Equus_caballus Locus CCT6A
snOPY snoRNA Orthological Gene Database
Equus_caballus CCT6A
Equus_caballus
CCT6A
13
SNORA22, SNORA15
4027..4160, 8759..8895
12227
TGGGAAATTCAAAGTATCTAAAGATAACGGTGCTTGTATGGAAAAAGTTGAACTAGAAG
AGGGAGGAAGAGTTACTTTTCACCATATGCCCTTTGGCACCTTTTAAATCCTAAACAATT
TTATCTATAAAAGCAAAATACAAAGCGTTAGTAAATACCTGGTATTTGGGGGGCACTAAA
TACTAGCAAGCAATTGTGGACATCCTCCGAAATTTTTTTGTCTTAAAAAGGAGTCACCTC
AAAGGACGGAAGCCACTGCTCAATCAAGTTTGAGTTTTCAAGCCCACTTTCAGGGCTTCA
GGCCTCAACAGTTGTCCTGAGCCCAAAGGGCTGCTTCTCCTCAAATGCCATCGCACCCAT
CCTGCCTCTTTCTAAAAGCATCTAGCACTTTCTACCTTGCATTGTTATCTCTTCATCTTC
CGTAGGCTTAAAACTCCTAGGACACTGGGCGAGGGTCCTTATCAAATTCACTTCTGAATC
CCCGCAGCACCTACAACATCGTTAAGCACACGGCATACAGTCAAGAAAACTCTGGTGACA
GGGAAAAAAGCAGCAAGGGGAGGAAACACGGCACACGGCGCGAGAGCAGGAGGGAGGAAG
CCCACTTTACTCCCCGCGGCCGGCGACCTCCAGGAAACGGCGCCGGTCCTCCAGACACGC
CCAGACGCGCGGCCGACAGGCCCTGCCTGGCGCAGAGCGGCCCGCGCGCCGCCTACACCT
TCAAGTCCCGAGTCCGCAAAGCCGGGGCCCCGGCCGGCGGAAACACGCGGTCACGACGAG
CCCCTATGACCGAGCCCTCTCTCCCGTGAACACGCCCCTCCCGTGCGCAATGGCGCCTTC
GCCCAGGGCGCGAGGGGCGGAACCGCAGGCAGCAGTGAGGCCGCGACCCATTCAGCTGCG
CCGGCAGTGCTGCGGCCCAAATGGCGGCTGCGCGCGGGCACGCTGGGGGCAGGCCAGGCG
CGCCGGACTTTTCCAGAAGACGGGGATAGCGCCTCCTGGCCACGCTGAGCCGGCTTTGGG
CGTTCCGCACGTTGCTTCTCCTCCTTTTCCTCTGTGGGGTCAGCCATGGCGGCCGTGAAG
ACTCTGAACCCCAAGGCAGAGGTTGCCCGAGCCCAGGCGGCGCTGGCGGTCAACATCAGC
GCGGCCCGGGGGCTGCAGGACGTGCTGAGGACCAACTTGGGGCCTAAGGGCACCATGAAG
ATGTAAGGCGGGGCTGGCGGGGAGGGCCGGGGGCACCGCGTACCTGCGCCGCCGCGGGCC
TGGCGCTGGGGACCGCGGCCTGGAGCCTGCCGCCTCCGCGCTCGCCGCGGCGGCCCTTCT
TCCCGGCGTCCTCCCGGGTAGGACCTGTTTCCTGCCCGGGTCGTTTCCTCTTGTCGATGC
CGTCTCCGCGGAGAACAAAGCTGCCCGCGTGCGCGGCGCTTCCCCCGCGCTCTGGGACTT
AGTGACCCTGAGGGCTCAGCAGGCTCTTACTCTGAAGGCAGGGGGTGGGCGCTGCACCGT
TCCTGTTACCGGGGGCAGAGAACCAACCCCACCTGCCCAGACTCTCTAGGATCTGGGTGA
AGCTCGATCTTTGTGGGACTCTTAATTTGATCTCCCGTTGAAAAAGTCACTCTGATTCAT
TTCTGCCCATTGCACAGGCTTGTTTCTGGTGCTGGAGACATCAAGCTTACTAAAGATGGC
AATGTGCTGCTTCATGAAATGGTGAGAGGCTTCTATCCTAGGTCAGAAATGTCTCGATTT
TCCGTAGTACATTTGAATTGTCGGAAGGTTTTTAACGTTCATTCTCAAGGTGGGAGAATA
TCGTATCAGCTCGCAATAGGTGGTCTTTTAGACAGTGGAGGGAGTAGAAAAGCAATGTGA
TCAATAACAGTACTGGTAATATAATACAGTGAGGAACCCTGGGCTCTGATAGACTTACTT
TTGAAACCCTACTCTTGCCCTTTAAGGCTTTGGTTAAAGGATTGTAATGACTAAAATTAA
TTATAATAAAATCTGAAAAAACTAAGAGCAGTTGACATAATCAAGTGGGCAATATGCGAG
AGGATAGTTATACTTTTCACTTTTTGAAACAGCAATACTCTGTTACATCTCATCTCTCCA
CCTCCAACTGGAAAGGAGATAAAACTCTGCTTTGCCATGTTTCAAAGTCCCAGTCATCAA
GAATGTAAGATTATTGAAAGGAGCGGTCATTTTACTTATCCCTAAGTTCCTGAAACCTAG
CAGTTCGAATTCAAGAAAGGAAAATGACTTGCCTGTGTTTTGAGTTCAGAATAAAATTTA
GGATTTTGATAGTACTGTACCATGCCGTTAACATCCAGACATTTGTAAGTATCTTCAGAA
GGACTGGCTAACCTAGTCCTATCAGCAACTTTAGATAATGAGATAGTCTGCAAGATGACT
GGCCTTGATTCTCAAAACTGTCAGTGTTCCCAAAGACATAAAAGGCTGAGGAACTTCTAG
ATTAGAGGAAAATAAGGAGACATAAAAACCAAAAGCAGTGCAGGAGCCTTGATTGGATTC
TTTGTAATTAAGAATCTGTGGGTGACGTTGGAGATTTGCATATCCTGTTCAGAAACCCTT
CCATGTGATGATTTAGTATCCACTGATGATCTTTGCTAAGAGGGCAGTTTTTTATTTTAT
TTGTTTTTGGTCAGTGCCAAGTAATAGTGGAGGCTGCTGGGCTTTTGTTTGAGAAGATAC
CTGGTTTATTCTCACAAGAGCCCTAGATTTGTCGTAAAGAGGCATGCATGGATTTGAAAT
TGTTACTATTACTTGTTAGCTCTCTCACCTTGGGTAAACCATAGCTGAGGCTCAGATTTC
CTCATCAGTAAAGGAGAGATAATCTGAGAAGTAAGTTTATATATGAAGATGTTTTGGTCA
TCATAAACTGATGCAAAATAGCTAATGGTAAGTTTTTAAAGTAATATGGAGCTGAACATT
TGGGCAATTTATACAAATGGATAGCACTTCAGGAGGCCCTTCACACATTTTAAGGTATAT
TTGGACTGTTTCGTTTTAAGTTGTTTAAGTAATTTTTTTTCTCTTTTTACTTTCAGCAAA
TTCAACACCCAACAGCCTCCTTAATAGCCAAAGTAGCAACAGCCCAAGATGACATAACTG
GTGATGGTACCACTTCCAATGTTCTAATCATTGGAGAGCTGCTGAAACAGGCTGATCTCT
ACATTTCTGAAGTATACATGACTCTCATGTTTCTGTGATATTTATTGTGTGTAGGAAATA
ACCTGTTTTATTTATAGAAATTGATTTGTTAATAGTAACTGAGGCCATATAGTAGAATAT
AGCAAACAGGAGGTATTAAATATGGAAACCAGAGTCTTTATCTTGGTCTGACCCAAATTT
ATTGTGATCATGGACAAGTTAAGGAACCTTCCTTGGCCTGAAAGATTTTTTTATCAAGTT
ATATTGCATGTATGGTTTATATCTGTTTATAATATAAATTAATAATTAAGATCTAGAAAT
GGGATATTCAAGACTAGTCATATTTATAAGCAAAAAGTCAACCAAAAACTTAAGTAAGAA
TTCCAGGGCTAGCCCGGTGGCACAGCGGTTAAGTTCTCATGTTCTGCTTTGGCAGCCCGG
GGTTTGCTGGTTTGGATCCCGGGTGCAGACATGGCATCGCTTGGCAAGCCATGCTGTGGC
AGGCGTCCCATGTGTAAAGTCGAGGAACATGGGCACGAATGTTAGCTCAGAGCCAGTCTT
CCTCAGCAAAAAGAGGAGGATTGGCAGCAGATGTTAGCTCAGGGCTAATCTTCCTCAAAA
AAAGAATTCCACAACTTTTTTTAGCCTTGAGTAGTTCTTAGGTTAAAGCGAACCTTAGTG
ATTATTAATCTGACGTCAGGAAGAATTTCCTGGGAAGAGAGAAAGCAGACTCTTAGCCTC
CCTGTTTATTTTTTATTAGTAAATGATGTGAATTAATTTCAGATAACCTATAGAAAGGAT
ATACTGGTCCTATTGACTGCAAGTTGTTATGACATAGGTGTGGCTTTTTGGTATTACTCC
TTGTAGTTTGCACAGTGAACACCCAAGTGTGCTTTATAGTTCCCTTGGTTTTGAATCTGT
GCTAGAGCAATGTCTGTTCTTTTCCTCTGCGTTGAAAGGACTATTTATCCTTTTAAATGT
ATTCAGAAAGTCAGCACATATATATTAACTTAATTGTATTAAAGGGTATGAATGATCTGG
AATATCCCTTCAAAAATTTACTTTTTCGGGGCTGGCCCCGTGGCCGAGTGGTTGGGTTCG
CGCGCTCCGCTGCGGGCGGCCCAGTGTTTCGTTGGTTCGTGTCCTGGGCGCGGACATGGC
ACTGCTCATCAAACCACGCTGAGGCAGCGTCCCACATGCCACAACTAGAAGGACCCACAA
TGAAGAATATACAACTATGTACTGGGGGGCTTTGGAGAGAAAAAGGAAAAAATAAAATCT
TTAAAAAAAAAAAAATTTACTTTTTCATAAGCAGTATAGTTGCATCTAATTAAAGAACTG
CAGTGTTAGTCATGGTTTTAATTGTGTCTTTGTTATAGGGTCTTCATCCCAGAATAATAA
CAGAAGGATTTGAAGCTGCAAAGGAAAAGGCACTTCAGTTTTTGGAACAAGTCAAAGTAA
CCAAAGAGATGGACAGGGAAACACTTATAGACGTGGCCAGAACATCTCTACGTACCAAAG
TTCATGCTGAACTTGCTGATGTCTTAACAGAGGTATGTGTTAAATTTGGAATGTATCTGG
TACACCTATACTGAAAACCCCTGATGTTAGAAACATGAGTATACTTAGCAATTCTAGTTA
TAGGGTGCTATCTAGGGTCTTTACGGTATCATACTGTGTGAAATAAATAGGCTCATTTTT
GTGGCAGTGATAACCTGATCTGTGTACCCAAAAAGTAGAATGAGAAAATGAAATAAGAGT
ATACCTGACCAGGTGGTAAAGCTTTATCTTTATAATCAGAGCTTTCATGAAAAGGTTTAT
AAAATGGAGATTTCATTATTTAAAAAGCTTTCTGTTATCAATCTTTTTAATAAAATAATA
GGGGTATCCATGATTCTTGGTAATTACTAATTGAGATTTCAGAAATGTAAATGATTTAAG
CTTTTTACAAATAATCTATTCCATTAGCTCGTAGAAGACAACTTAGATCAGTTCAGAGAT
TTTAAAGTCAAGAAACTGTCTACTTTAAACTCACCTGAAGAAGAAGCAACATAAGTGTCT
CAACTTCTGCAAATTAAATGCATTTAATGGTTATACTCCTATTGTAGGCTGTAGTGGACT
CCGTTTTGGCCATTAAAAAACAGGATGAACCTATTGACCTCTTCATGGTTGAGATCATGG
AGATGAAACATAAATCTGAAACTGATACAAGGTAGGTGGTAGAAGCTATGAGATCCAAAG
TTTATATATTTATAGATGCTTGATACAATACATATCTTACGGCGGATTTTTTGGTCTTTG
AATTAATCTATATTGCCTAGGTATTTGATTTACTCAGTAATATTTCCCCTTGAAATGAAG
TTAGTGGTATGATGTGTTCATAGTTAGAATGATTCTGAAAAGTGAGCTACATCAGTCATT
TGGCATTTCTTTTTTCTTTTTGAGGAAGATTAGCCCTGAGCTAACATCTGCTGCCAATCT
TCCTCTTTTTTGCTGGGAAAGACTGGCCGTCAGCTAACATAACATGCCTATCTTCCTCTA
CTTTATATGCGGGATGCCTGCCACAGCATGGCTTGACACCTGATACATAGGTCCGGACCC
AGGATCTGAACTGGCAAACCCTGGGCCGCTGAAGCAGAACATGGGAACTTAACCGCTGCG
TCACCAAGCCAGCCCCTCATTTGGCATTTATTGAATTGTTGGATCTGAAGCATAATGGGA
GGCCGTTGGGGAATTAAAAATATATGTATTATTTCAGAGACCTGGTTTAAAAACAATTTT
TAAAGGAGATGATCACAGTTTGATAGCCTACAGTTGAAACTTTCTCTGCAGAATATTCTA
TACAAGTTAGGGTTGTTACTTTTGTTCGAATGGCTTGTTTTAGTCATTTTCTGGAACATT
GCCTCTTCACAATTGAACCTATCGAAGTTTCACCCAAAATCTTATTCAAATAACTGAAAA
AATAAAGCTGATTATGTGAAAATTATCAATATAGTCTCAATTCAGTGTTTTTAATTTGCT
AGCATATGTTACACCCTGTCTGGAAATCAATAACAATATAATTTTTTGTGTGTTTCAACA
GCTTAATCAGAGGTCTTGTTTTGGACCACGGGGCACGGCATCCTGATATGAGAAAAAGAG
TAGAAGATGCATACATCCTCACATGTAATGTGTCATTAGAATATGAAAAAACGTGAGTTT
CTGGCCCCTCCAGTGGTGGAGCTGGTTATTTTGGGCAAGTCTCTTTTTTTGTGAGACTGT
TTCCCCACTCTAAGGATGATAGTACCTCAGTTGGGTTTGAGAGAATTATAGGAAATTTGA
AAATGTACCAGGGTCAGGATTGGAGTTCAGTGACTATTTGTTAAATTAAATTTCAAGATT
AACCCAGTTTCTGAGGCTACTGGCTTATCTTCTATTTAAAAAATAACCATTTCCCTCCCT
TTCTGTAATTTTTTTAAAATAGAGAAGTGAATTCTAGCTTTTTTTACAAGAGTGCGGAAG
AGAGAGAGAAACTGGTAAAAGCTGAAAGAAAATTCATTGAAGATAGAGTTAAAAAAGTAA
TAGAACTGAAAAGGAAAGTCTGTGGTGATTCAAATAAAGGATTTGTTGTTATTAATCAAA
AGGTGAGAAAAATTTGGCTTCATAAACTAGTCTGTTAGCTCTTTTTTATTTTTACAGTGG
AATATGTTGAAACTAATTTTTTGTTACTGTTGTAGGGAATTGACCCCTTTTCCTTAGATG
CTCTTGCAAAAGAAGGCATAGTAGCTCTGCGCAGAGCTAAAAGAAGAAATATGGAAAGGT
ATGGCTAGCACGTTATCTGAGTGATGCAAATTTTACTTATTTTGCAACTTAATGGGGATT
ATTCCTTTTTCCCTTCTATTTATTTTTGCATTTTTCTTTTTTTATTGTGATAAAGTATAC
ATAACGTAGAATTTATCATTTTATCAAAGTGTACAATTCAGTGGCGTTAAGTTACGTTCA
CAGTATTGTGAATCACCGTTTTGCGTTTCCAGAACTTTTTCATCATTGCAAACTAAAATT
GTACCACTTAAACAGTAACTCTGTCTCTGAATTTGGGACCTCATGTAAGGGAATCATACA
ACATTTGTTCTTTTACGTCTGGTTTATTTCACTTAGCATAATGTTTTCAGAGTTCATCCA
TATTGTAGCTTGTATCAGAATCTCATTCCTTTTTAAGGACCAGTAATATTCCATTGTGTG
GATATACCACATCTTATTTATCCATGTATCTGTCAGTGGCCATTTATTTGGATATCTGCC
TTTTGGCTATTGTCAGTAATGCTGTGTGAACATTGGTGTGTACTTGTTTTATTTTGAAAC
CATGACATATCCTATACATATTTTTCTGTGTCAAAGAGAGAGCATCAAGGGGTTTCAGAG
AAGTACCTTCTTCCCAAATGCCTACCGCAATGAAGAGCCCTTGTCTACCTTTAGATTTCA
TAGCACAGAAGTATTTGCTGCCTTGGGGAGGGTGGTTTAAATGGAGAGTGGGAGAAAAGA
CCAGTTTTCAGTTGGTTGGCAGTGAATGGAAAGGCTTAAGTTAAAATACTTTTTAGAATA
TAATATGTAATTCTGAAAGATTGCTTTCTAAAAATTCCACATTCTTCTCTTTAAATGTTT
AAGTAATAAAATCACTTACACATCTCCCTTAAAACACTTGAATATTGCAGGCTGACTCTT
GCTTGTGGTGGGGTGGCTCTGAATTCTTTTGATGACCTAAATCCTGATTGTTTGGGACAT
GCTGGACTTGTCTATGAGTATACCTTGGTAAGTGTATTTTCTTTCTGAAGGTAATAATAG
ATTTTAGGTAATGAATTTTTCAGGAGTAAAAATTCATTCAAACTCAGGATCAGATTTTTG
CTTTGTTTATATACATTTTGGTGGTTTATGTGTACTAATGATAAGCCATTGATGGAAGAA
TCACATTTCTTTTATATGTGGTTTCTTTTTTTTCTTTTAAGAAATAATTTGGGGGCCAGC
CCTGTGGCCAAGTGGTTAAGTTCCTGCACTCTGCTTCAGCAGCCCAGGGTTCACCAGTTT
GGATCCTGGGCAGGGAGCTAGCACTCCTCATCAAGCCATGCTGAGGCAGCATCCCACATA
GAAGAACTAGGAGGACCTACAACTAGGATATACAACTATTTACTGGGGAGCTTTGGGGAG
GGAAAAAAAGGAAGATTGGCAACAGATGTTAGCTCAGGGCCGATCTTCCAAAAAGAACAC
TGACCAGCTTAAACTAGTTTTTAAAAAAAGAAATAATTTGCTTTAATGTCATCAGTGGTG
TTCTCTATTAATTCACTACTTATCATTCCTCCATAAGCTCCTCCCCTCTGTTCAGTCTTT
GTGCAACCATTTTCTGCTTTTGAAAATATTCTCTCTTCACAGGGAGAAGAGAAGTTCACC
TTTATTGAGAAATGTAACAATCCTCGCTCTGTCACATTGTTGGTCAAAGGACCAAATAAG
CACACACTCACACAAATCAAAGATGCAATAAGAGATGGCTTGAGGGCTGTTAAAAATGCT
ATTGATGATGGTAAGGTCCTAACTGTATTTAAATTATGTTCTTTTTGTTAGTCTAAAAGG
CATGGCTGAATACTGTGTTTTTTTATCAGTAGTTTACACAGCCAGACACCATGCAAAAGT
AAAGTCTTCTTTTAAAATAACTATGATGTTATGCTATGTTTTTTATAGCATATCATTATT
AAAAGTGGATACAAATAAATGAACTAGTGCTAAGAGCTTGCAAGAACTTAAAAGTGCTAG
TTAAATCATTCTGCTATTTGATATGTTGCTTGTATTGCTTTTAAATGTAATATTAAAATT
GCTGTGGTTATACTGAATTCTCAAGAAATTAGTCGCTTTTCATGTGTGTTTTAATTTATA
TGTTTTCTCCTAATTGATTCTACAGTTTTTTTGTAGCTTAGCATCTCTCTCTCCCCACCC
AATAGGCTGTGTAGTTCCAGGTGCTGGTGCAGTGGAAGTGGCGATGGCGGAAGCCCTGAT
TAAATACAAGCCAAGTGTAAAGGGCAGGGCCCAACTTGGAGTTCAAGCATTTGCTGATGC
ATTGCTCATTATTCCCAAGGTATACAGGCTTTAACAGTCGATTTTCTAAACTAGACTAAA
ATGATTCAGCTGATGAAAGCTTTTCGATAATGTGGGTTTTTTCATAATGTGGATTTTGAA
AAAACAAGTTTGATCAGTGTTCTCCCTAACACCAGAACAGGTATCTTTCATCATCCAAAT
GTTTTTGGTTCCTCTGGAAGGGAGACTTGAATATCTGGAAGTTTCAGATGGCAAGAGATA
ACTATTTTAAGAGGATTTGTGGTGTAGGGATTATACTTGAGTACAAGATTGCTTTTTGTT
TTTATTTGTTTTAGTTAAACTGTGTTCAAAATCATGCTTTCCTATTGTATGCTCATTTGG
GGTTATAGTTTATGACCAGTGTATTGCTGGTCTTGGGCTGGATTAGTGAGTTGATTAGTA
AAATGTTATTCTCTAAAATGAGCATAAATACTGGTCTGTTTTCATTTGTAAAGGGTTTTT
AAATTATTAATTGGGAACACTGTTCATTTATTGTACACTTGACTCCCAGTTCTTAGGTCC
TGTCTTTTAAAGGATTAAATTTGTTTGCTTTAGGTTCTTGCTCAGAACTCTGGTTTTGAC
CTTCAGGAAACACTAGTTAAAGTTCAAGCAGAACATTCAGAATCAGGTCAACTTGTGGGT
GTGGATTTGAACACAGGTAAGAGAATGCAACTGTTTGTCGGAGGAGAACTAGATAATATA
TGTGAGGTAAAGCCAGGAAAAATCAAAACTGGAGATGGAAGAATCTTGGAGAGTTGCTTT
GCAGTTTGCTACCAGCACTCTTGGGGAACTCTGGGTTCTAAAATATGAAATAAAAATAGA
ATGACTGGATGTAGTAATTAAGGGAATAGAGTAGACATTTGAATAATTTCAAAGACTGGA
TTTGTTGATGTTGCTGAGTTGTGGTAGGTAGTTCAGGTTAATATTGTAGGGTTTCCTGTT
GGGCTTGCTTTACTCTGTTTTTTATCAGGGACTTTGATAAAATAACATTAGGTGATCATA
TTCATGGGTGAAAAAAGACTGAGGATAGCAAATACTTGCTGGAATAGGGGACCAAATCTA
ATGAAATTATTAAAGCCCCAGTCTTAGAGCAGTATAACACCACAAATTATACAAGTACAA
AGTGGGAGAGAGAGAACTAAGATGCATCCATGCAGTATGTGTGAGTAAGACCTGTTGTTA
ACAGCATCATTTACATTCAAGTTAATTGAAAAGGTTTCTGGAATGAGGGAAATGGTAAGC
CCGTTTTGGCCGGATTTAGTTCAAGTGCTATCCTCTAATAGTGTGTCCAGAGAGAGAGAT
TCACCTATTGGGTAACCAAATAGAGGGTTCCAATCACGGAAGGTCTAAGTAGAGATTAGC
CACTCATCAAAGATACTGTGCACAGGAGTCATGGTTTGTACAAAATTGGACTAATTGAGG
AACTTTGGGTTCTCATAGATAATACTGGAGGAAATGAGAGTGATCAGTGATGAGCAAAGC
AGCACAAAATACTGTTGTTCTAGACAGCATTGTGATCTTATGACCTGCTGTATGTGATTT
TAAGAATACTGGGTTACTTTTCAGGTGAGCCAATGGTAGCAGCAGAAGTAGGCATATGGG
ATAACTATTGTGTAAAGAAACAGCTGCTTCACTCCTGGTAAGTTTGGGAAAACCAAAATT
AAAATAATCTTTAGGGGATCGTCATATTCTTAATTTGGTATGTTTTAGTTACCTTTTTTG
GTTACATAAAAAATGTAATCAACTGAAAGTATAGAAACTAACCTAGCCTTCTGTTGTATG
GAGAGGAAAGGGGAAACTTTATTGGATGTAGTTTGCACAGTTTAGTTGGAAATTAAGTTG
AATTAGGATTCATATCTCAAATCAGAGTCATCTGACTTTTTTTTTCCCCTTCCAGCACTG
TGATTGCCACCAACATTCTCCTAGTTGATGAGATCATGCGAGCTGGAATGTCTTCTCTAA
AAGGTTGAATTGAAGTTTCCTTTCTACCATCTGAATCATGAAGACTCTACAGCGAACCTA
AGAATATAGCTGTGGAATGTTTGTCCAAGCTTCAAATGACTTTCAAAGATTTTTTTTTCC
CTTATGAAAAAAAGAACATTGGCACCTATTCAGATTCTGAAGTTCTGAAATAATAATTAC
AGATTTTTTTTTAGTTGCACTGCAATGTACACGTATAAAGCAAGCTGTTTTTATCCAACG
AACAGAATGTTTTGCTTTAGCTTTAGTGATGAAAAATACATGTTAGATAAGCATGTAACT
ATCTTGTATTAAATATTCCTTGAAAAACAAATTTATTGGTTTAATAATTTCTTCTAATGG
ATGTAATTTAATTTATCCAGTAGTTTCCAATTGTCAAGCATTTAAGTTTAAAATTTTTAT
GCTAATATAAATAACACTTAAGTAACTTAAGGTTTTGAAAGCATCCCTGTTTCCTTAGTA
TAAATTCCTATGGATAAAACTATTGGATCAGTTGGATTTTTCATGCTTTTGAAGTAGCTT
TGCTAAAATGCTCCCCAGAAAAGTTGTAGTGGGTAGAAAGATGGGTGAACTAGAGGCAAG
AGAGTTGAAGCTGCAAGTACGAGTGGCAAAAACAAATAAAGGAGGCAAAGGTAAAAAGAT
AGCTGAAGGCATGATGACTAAGGGCTAGATGAGATGCAGCTTTCAGGCAGACCGTATTTT
CACACCTCTGAAGCTTTTCTTAGGCTGAAACATCCGTCTCAAAACCCTCCTCACCTAATA
CTGTTCTCCGACATGTTTCCACAGAATTGTTTTTATACAGTTGGTATATCTGCAGTCATT
GAAGGTGAAGTTTTGTGTTGCTAAGCTTTGTATTTTGAGAACTTGGCAGTTTTGAGTGTG
CAATAAATGTTATGTTGAAACCATTTCTGTCATCTTGTGATGGTACTCCAGGGGAATCCG
AATATAAAAGGGACAGACATCAGTCCATATGTTCAAAAGATAATGAAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1201, 1637..1700, 3056..3190, 4538..4711, 5267..5370, 6241..6351, 6622..6781, 6875..6957, 7850..7946, 8562..8709, 9125..9258, 9813..9915, 10824..10896, 11155..11227
1065..1201, 1637..1700, 3056..3190, 4538..4711, 5267..5370, 6241..6351, 6622..6781, 6875..6957, 7850..7946, 8562..8709, 9125..9258, 9813..9915, 10824..10896, 11155..11224
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved