTTGGAAA
GAAAGGAAATGTTAAGTTGTCAGATTCTTTGGATCTTTGACCTCATGGTGTGGGAGTGAA
GGTTTTTTGGGAAACAGGTGAAGCTGGGCGGGTAGGGTAAGGGAAAGGGTGGGACAGGGT
AATAGAGGGAGTAACTCTGGGGCTAACTCATCCTCTGTCTCCACAGCTTCAGCACCCGGA
GCTGCTCCCTTGGCCATCTCTTCTCCTGTCCCTGTGCCATCCTCACTCCCTGGGCCAGCC
TCACTCCCTGGGCCAGCCTCTTCTCCAGTGCCAGTTCCCAACTCCTCTACCCTTGCTAGT
CCTGTGTCCTCTACAGTCTCACTTCCAGTGTCATCTTCACTCCCCATCTCTATCTCCTCC
ACACTTCCTGCCCCAGCCTCCGCTCCAGTCACCATTCCCATATCAACCCCCTTGCCTGTT
TCGCCTTCGGGTCCAGCTCTGTTGACCAATGTGACTCCAGCACTGGCACCTGTTGTCTCA
GCGGCTCCTGGACCTCCCTCTTTGGCACCAGCTGGGGCTTCCCCGTCAGCGTCAGCCTTG
ACTCTAGGTTTGGCCACAACTCCATCCCTGTCCCCATCTCAGGCACCGGGTCACCCTCTG
TTGTTGGCTCCAACCTCTTCACACGTTCCAGGGTTGAACTCAGCCATGGCCCCAGCATGT
TCACCTGTCCTGGTGCCAGCTTCTGCTCTGGCCAATCCTTTTCCGGCAGCACCAAATCCA
GCTCCAGCTCAGGCTTCCCTTCTGGCTCCAGCACCTTCTGCATCTCAGGCTCTAGCCACC
TCTCTGGCTCCCATGGTGGCTCCACAGACAGCAATCCTGGCGCCTTCTCCAGCTCCTTCC
CTGGCTCCTCTTCCAGTCCTGGCTCCATCGCCAGGTCCCGCTCCTGTACTGGCTCCATCG
CAGACTCCAGTTCTGGCTTCATCATCTACTCCGGGAACTCCTTTAGCCTCAGCTCCTTCA
CTGGTGCCAGCCCCACCTCCTGTGTTGGCTCCATCATCAACTCAAACTATGGTACCAGCC
CCAGTTCCGTCACCTCTTCCGAGCCCGGCTTCTACACAGACACTGGCCTTAGCTCCAGCT
TTAGCATCCACTCTTGGTGGCTCGTCTCCTTCTCAGACACTCTCTTTGGGAGCAGGGAAC
TCCCAGGGGTCCTTTCCAGCTCAGACATTGTCATTGACTCCAGCATCATCACTAGTACCA
GCTCCAGCCCAGACACTGTCTTTGGCACCAGGACCACCACTGGGTCCATCTCAGACGCTG
TCTCTGGCTCCAGCTTCTCCGATGGGCCTGGCCCCAGCTCACACGCTGACTTTGGCTCCA
GTATCATCATCTGCTTCACTCCTGGCCCCAGCTTCAGTGCAAACACTGACCTTGAACCCC
GCCCCAGTTCCAGTGCCCACCTTGGGCCCAACTGCAGCTCAGACTCTGGCACTGGCCCCA
GCCTCAACACAGGCCCCAGCTTCCCAGGCATCCTCCCTTGTGGTTTCAGCATCTGGCGCC
GCTCCCTTGCCTGTCACCATGGTATCCCGGCTGCCTGTTTCCAAGGATGAGCCTGAGACA
CTGACATTGCTCTCTGGTCCCCCCAGCCCTCCCTCCACTGCTACCTCGTTCAGTGGTTCC
CGGCCTCGACGCCAACCCCCACCACCACCTCGTTCCCCTTTCTACCTGGTAAGTTTTACT
GCCTCACAGGAGAGGGAAAGGAAGTTGAGTTTCTTTGGAGTGTTGGTAGAGTAGATGGAA
CAGAATGTCACTTTTGTCTTGGTAAATTACAAAGCCTAGTTTTGTGGACCTAATACTTGA
GTACCATTGGACAAGTCCCTTCTGTTCCCTGAACCTGTACTCTTACCTGTAAAATGGGAG
TAATAATCCATGTTCTATGTTTCTCAGAGGGGAGTTGAGGACCTAATGTGCTTTTATTTT
TTGTGAGGAAGATTGTCCCTGAACTAACATCTGTGCCAGTCTTCCTCTACTTTGTGTATG
GGACGCCGCCACAGGGTGGCTTGATGAGCGGGATACCAACCTGCAAACCCCGGGCCAGTG
AAGCGGAGCACACGAACCTAACCAGTACACCACTGGGCTGGCCCCCTAATGTGCTTTTAA
AACTATTTATTACTGATGTGTTCAAGGCTTCCTTGTTACTGTTGGCCTCTTTGGTTCTTG
CTTACTCTTTTGAGTGTTAGCATCTAATTGCCTCATTTTACAAGTGAAGAAACTAGCCCA
CTAAATGATGTTACAGAGGTTACGCAACTTTTGAGAACAAAGTTGGGCTGACTCCATTCC
CCACGAGGGGCAGTCCTCAGAGACAGGAAAACTTTTCTCACTTGTTAAAACCACCACTAT
TGTCAAATATTTTAACTTCTAGGGCAGGGTGACACCATGGACTACAGTTCCCTAAAGATC
ATGAGCCTCTGACTTTGCCTCTCATCTCTTGTAGTTTTTTACCTCCATGGTGATTAAGTG
GGCAGTAAGAACTCTCTTCCCTGTCCGTTGATGAACTGTTAAACATTTTTTTCTGTCATA
TATATATTCTGTATGTGTTTGGTTAAGTTAAACTTAAAACTCAGAGTAAATAACCCCAGG
AACAAATAAGGAGAAGGTCTAGTGAGTCCCTCCAGGCCCTCTTGTCTTTTTCTTACTCTT
ATTAGAGCTGCTTCTTATTCTTTGCTCAGTCCCTCACACTCCATCGGTGCCACCGACTCT
ACCTTTGATCTGTTTCTAATGCTGCATGGTTGGTCTGGCTTGTTGGAAGTAGAAGAGAGC
CTAGATCTAGCCCAAGGGTGATAACTTCATGGTTTGCTAAATTTTGTTGCTCTGCAAGTA
CGTAGCAGCTTCTTGAGTTCTTTTTCTTTAAACAGTTTGAGGTGTAAATCACATACCATG
CAGTTCACCCATCTAAAGTGTGTACAATTTAGTGGCTTTTAGTATTTTTACAGAGTTGTG
CAACCATCACCACAATCAACTTTAGAACATTTTCATGGCCCTAAAAAGAAACCCCACACC
CTTAGCCATCATCCCCTAACCCCTCCATCCCTCCTTGCTCTAGGTAACCACTGTCTGCTC
TGTCTATAGATTTGCCTGTGGAGTCATATAATACATGGTCTTTTGTGACCGGCTTTTTTC
ACTTAGCGTAATGTTTCTGAGGTTCATCCATGTTATAGCATACATCAATACTTTATTTCT
TTTTATTGCTGAATAATATTCCATTGTATAGATATATACCACATTTTATATATCTATTCC
TCAGTTGATGGGGACATCTGGATTATTTTTGGCTGTTATCAATAATGTTGCTATGAACAT
TCATGTATAAGATTTTGTGTCTTTTCATTTGTTTTCAGTTATATTGGATGTGTACCTAGG
TGTGGAATTGCTCAGTCATATGGCAACTATGTTTAACCTTTTGAGGAACTGCCAGACTGT
TTTTCCAAAGTGGGTGTACCATTACATTCCCACCAACAGCCTGTAAGGGGTCCAGGTTCT
CTACATCTTTGTTAACACTTGTTAATGTCTTTTATTAATTATAGCCATCTTAGTGGGTGT
GAATCTTGTGGCTTTGATTTGCATTTTCCTGCTGGCTAATGATGTCGAGGATCTTTTCAG
TGGTTGTTGGTCATTTGTCTTCTTTCAAGAAATGTTTGTTCAGATTTTTTTCTCTTTTTA
GTTGGGTTATTTTTTATTATTGAATTGTAAGAGTTCTTTATTCTGGTTACAAGTCCCTTT
TGAAATACATGATTTACAAATATTTTCTCCCTTGCTACTACGTTTTTTTTTAAGTTTTTA
TTTATTATTTTTTTATTTTTCCTTCTTCTCCCCAAGCCCCCCGGTACACAGTTGCATATT
TTTAGTTGTGGATCCTTCTAGTTGTGGCATGTGGGATGCCGCCTCAGCATGGCTTGATGA
GCGGTGCCGTGTCCATGCCCAGGATCCGAACTGGCGAAACCCTGGGCCACCTAAGGGAAG
TGCGCAAACTTAACCATTCGGCCACGGGGCCAGCCCCTCTTGCTACTACTTTTGAGAGCT
GGCCTGTGTTGATTTTTCGCTCTGCTAGGATGCTTTTTTCCTCAGATCAACAGGACCCAA
GAGGCCAAGTTTAAGGTAGCAGTCAAGAAGGGAGATTTAGGACACTGCTGTTTTTTAGGA
CTATCTACTGGAGTCCTTCATTATTTGTTCATTCTAATAACAGATGTTTATTGAGAGCCT
ACTTTATGCCAAGTACTGAGCTAGATACTGGTGATTATAGTGAGCAAAATCAGATATGGC
TCATGTTACATGGGGCTTATAGTTTAGTAGGTAGAAGACATTAATCAAAGAATTATACAA
ATGTAACACTACAAGTATTATAAATGCTACAAAAAAAAAGAGTTTGGTGGAGTTTTTTGT
TTTTCCTTCTCCCTGAGGCTCCCCCAGTACATAGTTGTATATTCTGGTTGTAAGTGCCTC
TGGTTGTGCTATGTGGAACAACACTTCAGTATGGCTTGATGAGTGGTGCCATGTCCGCCC
CCAGGATCTGAACTGGCAACACACTGGGTTGCTGAAGCAGAGCATGCGAACTTAACCACT
TGGCCACCGGGCAGGCCCGAGTTTGGTGGTTTTATGGTCTGTGAAACTGGAAGCACAGAG
ATGGGAATGGATTGGGTCAAAGTCATACAGGTTCCTGTCTGCTAAGGCACCCCCCTTTTC
TCTTTGAGGGTGATGATACCTAAATGTCTGGTTAGCTGTTCCCATCTCACCCCATTCCAT
TCTGGCCACTGGCAGAAACCTTCCTGCTATGGATTTCATTAGCCCCTCTGTATCCTGGTC
AGTGATTTGGGGAAGGCTTTTAATAATTGTTTTGGATCCACTGCAAGAAGAGAAATTAAC
TTGGGTGTTCTGGAGTTAAGTGTTACATAGGAAAATTCCCACAAATCATCCATTCTATAA
GCTTATTGGGTTTGTGAATCCTAATTTTGAATATTTAAGCATTCTGTTTTGGTGGTGTGG
AAAGATTAGTTTTCTCTTGCGGAGAAGTTTCATTTGACATTGTGAAAGGAGTAACTCCCA
TTACTGACAACTTGGGAAAGCACTAAAAGCATAGTGTATTTTTTAGTCTTATGGTTTCCG
TATATTATGTTTAACTCTGGGAGGAATTGTCAGGTTTTCTTTGAGGACACTGATTACTTT
TTCTGTTTTTTTTTCTTCTCATCCCCAGGACTCTTTGGAGGAAAAGCGGAAGCGGCAGCG
GTCTGAACGCCTGGAACGGATTTTCCAACTTAGTGAGGCTCATGGGGCCCTGGCACCAGT
GTATGGGACTGAAGTCTTGGATTTCTGTACCCTGCCCCAACCTGTTGCCAGCCCCATCGG
CCCTCATTCTCCTGGTCCCAGCCATCCCACCTTTTGGACTTATACCGAGGCTGCCCGCCA
GGCTGTACTGTTTCCCCAGCAACGACTAGACCAGCTGTCAGAAATCATTGAGAGGTTGGC
AGGGCTAAGTGCTAATGGGAAGAGGGTCTTGGGGCCTCTGAGTGCATGTGTTGATTAGGG
CTGGTGAAGGTGATGGGGCCTTTTAGAGTTCCATCTTTTATACTGCTTGCCTTCTTCCTT
TCTCAGGTTCATCTTTGTCATGCCTCCTGTGGAGGCACCTCCCCCTTCCCTACATGCCTG
CCACCCACCTCCTTGGCTGGCCCCACGTCAGGCAGCCTTCCAGGAGCAGTTGGCCTGTGA
GCTCTGGCCCCGGGCTCGTCCTCTGCACCGTATTGTATGTAACATGCGCACCCAGTTCCC
TGACTTGAGGCTCATCCAGTATGATTGTGGTGAGTTCATTGGCCAGTGAGGATCCCTTGA
CCTTTTTTCCTGTCTTAGTAGCAAGACTGTTATATGAGAGGGATGCTGTATGTAAGGTCT
GTGTGGATTTCACTAAACATTAGAGAGTTTTAGGTTATGCTTATGGACCAGGTAGAGAAA
TGTAGGCCTTATGGATTCTTGACATTTATGGATTTGATGAAAGTTGACAATGTGTGCTAA
CTCATTTATTCATTCAGTGATTTATTTTGTGAACATGTATTATATTTTACTAATCATTTG
AGATGCAATGGCGAATGAGATAACAGCATAGAGTTTTTAGATTTATGGAAAAAGGTGTGT
GGTATATAAGACTATACATTAAATAGTAAATTTCCTTTTGGGAAAAGACAAGGAATCCTG
TCTTTTGGTTAGAATCCTATTGGTTAGAATGCATTTGGTGGCAGGTAACAGATAACCAAC
CAACAGTGGCTTAAACTACAGGAGCATTTATTGTTTACTTAATGAGAAATGCTGAGAATA
GTGGAGTATGGCCAGTTCAGCAGTGAGCCACGAGCCCTTCCCTAGAGCAGTCACTGACAA
AGGGAAATGGCAAAGAAGAACTATGTCTTATTTGGATCAGTCAGGATTCATTTTCTGGGA
TTGAGTTGGGGCTTGCCTTCCCTGAGATCAAGGGATCTGTGCCAGGTATCCCTAGTGTTA
ATCAGGTTCTGTTAACCAAGAATGGCTGTTGGACAGTAGCGAATAGTTTCTGTCACAACC
CTGCACAGATATTTCTATAGTAACATGTTTGGAGAGTTCCTAAATGTCTTAGGATGTAAG
AAAGCAGAATTTTTTTTCTTTTTTTTTTTTGAGGAAGATTAGCCCTGAGCTAACTACTGC
CAGTCCTCCTCTTTTTTGCTAAGGAAGCCTGGCCCTGAGCTAACATCTGTGCCCATCATC
CTCTACTTTTTATATGTGGGATGCCTACCACAGCATGGTGTTCCAAGCAGTGCCCTGTCC
ACACCTGGGATCCGAACCGGCGAACCCCGGGCCACTGAGAAGCAGAACATGCGAACTTAA
CTGCTGCGCCACCGGGCCAGCCCCTGAAAGCAGAATTTTTATTAATATGTGCTCAATACA
TATTTTAGTAAAAAAGTAATTTTATAATGTTTGAAACCATTCGGAGTACATGAATTGAAA
GTCTTTGTTAAAAGTGTTTGAATCGACTTATCAGAAATGTTACAGAAGTTATTTCTTTGT
TTGATGGAAAGTTGAAGTAGATAAGCTCCTAAGATCCTGTCTCTATAGTTCTGAGCTCAG
TGACCTTCAGTCCTTGTCTGTAAGCCATGCCATCAACAGATCTGTTGATGTCTATCCTAT
GAATCAGTTCTGTGTTTCAGCTAGTTTAACTCAGTGTGGTACTTAAACATCTCTTGCTCA
CACACCATTGAGGATTCCTTTTTTCACATTCAGGGTCTGTGTTACCCTATCCCTGGTTCT
ACTCAGGGAGGTTAGATCTAAGACGAGAACAGACTGAAGAGGGGAGCCCTTCAGGGGACA
AAACGTGAAGTTAAATACTTTTGATCTGCTAGGCTAATCGAAACCCTGGCCTAAAGCTTT
GATTATTTTTCGACTACAGCCTTCTAGTGCTGAGCCCCATTCCAGCTTATAGCTAGCTTC
CTTTACCCCTTCGTATCTCTTCAGGAAAGTTGCAAACATTGGCAGTGCTCTTGCGACAGC
TGAAGGCGGAGGGCCACCGGGTGCTCATATTCACCCAGATGACCCGAATGCTGGATGTAT
TGGAGCAGTTTCTCACCTACCACGGCCACCTCTACTTGCGTCTGGATGGGTCTACTAGAG
TTGAACAGAGACAGGTAACACAGGCATCTGCAGCCCTTAGCGGCTCACCTAAGCTCCGTC
TCCCTTTTCCAGGCCTTGGGGTCCCAGGAGGGGCCCCACTAAGCCTTGGGTCTGTTTTTG
GGGATATGTCTCCCAATACTATTCTTTTTTCCCTTTCCCTCTAGGCCTTGATGGAACGAT
TCAATGCAGACAAACGCATCTTCTGCTTCATCCTTTCAACTCGGAGTGGGGGTGTGGGTG
TGAATCTAACAGGAGCAGACACTGTTGTGTTTTATGACAGCGACTGGAATCCCACCATGG
ATGCTCAGGCCCAGGATCGCTGTCACCGAATTGGCCAGACTCGAGATGTCCACATTTATA
GGTATTGCCTAGTCTCCCCTCACCTTGCTTCCCCTTTGCTGATAGGGTTTTATTGATGTA
TTTGGCTGTTTACACATGGCTTTGATCACCCTATAGGCTTATCAGTGAACGGACAGTGGA
GGAGAACATCCTAAAAAAGGCAAATCAGAAGAGAATGTTGGGAGACATGGCCATTGAGGG
AGGCAACTTCACCACAGCCTATTTTAAACAGGTACTAAGATCTTCCAGCCTGTGCAGGAG
TGAGCTCTTATGCCTGTAGGAGTCACTCTTATTAAAGAGGGTGCTTTGGCCTCCACAGAC
CTGCCCTTTCAACCACTGGTGCTTCTGATACTTCTAAGAGCTGTCAGCCTCATAGCTGTA
GACTTCAGACCGGCATTCCATTGGCTCTGACACTTTTCTCTCTGTTCTCTCCAAAGCAGA
CCATCCGAGAGCTGTTTGATATGCCCCTGGAGGAGCCATCTGGCTCATCTCTACCCTCTG
CCCCTGAAGAGGAGGAAGAGACTGTGGCTAGCAAGCAGACCCATATCTTGGAGCAGGTGA
TAAAAGAATGGGCTATCCATAGAGCTAATGGTCACAGTGTGTATTGTCTCAGTCTGTTGA
GCTTGTCCAGGGGGAAAGAGCTGTTTCCCAGATTACAGTTGGCCTTTGGTAGTTGTGATT
AGGTTGTTTATTTGTTCACATGGTTTCATAGAAAAAAGACAGGATTAGGAGTCCTCAGTT
CTAGGTTTAAATTCCAACAGTGCTTCTTGATAATTGTGTTTGTTAAACCAAGTCTGTTTA
ATCTTCTGAGCCTCTTTTCCACTTTTCTGAAATGCTAATGACAAAGAAGTAACTGAGGAT
TAAATGGCGTAGGATGTAAGAAGTGCTTTGTACATGGTGAAAAACTCGTATTTTCCAAAT
GTTGATGCATAATAGAATCACTTGGAAAGCTTTTAAAAGGATTCATTCCTGAGCTCCCTG
TTAACTAAATCATGATTTTGGAGGGTGAGGTTTAGGCATTGTATTTTTTCAGAAGTAGAC
AGATGTTTAGGAACTACAGGTGTAGAGTATCACGGGGATGTTTTTCTCGACCAAGTGCCA
TTCCCTCTTGGCTGAGCATGCTCTAGGCTACTTCTGGAACCCAGTGACTTTGGTGTGAGC
TCTCTGGACATTCATCTCAAGGGAAAGATCAGATGTGGTTAGTCTGTCATGAGTCGTCTC
AGTGCAGAAAAGACTTAGGGATTTTTTTGTATTCAGAACTTTCTGGGACTGCTTTTCTAA
AGAGATCTAAAGGCTAACTCGAACAGAAAGGCAGTAGAGCTAGGGGTCTAAAACAGTTAT
TTTCTCCCTTGTGGGAATCCTAGTCAAATCCATTCCATCCTATGTGGACCGCTGAGTTGC
TTTGGTAGCTTTGAGGGCGCAGAAGAGAATTGAGTTCTGTTGTAAACCTGGTTTGGTATA
AACTTAGCCTCAGATTTTTGCTGGAATCAAGTCATAAGATGTAAAGTTCTTTAATTTTCA
TGGTTTTTTTACCCACACCCTTGCAGGCATTGTGTCGGGCAGAGGATGAAGAGGATATCC
GTGCGGCCACCCAGGCCAAGGCTGAACAGGTGGCTGAGCTTGCAGAATTCAATGAGAATG
ATGTGTTTCCTGCTGGTGATGGAGAGGAGGCTGGTCGGCCTGGGGCTGAGGATGAGGAAA
TGTCCCGGGCTGAGCAGGAAATTGCTGCCCTTGTAGAACAGGTCAGTGTTGGACCCACTA
GTTCTAACCTCACCCTGCGCAACTCCTTCCTCTAGACTCCATGACCCTCGTTTTATTTTC
CCTGGTGAATGTAATCAAGGGTGATGGGCCTTGGGCACCAGCTCCGTATGTTCATTACCA
CTGCTCCTCCCCACAGCTGACCCCCATTGAGCGTTATGCCATGAAATTCCTGGAAGCCTC
ACTGGAGGAGGTGAGCCGAGAGGAACTCAAGCAGGCAGAAGTGAGTATTTCTAGGGTAGG
GATGCAAGTGGGAAGCTGCTCCTTTGTACCTACTCCCCACCCTGCCTGCCTCCCTCTGAC
CACCCTTTGGGCTCTGTTGTTGGTAGGAGCAAGTGGAAGCTGCCCGCAAGGACCTGGACC
AAGCCAAGGAGGAGGTGTTCCGCCTACCCCAAGAGGAGGAGGAGGGGCCAGGGGTTGGGG
ATGAGGTTTCCTCTGGGACTAGTGGAGGCAGCCACCGGCGCAGTAAGAAAGCCAAGGCCC
CTGAAAGGCCAGGGACTCGCGTCAGTGAGCGTCTACGTGGAGCCCGGGCTGAGACTCAAG
GGGCAAACCACACTCCTGTCACATCCACCCATCACACCCGCAGCACCTCCACACCTCCCC
GCTGCAGTCCTGCCAGGGAGCGAGTTCCCCGGCCAGTTCCTAGGCCTCGACCCACTCCAG
CCTCAGCTCCTGCTACAATCCCTGCCCCAATCCCCATTTCAGCCCCAAATCCAATAACCA
TGCTTCCTGTCCATATCTTGCCTTCTCCCCCACTTCTTCCTTCTCAGATTCCTCCCTCTT
GTTCTTCTGCCTGTACCCCTCCTCCTGCCTGTACCCCTCCACCAGCTCATACCCCACCTC
CAGCCCAAACCTCTCTCTTAACTCCTTCCTCCCCTCTCCTGCTTGGTTTACCTTCTGTGC
CCGTCTCCCCGCCAGTCACCAACCTCCCTTTGGGCTTGGAGCCTGAGGCAGAGCTGTGTG
CACAAACATTGGCATCTACTGAGTCCCTGGAGCTGGCTGATATGGCCAGTTCTGAGACGC
TTACTCTTGTGCCCGCTAAGGATCTGTTGCCAGTTGCTGTTGAGATCCTGCCTATGTCAG
AGAAGAACATTTCTCTCACCTCTACTGCACCTAGCCCAACTCTGGAGGCTGGCAGTGTCC
CCAACGGTCAAGAGCAAGAGGTGCCAGAGCCTGCCGAGGGGACCATCCTCACAGTGCTGC
CTGATGGTGAGGAGGTGCCTATGTGTCTGAGTGAGAGCAATGGGCTGGAGCTCCCACCCT
CAGTGGCATCTGATGAGCTGCTTCAGGAGCCGTTGGAAGCTGACAAGAACTCAGAAGAGC
TGGTGGAGTCCCAGACCGCAACCTCCAGCCCTGAGAAGCCACAGGAACGTGTTTCAGCTG
AGGTGGCAGCCCCATCAACCTCATCCTCGGCCACCTCCTCACCTGAGGGTTCTTCACCTG
TCCGGCCCCCTCGGCGTCGCACCAGTGCCGATGTAGAAATTAGGGGTCAGGGGGCTGGTC
GGCCAGGACAGCCTCCAGGCCCCAAAGTGCTTCGCAAGCTGCCAGGACGGCTAGTGACTG
TTGTAGAGGAAAAGGAACTGGTGAGGCGACGGCGACAGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1103, 1774..1847, 2451..2713, 3920..4171, 6010..6195, 6431..6571, 7589..7811, 7927..8204, 8849..8942, 9082..9171, 9670..9858, 9949..10277, 10384..10561, 11125..11261, 11469..11638, 11753..11945, 13303..13439, 13529..13715, 15690..15859, 16251..16516, 16728..17015, 17544..17708, 17986..18171, 18390..18656, 19006..20507, 24028..24293, 24426..24628, 26304..26473, 26624..26820, 26916..27030, 27236..27355, 28346..28540, 28696..28779, 28886..29158
2660..2713, 3920..4171, 6010..6195, 6431..6571, 7589..7811, 7927..8204, 8849..8942, 9082..9171, 9670..9858, 9949..10277, 10384..10561, 11125..11261, 11469..11638, 11753..11945, 13303..13439, 13529..13715, 15690..15859, 16251..16516, 16728..17015, 17544..17708, 17986..18171, 18390..18656, 19006..20507, 24028..24293, 24426..24628, 26304..26473, 26624..26820, 26916..27030, 27236..27355, 28346..28540, 28696..28779, 28886..29158
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved