Equus_caballus Locus RAB3GAP2
snOPY snoRNA Orthological Gene Database
Equus_caballus RAB3GAP2
Equus_caballus
RAB3GAP2
30
SNORA36
51038..51169
98041
TTATGCACACATTCTATTCAGTGTATTCCTTCAGCAAATACTTACAAGCACTACGTGCT
GGGTCCTACACTAGATACTCTGGATATAGTCTGTTCCTGATCCTGGCAACCCTCCACCCC
CACCCCAACAAAACAAAACAAACAAAAAACAACTAAGTAAGATTCCCGTTATGTTCTGTC
ATAGCACTTCGCACTTTTTTCCTGCCTAGCATTATTACAATTTCAGTTAAACAGCTGAGT
AATTAATTGCTTACCTGTGTCAGGCACTAGAATTTTAGCTTCATGGGAACAAGTATTTCA
CCTCTTTTGTTCTCTGCTTTACACTCAGCGCCTAGCGCGGCTGGCATAAAAAAGACGAGC
AACAAATATTGAATGGATGGATGAACGAATGAATGAAAAATCAAACGGATGTCGAAAACA
GAGTATAATGCAGTATAACACGTACTGTATGAGGCGTGCACAGTACTATGAGAATTTACA
GGAGGAGCACTGAAAGCCAGCCTTGACAGGGCTGATTTCCAGGAGAGAAATTAATCTCTT
CAAACTCCGAGACTCGCAGGATACCGTCCCCCACTGGCCTGACACTACTTGAACCGGGCT
TATTCTCTGTGACATGTCAGGATCGTGCCAACGTGAGGACGTCAATGAGATTGGTGAAAC
GACTCAAAGGCCGGCGCGGACAAGGTCCAATTAGGTCATCTCCGGCTAAACGCCAGAATG
AATAAAGGCTTCACCCCCAGCTGGATGCACAGAACCGGGACTAAACTCTTCCCCCGCCTC
CTCCACGTCGACGTCGCACCACGGACGGCTGGTCACGTGACCCGGACCGCTCCAGCCCGG
GCGCCTGGGCCGTCCTGCGCCTGCGCAGTGCGCCGGGGCGGTGGACCGAGCGCGCTGACA
GCTTCCGGTCCGGTTTCCCCGCCCCTGCCTGGCTGAAGCTGTGCGGGCTCGGCGGTGGCG
GCGGAGGGGTGGCGGGGGGCAGGGCGTGGGCCGGTGAGGGGACTGCCCGAGCGGGTTCCC
CAGAGCCATGGCCTGCTCAATTGTCCAGTTCTGCTACTTCCAGGACCTCCAGGCCTCCCG
GGACTTCCTCTTCCCTCACCTGCGGGAGGAGCCCCCCAGCGGCGCCGTGCGGAGGGACCC
CAGTAAGTGCCCCCGCCTCGCCGCTCCCTTCCCCGCTCTGCTTGGCGGATTCGAGGCTCC
TGCCTTTGCCCCCTGCGCCTTCCCTCTTCGCTGCGGGACGACCCCCTGCCCTTCTCGTCC
TAAAGCTCGGTCCACCCTGGCAGCGTCGGTGTTGTCTTCCTCTCGCCCCAGCTTCTCCGG
AAGCCACTCCGCCCTTTGGCCAAAAACTGCGTCTTGCTTCCTCTGGTCTCTGTCTATCCC
ACTTCCCCTAGCCCCCCTCCCTAGCTTCGTCTCCGAGTCTCCTCCGCCCTCCATCCCGGG
GTCGCCTGTTCTCCGTGATCGCATCCTCCTCTCCATTCCTTGCCAGCTGTCAGCGCTCTA
CCCTGGTATTGCCTCAACCCCCACTCTCCTCCATCCCTGGGACTGTGGCCTTCTGCGACC
TCCTCTTCCGAAAGTGTTTATCTTCCCCCACAGTCTCCCTTCTTCTAGCCCTTCCCCCCC
CATTCAGATTTAGAGACTAAATGACGGATTGACAAGTGACTCTTAAGGGGGGTGAGTAAG
CGTCTCCCAAATAAGGAAAATAACCTGTCAGGGAGTGAGCAAGAGACTACATCAGGAACT
AAAATTACAGTAACATGGCCATGAAAAGTTAATTTGCTTTACTGGGATGAGAAGCCTTCC
ACCTATTATTATCATCAAAGTGTTAAATAAGCCCTTGCTCACGTAGTATAAAATCCCCCA
TCTGATTTATTAGGTTCTGCATAGTTCCTGAGAAGTTCCTACATTTCTCCTATTGAAAGG
GTGTGTGTTTTGTGTTTATTGGTTTCTTCATATTTCCATTCTGAAGCACCTCTTTGGCTT
TGGAGTATAGTGCTGTCATTTTGTGTTATACTGGAATGGTGACTTTTATCCCACTAAATA
GGCCCCTCCCCCTTTTTAAAATTTGGAAGAAATCCAATCAAAACTATGAATTTTTACTCT
GCCAATCAGTAGGGCTGTGTATCAAATAAGGTTGGTGGTCTCTGCCCTCTAGGATCTTAT
AGTTTGCTGGGACAAATAAATTAACAGCTACTAGGCAATGTGATTGAGATATATATAGAC
AGAGATATAGATATAGATATATGAGGCACTAGGGGACAATTCCTTGAAGTGGTGATACTT
AAGCCTACCTTTAAAGTAGTAGTTAGATGGGTAAGAGAGAGGTAATAGCATGCGCAGAGG
AACGGAGGCCTGAAATGGAATGATATTTAGAAAACTAAGGAAAGCCGAATGGCTGAGTAG
GAGGATGTGAGGGAAATGTTAGGGAGGATAAGACTGTAAAGGTGGTAAGGAGCTCCATCT
TGAGAAGCTTTGTGAAAGTAGTGGGGTGCCTCTGACAGACTTTAAGCAGAGAAATGACGT
GGTCAGATTTGTACTTCATATGATCCCCAGAGTTTTTGAATACCTGTTATATGCTTTCGC
AGAAGTGTGAAGGAAAGAGAGGAAACAGGAAAATTGGTTGGGAGGTTTCCAATAACCCGT
GCAAGAAGTGATGTGAGCTTGAACTAAGCCTCAGCGGGACTTGAGAGGAAGGACTAGATT
AGAAAGATATTAAGGAAGTAGAATCTGCAGGACCTAGTGAAGATCAGGTGATGGGGTTGT
AGCTGGTGAGTGAGAGGGAGTTGAGGGTGCCTTTGGCTTTTGGCTTGGGCCACGGTATAT
ACTGAGAGAGAATGAAGGAGATAGGTATTGGACGCATTTTAAATGTCTGTGGTATGTCCA
AGTAAGGGGACCAGTCGAACGCTAGATAAAAAGGTCTAAAACTTAGTAAGGATCCCTGCC
CAGAGGTGTTAATTTGGGAGTGACCAGCAAAAAGTGTGAGTTCAGTTTCAAGGGTTATCT
AGTAAAATGAACTGAGTAGTGAAGATGTAACCTTGGAGGAGCTCTGAAGTTTAAGAGTCA
CGAAGAGATTAATGGGAGGAAGACTGAGAAACGGTATCAGAAAGAGGAAAACGAGGTGAG
AATAATGCCCCAGGAGTCAAAGGAGGAGAGAGTTTGATGACAGGGAAGAGTGGTCAGCAG
TTACCAATGCAGCAGAGATCAGCTTAGATAAGGTAGAAAAGTGCTTGGTTTTGGGAAAGA
AGATGTGACTGGGACCTCAGGACAGTTTCGGTGGAATGGTGGGAGTAGAAAGCATATTGA
TAGGATATTGAGGAGTTGAAAAATGAAGTTGACTTTCAAGGAGCCAGGTTGTAAAGATAG
TAGGTGTAGGACTGTAGACGGGGGATGTAGAGAAAAAGAACACATTTTCTCTGTCCCACA
GCCACTCCCCCGGTCCAGGTCACCGTCGTCTCTCACTTGGGCAATGGCACCGGTCTTCTT
CTAACAGATCTTCCTGCTTCCACTCTTGGTTTTCTGTAATTAGTTTCCAAAAGCGGTCAG
AGTGAGCTTTCAAAGACAATTTAGATCATCACACTCCCCCCTTTGTAACCCTCTGTGGCT
TTCAATTACATTTAATATAAAATCCAAAGTTCCTATATGGTTTACAAGGCCCTTGAGGCC
CTGCCTCCTGCCACTTCTTGCATCTCATACTCCTGTCCCCTTATTTCTTATGCTTCAAGC
ACACTTTTTTGATGTTAAGCCAGCCAAGCTCATTTGCTCCTGAGGCCTTTGCCCTGGTCC
CTGTCTCTGCCTTGGATGCTCTATGCAGATCTGTGCATGCCAGCTGCATCTTGTCATTGA
GGTCTCAACTCAGATGTCAGCATCTCAGAGAGGCCTTTTTGGTTTTTTTATTCTTTTTTA
ATTTTTTAAATTTTTTTTAAAGATCGGCACCTGAGCTAACAACCGTTGCCAATCTTTTTT
TTTTTTTCTGCTTTATCTCCCCAAACCCCCCCATACATAGTTGTATATCTTAGTTGCAGG
TCCTTCTAGTTGTGGGACGTGGGACGCCACCTCAACATGGCCTGATGAGCGGTGCCATGT
CCATGCCCAGGATCCGAACCCTGGGCCACCGCATCGGAGCGCACGAACTTAACCACTCAG
CCACGGAACCGGCCCCGCCTTTTTTTTTTTTTTCCCAAAGGTTTTACTTTTCCTTTTTCT
CCCCAAAGTCCCCCGGTACATAGTTTTATATTCTTAGTTGTGGGGTCCTTCTAGTGTTGT
GGCGTGTGGGACGCCGCCTCAGCACGGCCTGACAAGCGGTGTCATGTCTGTGACCAGGAT
CCGAGCCTGCGAAACCTAGGCCACCGAAGCGGAGCGCACAAACTTAACCACTCGGCCAAG
GGGCCAGCCCCCAGAGAGGCCTTTTTTGACCATCCAATCTAAAATAGTCCTACCTCCTTG
ATGGAATTTGTTGCTTTCGATTGTATCATCTTGTTTATTTTCATCACTGTGTCTCTACTG
TCCAAGATGGTAGTCTTGAGCCACATCTGGCTGTTGAATGCTTGAAATGTGGCAAATGCT
ACTGAGGAACTGAATTTTTAATTTTATTTAATTTAAGTAGCCAAATGTGGCTAGTGGCTA
CCATATGTGACACAGTTATAGATTCTAAAATTTAGGCATATACAGAATGAATACTTGTCG
AAGGTCACACAGTGAAGGGTAGCCTTAGCATATGAACTCAATCCTGGCAGTTGGGAATGT
AGTCATACCCTAGACATCTAGATTAATTTGCAGGATGCTTATGGGTTTGCAAATATGATT
TAATTTAGTACCCTTTTAAGTCAAATTCTTAGGTTTATGTATGTTGGTATTATTATGGCT
ACCATCAGTTCAAGAAGAAAATAAATGGAGAAAGAACTTCTTAATCAGTGAGCCTCTTTG
CCAAACCTGTATTTCACCCTTAAAATGGTGCTTTAATTTACACATAAAAATCAGAAAAAT
AGCTTGTCCTACTGTAGATAATTTACTTGGGATTCTTGGAATGACCAGGGCTGTGGATTT
CAGCAGTCACCCCAGGCCATCTTTTACAAAACATCAGGTTTTGTAAAGAGCTCTTCCTTA
AGAAAACCTGAACCTTAACTTTTGTGAGGGTGAAAATTTAGAGCGTAAAAATGAAGTTAG
AGCAGGTAAGCAGGACCTGCCTTAAACTGCAGACGGTGTTTGGCTTTGCTGCTTCTCTTT
ATTTATGAGTGTGATAAGTGATTACGTTATTGGGAAGCAGAAATCAAGAGATCACTTTAT
TTTCCTAGCCTGTATAGTTTTAAATTCTTAGCCCAGCTCATCTCTAGGGGCTATGTAAAA
CCAAAAAAAGAAACCTCAATTACTTGTCATGAATTATTTGTCCTAGGTAAGTGATAATTT
TGAAGGCTTACCTGTTGGTTTAATGATTCATTTATTTTAATGTGGATGGCTGCCATAGTG
ATACTTGGTACTTGGGCACCCAGGACTCTGTGCTACTCTCTTCTGTATTTGAATTGTCAG
AGAATAACAGTATGACTTTATATTACTTTGTGTCTTCAATTATAAAAAGAGTCTGTCTTC
TGTTGCTTTAAAAGAGATCTTGAACCTTACTAATTCCCAATGTTTAGTGATAACTATTAA
AATTGTTTCTACTCAATCAAATGCTGTCTATTTCAGACAAAATTTAGTCTCATGCTTTGA
AATATTAGAGATGGTAGTAGTGTGGGTCCCCACTTAATCTACGGTGACATAATTTCCAGT
AAGACTCGATTTCTAGACCAGAGCTTTCTGATGTTAATAATTGAGTTGGGGAAAAAAAAT
ACATGTACAAAGAGGGAAAATCAGAATATTTGGAGGTAATTTGGGTATTATAATATTGTG
AATCTCTTAATTTACCTAATAGTAAAATAATTTCCTATTGACATACTAAAAATGTAGACC
AGCTTTCCTTCTTATCTCTTTTAGCAGAAAGATAAAGGATAAAGCATGCAGGGAATTACC
TTGGAGTCATCAATTAAGGTCATGTTTTAATGCAGTCACTGAGAAAAGTGTGCTTTTTAG
GATAACCTAAAATTATGGAATTATTTTGCATGATGGGATACTACCCAGGGTATAAAATAC
CCATTTTTTATACTTAGGGAAAATGCTTTTTCTCATTTGAGGTCATACTGGGGAGAGAGA
AGTAATCTGGAAGTAGAACATTTATGGGAATTTCAGAAAATTTATAGAGTTATTGGCTTT
CGTTAGCTATTTAAAATTGGAAGAGGCTCTTACAGATAAAATTTTATCAATGAGGAAATT
TAGACATGAGCAATCTAATTCCTTCATTCAGCCAATATTTATTGGGCACCTACTATGTAC
TAAGCACAAAGCAGTCTTAAAGGTAAATAAAATTGGTCCTTCTCTTCAGGGAGCTTTCAG
CCAGTAAAGGAGATAAGTAGGTAAAGTTTTATAGTTTTACGTCTTATATTTAGGTCTTTA
ATCCATTTTGAGTTAATTTTTGTGTATGGTGTAAGATAAGAGTTCAACTTCCTTCTTTTC
TATATAGATATGCAGTTTTCCCAACGTCATTTGTTGAAGAAACTGTCCTTTCCCTATTGA
GTAGTCTTGGCACCCTTGTCAAAGAACATTTGACCATATATGTATCTGTTTATTTCTGGG
CTCTCTATTCTATTCCACTGGTCTGTTTGTCTGTCTTTATGCCAGTACCACACGATTTTG
ATTACCATAGCTTTGTAATGTGTTTTGAAATCAGGAAGGAGTCATCCAACTTTTTTCTTC
TTTTTCAAAATTGTTTTCACTGTTTAGGGTCCATGTCTTTTTTTTTTTTTTTTTTTTGAG
GAAGACTAGCCCTGAGCTAACTACTGCCAATCCTCCTCTTTTTGCTGAGGAAGACTGGCC
CTGAGCTAATATCCATGCCCATCTTCCTCTACTTTATATGTGGAACGCCTGCCACAGCAT
GGCTTGCCAAGCAGTGCCTTGTCCGCACCCGGGTTCCAAACCCGCGAACCCCAGGCCACC
AGGAAGCAGAAAGTGCAAACTTAACTGCTGTGCCACTGGGCCGGCCCCCATGTCTCATTT
TTTATGTATGCTATGATTCCAAGAAAAAGGTTGGGAATGGTTGAGCCATACAGAAGAAAG
TCTTCAAACATTTTGCCTATATACACCCCAAAAGAGTTTTTCAATAGTATGTACCCCTTG
CACAAAAGATGTAAATTCTGATATACTGTAAACATGGCCATTTAATAAATTTATATCATC
CTTTTAAGTTTATTCAGTGAATTCTAAATACTATAGGGAAGTGATACCCACCAATATCCA
TTAAAAAACCTGATAAGCACAACCAGAGGGACCTATAACTAGAACATACAACTATGTACT
GGGTTGCTTTGAGGAGAAGGAAGAAAAATATGATGATCTTCTCTAAGAGTAATTTTATAA
GTCTTTTTTTCTCCTTGAATTCTTATTTCCATTCCATTTCCTCCACAAAATGCTATTCTA
ATGTAATATAGATTTTTATTATCAGTCCAATGATTTCTCTGCAAAAAGGGATATGAATTG
AGAAGAAATAGATTTCCTGTGGTCATAAGGCTCTAAGTTTTAAAATTTTTCTTCTTACTT
GACTGATTACAATTATTATTAGAAGCAGATAACAGAAAAAACAACATACATACGTTACAA
ATTTTGATAAATGACTATTAAACATAAATAACAAGCGTTATTTGAAAATCGCCAGATGAG
AAGGATGGAGGAGTTTACAGTGTCTTGCTTAAAGAGAAATTTTTTTAATGCCTTGGAGTA
ACTCACTATAGTAATATTTGGAAGGTGTGAGAGGTGAGCCTTTATTTGGTAAACTGGGAG
AAGGTGGGGTGGGAAAGTTGGCACTTTCCTAGGCATATCTGGAAACGGAGTTTCTTAAAA
CTATCTGTTCCCAAGTAACTCTTGGCAAATTTCCATGTAATCCCCAGATACTCCTACTTC
CATCTGAAGACCCTGCTACTGCGTAAAATCTAACCTCCTCTGCCAATCTCTCCAGCTTCG
CCCTTTACCATACCACACTCACCCACCACAATTTACTCTTTGCAGCTTTCTGAACCCCAT
GCCATTTCATATCCCTTGCATGACCATTTTCTCTCCACCTCATGGACATCTATTAAACTA
TTAAGACTTGGTGAAAACTGACAGTTCTTCTGTGAAGACTTTCCTGAGTCACCTATATAG
AATGAACCAACATTCCTTCATTCTCCAACTATCATGTGCCAAATTATATCATAAAACCTC
TTCATGACGTTTGAAAGGTTCGAAAAGGAAAGCAACGAGAGGGAAAGCTTTATGACATTG
GACTTAACAATAAGTTTTTGAGTATTACAGCAAAAGCACAGGCAACAAAAGCAAAAATAG
ACAAATGGGATGGTATCAAACTTTAAAAGTTTTGTGAATCAAAGGATGCCATTGACTGAG
TGAACGGCAACCTATGGATTGGGAGGAAATATTTGCAAATCGTATATCTGATAAGGGCCT
AGTGTCCACAATATATAAAGAACTCCTACAACTCAACAGCAAAATAATCAAATAACCCAA
TTAAAAACTGATTAGAATAGACCACCTTTTCTTCAAAGATATTATATAAATGGCCAATAA
GCATATGAAAAGATACTTAATATCACTAATCATAAGAAAAATGTAAATCAAAATGACAAT
GAGATACTACCTCATACCTATTAGGATGGCTGCTATCAAAAAAACCCAGAAAATAACAAG
AATTGGCAAGGATGTGGAGAAATTGGAACTGTTTACGCTGTTGGTGGGATTGTAAAGTGG
TGCAACTGCCATGCAAAACAGTATGGAGATTCCTCAAAAAAATTAAAAAGCAGAATTACT
ATACGATTCAAGAATCCCACTTCTGGATATGTATCCAAAAGAATTGAAAGCAATGTCTCA
AAAGAGGTATTTGTACACCCATGTTCATGGCAGCACTATTCACAAAAGCCAAGGCGTGGA
AGCAACCCAAATGTCCATTTACAGATGAATGGATAAACCAAATAGGACATATACATACAA
TGGAATATTACTCAGCCTTAAAAAAGGAAATCGTATTGCATGCTACAACATGGATGAACC
TTGAGGACATTATGCTATGTGAGATATCAGTCACAGAAATACAAATACGGTATGATTCCA
CTTATATGAGATATCTAAAGTAGCTAAATTCATAGAAACAGGCAGTAGAATGGTGGTTAC
TCGGAGCTGGGGGGGAGGGAGAAAAGGAGACTTGTTTAATGGATATAGAGTTTCAGATTT
GCAGGATGAAAAGGTTCTAGAGCTCTGTTTCACAACAACATGAATATACTTAACACTACT
GAACTGTACACTTAAAAATGGTTAAGATGGCAACTTTTATGTGTTTTTTAACATAATAAA
AAAGTATCAGTGTGGTAATAAATAAATAGATCATAAAAAAATAAATAAAACAAAGCTGCT
CATGGTAGAAAGTGACCTGCCTGAGGTTCCAGTAGCCCCAGGCCCTACCTGGATGTCCTG
GGAGCTGAGAAAAATCAACATCTTGGCTCACCTGTAATCCATTTGCAGTTTACTGGGAAT
CTCTGCTCTAGGCAGAGGTTAGCCATGATGGTTTTAAGCAAAAGTATAGCATTTCAAGAT
CTGAGTTGTAGGCAGATGGATTTGGTGGCTGTGAAAAGGGTAGGTTGGGTAATTCAAAAC
TAGAGGTAGGTGACCATTAGGGAGGTGTTTGTAGAAATCCAGATCAGGGCCTTCAGAAGT
AAAGACAGGACTAAGGCAGTAACAGTGATGATGGAGTTTGAAACTTGTTAGATTTAGCAA
AGGCTAAAAGGAATTTGAGCTGAGAAATGGGATAAGCAGGCTAGTAATTTAGAGACATTT
CCTTGTCAGCAAAGAAGAGAATGGTTGGGAGTGGTGGGTGAAAGTGGAGGTAGAATGACG
AGTTAGGCTGCCGTTGCGGTATTCCCAAAGGGGAGATCCTCTTTTCCTTGGATTGGTATT
CCTCAGATGTTATTTAACAGTCTACACAGTGACAATCCTGGATTATAAACAGCAAGTAAT
TTTTGAATGACCACCAGACTAACACCATTTGGGACCACTGAGACCTTAACCTTCCTCAGA
GAAAGGAGTCCTTGAAACTCTTAAGTGTCTTCCATCCCCATATTCCTCCTTTGAGAAGAA
GACCAGAAACAGTCCCTTGAACATAGCTCACTTTTCTTTGTGCCGTGTGAGTCTAGGTCT
CACATCTGAATTCCCCAGAAGAGAGAATCTCAGGTCGAGAGAGAGGGAATTGCCCATTAT
CGCATTGCCTTTTTTTTAAGTATATAAAATCAGACACCTTCTGGCTACTCATATCCCAGC
TTCCCGATGTTAAAGCTTTACTGCTGTGCTGTCCAATATAGTAGCCACTAGCCACATGTG
GCTATTTAAATTTAATAGAAGTTAAATAAAAATAAAAATTCAGTTCCTCAGTCATACTAG
CTATATTTCAAATGCTGAATGGCCACTTGTGCCTAGTGGCTGCCTTATTGGACAGCACAG
ATATAGAACACTTCCACCATTACAGAAAATTCTACTGTAAAGTGCCACCTTGGTGAGAAT
CCTTCCAGACTTTCTGCTTAGACAATAAACACACACACACACACACACACACACACACAC
ACAAGCTTGCTGCTTGGGTATTTATTTTTAATTTTATATCATGACCTTATTTTTATAAAA
TGTATATACTGGAACATTTTTTTGGTTTACTTAATTTTGTAATGTCAGCATCTTTCCAAG
TCTGTATATACAACTCTGTAGCATTTTTTCTCACAGCTGCACATATTCCATCAGAGACTC
TAGCAGGCTTTATTTAACCATTTACCTATTAAAGAATATTTAGAGTATTTCTGATATTTT
TGCTATAAGAAAATGCTCCAGTAAACATCCTTCTGCACATCTTTATGTATGACGCTAGTA
TTTCTGTATGTAAATTTCTGGGATTGGAATTGCTGAATAATAAAAATTCACATTTTAAAT
GTTGGTCAGTTTCCAGATTACTCTAAAAATTGGTCAGGTTCATTCCTGTCCATGGTAAAC
AGAAGTGCCTATTTACACACATACTTGTCATCATGCTATATTATCAGTTTCTTTAACTTT
CGCTCTTCCGATAAATGAAAAATGGTTCTTATGTTATATTAAGGTTATCAGACTTTGTAT
TTTTTTTTAAAGTGCAGGTAATAGCAAGATTCAGCTGGTATTGGAAGAATTTAGTTTAAA
TGTAAGGAAAGTTTTCTCACAGGGACAGTAGTTGAATATTAGAATGGGTTAAGTAAGGAA
GATGTCAAATTGGCTTCTTCAGAATATGCAAAAATTAGCTTTAGCTAGTGATGTTTACAA
ACCTTCACCCACATTTCATAATGGCACACCCTGCCTCACCTTATGAGCTATGCTTTTTTC
TGCTGCTTTGGATATAATAAATCAGTAACATATAAGTATGAATATAATATACTATAATAT
GTACTAATAATATGTATTATATTCAATAACTTTGGATATAATAAATCAATAACACATACT
TATGAAGTTATAGGAAACAATTGTAAAAGATGTATAAGTTCTTTCTAATATACATAATAT
GTTATTGCCCTTAGTGACTTCCTTTCAAAAACAAAATGAATAGGAAGGAGAATAGGGCAT
ATTAAATTTCTTCAAGTCTATAGATTTTTTTGTTTTGTTGTTTTTATTAAGGCAGATCTA
AAGATTTCTTAGGTTTTTGGGCAAAGGGAGCATGTTTATTTTTATAAACTTTTTAGAGCT
GGAGGATATACTTGATTTCTGCTTTAAGATATTCTCAGTTCTGTCATTTTGTGAATTGAC
CATCAGACCATATTTTCTTTACTGAGATATAGGAGGTGAGTTATTTGGCAACAAGAGTCA
TGAGAATTTTAGAACTGAAAGGGACCTTAAAGATCTAGTCTGATTTAATCATCGTGTTTT
GAAAGAAATAAACTCTTTTGTTGAAAATGAGATGGCCTCCTCATTTTAGATTGCTACATA
TTTTTGTGCTGAAAGGAATATTCTAATATGAAATGTATCTTCCCATGTTCAGTCTCCCAA
GAAATAGGAAAAGATTAGTCATTCTGAGACATAGAAAATTAAGAAGCAGCTTCTCTATTC
TTTAGTCTTTTGTTTGTTTGTTTGTTTGTTTGTTTTTTACTTTGTATTGCTATATGATAC
TTTCCTTGCCTTGGTCAAGAAGAGCCAACTCAAATTTGTTGAACCCCTGAATTATTTACA
AGTCATAGGTTCTAAAGGTTCTTTCTCTTTATAGAAACAAATACATTATCTCTGTTTTTT
CTTGTCTCAGAAGAACGGAAATGAATTTGCTTCTGTGCTAATAAGATCTTTTATTAGAGC
ATGAAGATTAAATTGTTTTCCTTTTCTAACATTTAATGATTTTAGTTTCTCATTTAGTTT
CTGATCTTGACATACTCATATTGGAAAAAGCAAATGCTGTCAAATTAATTGCCCACTTCT
AGAATTCAATTTCCTTTCTAGCTTCAGGTTCTTGTTGAATGAAATACACTCGGTTTATGA
GGACAGACTGTTCAGAAGCAAATCAGAATAATGTATTTTTTGAATGAAATAGAGCTGTGG
AAAGCAGAATTTCCTGTCTGAGCTTTTGTTGGTAGAATAATTCATTCATTGGAAATACTC
CTAAAAAAGACATCTACAGTGTTTTTGGTGATTGAATTAAAATGTGTTTTCTCTTTGGTT
TGAAGGTTTCAATGACTATATCATTTATCAAGTGAGAAACTGAGCAGTTTTTTAATACTA
GTATAATCTGATCTCTTCAGGGAAAAAATCCTCTGCAGAAGGAATTGTAGTTCCAGTTTA
CATTTTGAAGTCATTGGTTTTATTTATTCAGGAAAAACGTTTAACTTGGTAAGAACAAGG
GTGTATGCTTATGTTACCAATTATTCTAGACAGTTCAAAATATCCTCTTCAGTGATGGGT
ATAAAAAAAAGCTAAGGATTGAAAAGTCAAGTTACTAATCAATGAGGAGGTAGTTGCTTT
TTGTTACTATTATTTATAACTTCATCTTGTTCATTTTTATTTCTCTCCATATCATATAAG
TTGGTTGGAGATGAGCTTATGATTTTTATTTATATACGGAACAGTGTGATTTAAGATGTG
GTATGAAACAAGAGTGAAGGGTAATTTCAGCAAACAAGGTGGACCAACAAAGTGTTTTAA
GCTGGCAAACTTCTTGAAAGACTCAGATCTTCAACGCAGTCCTTGATTTTGTGTGAATTT
TAAGGAAAAATTACTAAGAATGTGAAACAAATAGATTTTAAAGGAAGCTCACCCCTCAAG
AAAGATTCATCTCTCTCCCCAAATGAAAGATTCAAAACTAAGCAGATATGTCTCATGTAC
TTGGAAATACCATTTTTTCAGTAGGTTGTACAGGAAATGAGGTGGGACAGCCCAGTCAAA
GCGTGAACTTTTGAAATATGTTGCTTACAGCTGGCTGCTGTCCTGAGATAATATAGTCGT
AAAATGATGGCTTTAGGAGCAACAGCTGGCATGTGAATCATAGCATGAAGGTAACAGGAT
GAGGGAAGCATTTTCCTGACCTATTTTTAGATTGCTCCAATAGGCAATATTTGCTGTTTT
TAGTATAACCTGTTTTATTCACGGTTGGCAAAAAAGAATCTTTGCATTATACAGTATGGA
CACAATTTAAGAATGATGTGGATGTTCCTTATTTTTCTTCAAAATCATATGGTGTTTATT
TGGGAACTCAGTGTCCTTTGTAATTGTTTTTTCTAGCCTACCAAAAAATTGTTATTGAAA
GTCACACTTAATTCAGTGAGCATATTTGTTTTCTATTATTGATGCAGGATATTTTGTTAG
CAATGATACAAGTGTTGTTTTGAAATGTTGAATATCCGTTGTGTGTATATGAAATATAAA
GATCCATTAATCCATGTCAACCCATCTACTTTGATCTATGTTTCTAGAGGATCTTTTCTT
ACGTAATCAAATTCTGCCTCTTAGACTTGAATTAGAACAAAAATACTCTATTTTTCCTTT
TACTTCTTAATCAAAACCAAAGCTAAGAGTTGGTGCTTTTTAAATTATTTTGTCTCACTA
GTTAAAATGGAATGGAGTAGAAGAGAATTAGCAATATTGTAATTTTACATACAAAAGTTA
TTTGAAAAAGATGGTTTTGATCCAGAATATAAAGTCTGTGTATGTAAAGTTTAAAAAAAT
AAAGTTTTATTGTTTTGTATTTCTGTGGAAATGCAAAAGGTTTAGAATTGACAATTCATC
TTTTCATTATATTTAAAAATATTAATTTAAATCCTGCTGCTTTTGTGGGAATATGTGGGG
AAGTGTTTGGATAAGAAGGTAATTTTCAAAGACTGTACATTCATTCAACAAATATTTATT
AAGTACTTATGATGTCCTTGAAAATATTTATATATGTATGTATAAGTATTTGCACACACA
CATTATACACTTTCCCTGCCCTCCAGGGCTTAATAGTTGTCTCAACAAGTTGCACATTTA
TGATAAATCAGACAAGTTAACAATGCAGCAAGTGACCCAAAGCAGTTTATAACTAAGTTC
TGAAAGAAAAAGATGTTCAAGTGCTGTGGTTTCACAAGAGGGAAGGATCGTTGGTGGATG
CAAGAAGACTTCATAAAGAATTAATCTGAGTCCTGGAGGAGAAGTTGCATTTGGAGAGAC
AGAGACAAATGGGAATGCATTTTAGTTGGCAAATATGGAATAGACAAAGGCAAGGAAGAA
GAATGAGGAATGAGGATGGTATTTGGAGAATGATAATTCTAACAGCCATTAAGGGTGTCT
GTGTGCCAAGCACCTTTCCTAGTGCTTTGCATATATCAACCCTAACAACAGTATGAGCTA
GATACAGTTATTAACTCCATTTTGCTAAAGAGGAAGCTGAGGCAGTAAGAGATTAATTGC
CCAAGATCATATAACTTTTTAGGCGTAAACTAGGTATCCAACCCAGGCACCCTGACACCA
GAGACCTAATAGTTGTTCTAGACCTGTGCTGTCTCATGCTGTGCCACTAGCCACTCATGT
GCTATTGAACACTTGAAACGCGGCCAGTCCAAACTGAGATGTGCACTTAGTGTAAAATAC
GCATCGCGTTTTGAAGACTTAGTATGAAAAAACAATGTAAAATATCTCATGAATAATTTA
AGGTTGATGACATTGAAATGATAATATTTTGGCTGTTTTATGTTAAATAAAATATTAAAA
TTAATTTCACCCGTTTCTTTCTGCTTTTTAAATGTGGCTACTAGTACATTTAAAACTGCA
TGTGTGGCTTCAGTATACTTTTATTGGATAGTGCTGCCCACCAGAGAGTGAAGAGTCTCT
CTAGAGTGAAAAATACAAAGAAGGGTGATGGCCGCACAGGGAAACAGGATGTTCAGGATC
AGAGTAGACTGGCACTGAAGTCACCCTTGAAGTTAGAGTTCCTTGGAGGACCTGCCTCAG
ATTTGCGGGGTGGGGCCCACCCTGAAACCAGCCATCCTTAATTCACTATTTTAATCTCTT
CCATGCAGAGTTTTCAGGCCACCTAGAGAGGGAACTGCAGAAGAGACTGTAACTCTGGTC
TTGCAAAGGCAATGAGTGTGAATGCCGTTTTCTTAATTTGCTCATCAGTTTTGTTGAATT
GGACTTCATTGTAGAGGACATAGGCAGTTGACGACAGTGTCATTTGAAGAATTGCTATTT
GGAGACTGGGTGGTTGCTACTTATTTATTTAATAAATGGGGGAGAAAGCCACTTAAGATT
ATCCTGTGATTCATAGTCTAGCCTTTGACTGAAATGAGTGCCACTTAGCTCGTTAAGCAA
ACTAGGTAAATGCCAGTGGCTGTGTGATTTGATGATTTGTGGGGTCTTTGGAATTTTTTA
CACTGGACCCTGACCACTCTAAAGAAGTTGTCTTTATTCTAAATACTTTGTTAAACTGAC
TTACCTCTTAAGTTATATCAGAGCTTGGGACTTTCAAATTACCTTGGCCTATAGGAGATT
TTGATCTATTTATTCTAACAGACTATCCGGTCAAGTATTTTCAGATTTTCTTTACAGTAA
TGGATAATAAAAAGTAAGTTAGTCTTACTTCTTCATGAGTACATAGCATTTATAGACCTT
AAGGTCTTACGGTAGTGTTCCATATTGACATTAAACAGTGCACAGTTCTCAAGTAGACAT
TAAACACATTGCTTTCGTTATCCACAACTTTGATCAATGATCATCTAAAAAACATTGATA
ATGATATCAATTGAAGAACACCATCCTTCATAGAAAAGTTACCGGAAGGAAAGGTTGCCT
GAATAAAATTCTTTACATGAACGGCAAGTTTATTAGACATTGATCACCTATGTTTTCAAT
ATAAACCATCCTTTTTTTTTTAAGAGTATGCTTGGCCTCTTGCATAGTCTGAAGGCATAA
GAAATAACTTTGGTAAAGTGCTGAGATTCCAACACTTTTTAACAGCTGACAATAGCTGTC
AAGTAGCAGGCTGTAAAAACTTTATCACTGGCACTGAGTAGAAATAGCCACAAGGGTAGT
GCTCAGTTTGCAAATTTTTCCCGATTTTGTTTTTTTTAAAATTTTTCCCATTTTTAAGTT
GACTAGAATTTGGGAAGCATTTTCTTATTGTAGCATAAATAGACTTAAGATTCTAGCCCT
CAAAAACGTCTTTAACCGACCTGAGTAATAATTCTCTTTTGCCTTCCTTTAACCTCTGTC
TGTACCGTGACTTCTTTGGAAAATGTATTCCTGTGGTAGTGGGAGAAGCCTGATTAAATT
CTCTTTCCCTCTTGTTAATAGAAATTCCCCAGTCACGGGCCTTGAGAAATGGGTAAACTG
TCGTGAACACAAATATCTTGTATAAAGAAAGAATTTCTCAAGGTCTTTCTCTTCCTGGAT
GTTTTGAATTGTGCGTAAAGAGATATTGGGTCTGTGCAGAGGCAGGAAATCCAAATTGCT
GCTGTCTTCTGTTTGATTGTATGAGTCATTTGTGAATTGAGTCAGGTCCTTTTTATACCA
ATATGGAGGAGAAATAACACATTTTTTATAGTTGTGTACAGTGTTCAACAGAAGGCTTAT
TTCCTTTTGTATCTCCAGCACTTAGCACAGTGCCCAATATGTAAAAGATGCTGTGTTTCT
TGAGTGAATGAATGATTAGCTGACCTTCATGAAGTGCTTTAAATTCCACTTGGTCTCTCT
GAGATTGTGGTAATTTGATAAATACATTATTTTTGCAGCAATTTTAAAATTGAATCATGG
ACTTAGGAGTGATAAGCTTTTGTAGGTACTTTGCTTTCTTGTGTAAGAGATGGTGCGTTT
TCTAAAAATTTAAATAGGATGGCCTAATTGCCATCAGCCCACAGTAAGGCAGTTGTTTTG
GTGCAGTGGAAAAATTAAGAGAAAAAAGAGATTGCCTAACTGAATTAGATTGCCAAAGAA
CAAAGTGTAATTTTCCAAGTTACAAAACAATCTCCAAATCTCGCTATCAGTGTTTCTATT
TTAGAATAATAAGTGTTGTCTTTTGGCTTAACTGTAAGCCCCACTATTTCCTAATCTTAT
CTCCCCTCATAATTCTTAGGAGGAGTTAGTATAGCAGAATACTTGTAGCATGGGCTTTGG
AACTCAGGCCAACCTGGATTCAAACCCCGTTCCCCACTTACTCCTCTGTGACATTGGTCA
AGCTATAAAAACGAAATAGTCTGTTTTTCTCATTGTAAAAGGGGGATGATAAAGGGTCCT
TGTCACACTTAAGTGAATTAATGTCTGTTATGCACTTAGGCAGATAGAAATGCTGGACAC
ATGTTAGCTGTTGTTATGTGATAACCCCCATATGAGCATTGCATCTTTTTGCCTCTTTGC
CTTTGCCTATGTTGACCTTTTTTTTGAGTATATTTGAAGTTCAAGTTCTTGCCACTTTTT
GAAGACCTAGTTTCAGATGCCTCCTCACTGTATTTTCTCTCACTGCCTCATCCAAGTTCG
CATAGTGGTGGATCCCAGAACTCACCATGTATCATCGTCACGTCTGTCTGTCTCCTGCAC
AAGATCACAAACTCTTTAAGGATAGGAGTATGTTTGTAGTTTTCTCCATTCCTACTGCAG
AGTTTGGCACGTAGTATTTAACAGGGCATTTGTTAAATTGCTTAATTGACGTGTACATGG
AAATCTTTTATAAATTGTGCAGTGTTAATTAAATGGTAGTACTAGTTTAGGGCTTAATAT
ATGCCTAGCAAGGTGCTTGATATGTTAGGAAGGAGTTATTTGGTATTTAAGTACCAAAGA
TGAGAATATTACCACGAAGCTAATTGAGCAATGATTCCAAGTACCAGACTGTAACATTTT
TTATCATCTATGTGTAATTTATTTTAGCAACTTTTAAAACCTTATGTATAAGTGAAAGTT
CTGTTTGCTTCCTTCCTACTGGAAGTTTCTTAGATACCAAGTTCAGTCCCATCTTTTAAA
TTGATTCTCCCCCCAGAATCTTGAAGCTAATTGGTTTAAATACAATATTTTATTTATCTT
TTATTTTATTTTGATGTCTAAATCTGGATGACTAGCATTAAAAACTTACTATGTCAGACA
CTGAAGACTTTAATATACTATCTGATTTAAATCCTTATAACAACACTAGTGGATGTAGGT
ACTATTGTTTTCCATGCTTTATGGTGAAAGAACTAAAACTTACTGACATGGGGTAACTTG
TTGTACATCACAGAGTTGGTAAGTGCTGGATCCAGGATATGAGCCTAGTAATCTGGCTCT
GGAGCCTAAATTCATAATTATGCACCTGCCTGCTCTTTTCACTTTTTATTTGAATTTTAT
CTGTTTTTTAATTTAATTTGAGGTAATATATATAAAGTATCTAATGTCTGTCTCAGAGTA
GTTGCTCAAAAAATGAAAGTTTTATTTCTTCCCTTCTGATGTGAATGGTATCACATATAT
AAGAGATAAATTCAAAGATAATTATATAAAAACAAGTACCGTGAGCATCGTAAGGGTTCG
CGCTCTCTAAACCTATCTGAGATTTTTAATTCCTTGTTGCAGCGTTTGTTGAACATCTTA
TTTTAATCCAAGAGAATGTTCTTGCGTGTAAGAAATCACAGAGTATCAGAAAACGGTGGA
GAATAGTAGACCTGTCTTGTTTCAAAATTCAGTTTTCTTTTTTGCTGATACTTTGATCAG
AAGACAAGTCACTTTTTAAGACTTTTGTGTGAAATTTTAGGTGTGTTTTTTGTTGCTGTG
TATGCTTGTCTGTCTTAAGTAACAAATGTTCGTCATTTTAAGATTGTTTTAAAGTCACCT
TGCAGTTTGATTTCAATGGGGATAAACTTGATGTCCAGTATCTTAAGATCCACATAACTT
GCACAGTTTTACTGTTACGTAGATTGGAAATTCAGGTCAAATATTTCCTGATTATTATTA
CATAGAGCAAAATCCTGATGTAGTTTACCATTGTTTTCTTCCTTAATATCAACATTATAG
AGTATATATTTATATGATATTTATTATATCAGTGTTGGTTCTGTTATGTTTATAGAAAAT
TTTTAGAATATTTCAAGCTCTATATTTCATGTAAGCACTTTTTATCTTTTTAAAAATAGG
TAAATCAACAAACTGGGAAGATGATGGTTGGGGAGCATGGGAAGAAACAGAACCCCAAGA
ACCTGTAAGTCTTTCTAAATGTACACATGCTCTTTGATAGTGGCATTTTCCTTTGTAATA
ATAGTGACATATTTCAATGTTAGGTTGATATTTTAAAATCTTTGTCAAGAATGTTTTCGT
GCTTACGTAATAGTACTTAAGTAGATGCCTATTCTTAAGGATTTAATGGCTTTATAGCTA
AGTAGGCTAAATGGAGAACAGTTGTTTTAGGATTCTTTCTCCTTCACGAGTTATTCTTTT
AGACTCTTTCACTTATTCATTCAACATATATTTGTTAAGTTCCCATCGAATTCTAGTCAC
TTTTCTAGGTGCTGAGAATATAGCAGTTAGCAAGGTAGACAAAGTCCCTGTATATGTTAG
GTGTTTTCACCTCAGAGTAATGGAAAATCTAACCTAAACTGGCTTAAATAACAAGGACAT
TAATTAGCTCACAGAGAAGGAAGTCAGGGGCCGGCCTGGTGGTGTAGTGGTTAAGTATGC
TCTGCTTTGGCGGCGTGGGGTTCACTGGTTCAGCTACTGGGCACAGACCTACACACCACT
CATCAAGCCATGCTGTGGTGGCCTCCCACATATGAAGAACTAGAAGGACTTACAACTAGG
ATGTACAACTATGTACTGGGGCTATGGGGAGAAAAAAAAGAAGAAGATTGTCAACAGATG
TTAGCTCAGAACTGATCTTCCTCACCAAAAAGAAAAGCATTAAAAAAAAAAAAAGAAAGC
ACTCAGAGATAGTATGGACTCCTGGGTCGTTTGATCAGGTGATTCAGCTATGTCATCAAG
GACTTCAGTTCTTTCCTTCTGTCTGCACTGCATACACAGTGCTGACTTCGTCCTAAACCT
TGTTCCTCTCACAGGTGTGGTGTGGCCACATGTTTCTCCTTTCATGATCAGAGGGAGAAA
AAGACTGGGGATTTAATGACTCTTAGGAGTGGGGAAGAACATTCACAGAAGCCTCTAGGA
GACCTTGCCTTATTTTTTCTTGGCCAGAATTGGACCAGATACTCATTTCTGAACTAGACA
CTGGCAAAGGATATATTTCCTTCAGTGAATCATACCATCCCCTGGCGTTGAAGGATAAAA
GGGTCAGCTTCTCCTGAGGCCCATGGCCACACAGGGAAGGAGTTGATACCTGAACAAAAT
CCAGACTTTTTTGTGAAGAAAGAAGAACGAACATATATAATGGATAGGTCTTCTGATCAT
CCTCTTCCCAGCAGCTTACACTCTAATGTGGAGAAAGAAATTTTTTTTGGAAGATAGATG
AAAAATATAAATGGTGGTAATAGTTCCACAGAGAATTCAAGTGGTCATGTGGTGATCAAG
TGACTCTTGTAGATTGGGTGGTCTAGGAAGGCTTTGCAGAGGATGCGACATTTATGCTGA
GATCTGAAAGCCAGCAGGGAGTCAACGAGGTGAGGATCTGCCAAAGAGCATTGCAGGCCA
GAGCAGCAGCTCATGCAAAGGTCCTACGGCAGGAATAGGCTTGGCGTTTGAAGGAACGTA
AAGAAGGCCAGTGTGGCTTGGCAGAACTGGGACGGCCACAAGATGGGCTTAGAGGAGTAA
GCAGACCTGATGGAAGGCTTCGTGAGTTTGGAATTTATTCTAAATGTGATAGGACACCAC
ACCTACCATATTTCTTATTTTTAAAGTTCACCTTGGCTGCTGTTTGGAATAGGTTGAAGT
AGGGAGACCCATTAGGAGGCTCTTGTGGTAGTTTAGTTGAGAAATGATGGTGGCTTGCGT
TAAGTTGGTTTAGGGAAGATGAGAAATTGGTCGGATCAGGGTACGTTTAGAGATGATGAT
AAGACTGGCCTATGAGTCGGCTGTGAAGGATGAGAGAAAAGAAAAATCAAAGCAAGAATT
AACTTGTTTCATCTAGGATGTGGTGTAGAATAGGTTAAGAAAACATAATTGATAAGATCT
TGATACTCCCTGAAGTGAGTAATAGGTACCCATTCTGTTTATTTTTGTCAATGTTTGAAA
ATATCTATAATAAAAAGTTTCTTGAAAAGACCCTTCCAGGTATTTGGCTTGAGCAACTGG
ATGGATGGTATGTCATTTATTGAGTTGGGGAAGACTAAAAGAATATGTCTAGGGGAGAAA
AGAAGGAGCATCGTGTTGTAAGCAGAGCAGACTAATGTAATAGAGATTTATGGAAAAGCT
CCAAGAGAGGATTAAGAACAGGAAACCATTTCAGAAGACGTCGAGGAGAGTGGGGGTGTG
TTGGCTAGGATATGAAGGAGCTCGAGGAACTTGGTTATCCCGTCACCTCAGCAAGCAAAC
ACCGTCCCTTGCTGCTCCAGTGTTACGTCAACGTGGAGACTCACCTCTGCTCTGTCTCTG
CTTTTACTAAGACTGTGACTGGCTTCTGCTTACTCATGATTTAGACTATTTCATGGCTTT
CCTTAAATCTTTTGCGTATGCTTGTCTTGGATTCTTTCTCCTCTTTGGCTCACACTCAGA
GCTCCTATGAGCATTTTACTGAGTCTGTTTATCACCCTCCATTATTAGGATATTTGGGAA
AAGAGGACATAGTGTTTATACCAGGCCACTTCATGGGACATCAGCCAACTTATTAATGCT
GCCCTCTGGTCAGGCACCCATCAGCAGTCTAGTTAGCTGTGACAAGAATGAGGAGGAGAG
GGAAGGGGGAGGAGGGATATGTGAAAAAAAGTTTGAAGACCCTGCATGACTCTATGTAAG
CAAACCTCTCAGGAGGGGATGTGCTTTGAGAATTTCTCAGAAAAGGATCGTGTAACTCAA
GCTACCTTGCATGTGGTGTTGGGTACAGTTACTCTTAGTATTTGTTTTCTCGAATCATAG
AGCTAAGTGACTATTGTGAGTCATACAGCAAGCTCCCAAGTAAGTTTGAGGTTTTCTGTA
ATAGACCTCAGAGACATTGCATGTTCAAGGGGACACATGCATTCATGATCTCAGAGGAGG
TTCCTCTGGAACCTCCTTTGAGAGACAGTTATTATTAAATATATAAAATAGTGCTGGTGC
TGAGTTATGGTATTTATTTACAGACCCAGAGGCCTACATCTTTAAGAGTCCACTGGTACA
TAGTTGGTTCTTTGTGGAATGGATTTTTATTTGTGAATGGTATAGTTTGGGATTTGTGTG
TGAGACTAGTTTTCCTTACAATTATCTGCTACATCTTCCCTGATAATATTAAGGGGGTTA
GTTTACTGACAGTGTGTCATAGAGCTGCTCTTTGGCTCATCTAACAGTGCGTCTTCCCTA
AGTGTATACCCCTCCATGGCCTTATAACCTTTCATGGCAGAAATGACTGCTACTACATGT
TGGGGTCCAAGAAGCGAGCAGGCCTGAAGTAACGCTCTGTGAATTTGGAGTTTATTCTAA
GTGTCATCAGAAACCTCACTGTGTGGTTTCTGGGTTTTTTTGATGGGGGGTAGCGGGGGG
AAGATTAGCCCTCAGCTAACATCTGCTGCTAATCCTCCTCTTTTTGCTGAGGAACACTGG
CCCTGAGCTAACATCCGTGCCCATCTTCCTCCATTTTATATGTGGGATGCCTGCCACAGC
ATGGCTTGCCAAGCGATGCCATGTCCACAGCCGGGAACTGGGCCTGTGAACCCCGGGCCG
CCGAAGCAGAATGTGCGCACTTAACCACTGCACCACTGGGCTGGCCCCTTGTTTCTGGTT
TGTAAAGCTCACCTGGGCTGCTCTGTGGATGGGGTTGTAGTAGGCCTTTTTATTAGCTAT
GCCTCTCATTCGCATAAAGGTCTTGGGCTGGTTTATTTTGCAGTATTTAATTTTGATGTT
CCACTCTTCCAGCTGATTCTGGGTGATGTGGACAAGGGTAGCCTGGTTAGAATGTGTAAG
TGTGAATGGACTTCCTTGAAATCTGACCTGTAATGTATGTCATCTTCTCTTTGTTGGTAA
GGATATCCTAAATCTAGGGATAATGTCTTTTCACTGTTTCAGTTAAAAGCTGAAATACGC
TTCTACTCATTCTAAAACACACAAAATTAGTTGCCTGTAGATCATTTCTTCATTTGGATA
AAATTTGAATATTTACAAATGGCCCTGATGGGTGAGGGTGGCCTCTTCTCTTTGTCTTGA
TAGATTTGCTCACACTATGGTCTTGACAAATACGGCAAGTGAAACAGTATCGTTAGACCT
CATTGACAGCAATTTTGGGTACACTAATCATTCCTAACTGTTTATTATCCCCTGTTGAGC
CCTTGTACCTTGTCATGGTCCTATATACATGGTGAGGGAGAAGATACTTGGATGACAACA
AAAGTGGGCCAGGACAGTGATGTTCAGGAGTTATCTGGACGTTCAAGTTATCCTGCTGTG
TTTAAGACAGCTTCTCTGAACTTAGATCCTGTCCTCAAAACAAGACAACATCTTTGCCAA
GAGAGACTGTTTGGTGAGTGAGAACAAAAATGGCAGTATGGTCCGGGAAAAGAATATGAC
CTCTGCCTTGCACTGCAGCATCATCCAGGACTTCCCATGTGTAAGATCATTATGAGGTTT
TGCTGAGCAAAGTGTTTTATACTAGGGCTATTGGAAATGTTATTCATCTGCAGTAAGAGA
CTTCTGTTACTTCTACTATTGTCTGTGATTATGAGCAACTCCAAGGCATAACCAGCTCCA
GAGGCATAAGAAGAATAGGAGTAAATTTTGGCAGACGTAGGAAACGCAGAATTACCTGCT
CTAGTCAGGGTGTTGTAGGCGCCTAGTCAGAATGGAAAGGGAACGTTCTACTCTCCCTTG
TGTGGAACAGACAGCAGACTCACAACGTGCCTTCCCGGAGAGTCTCACTGGCAGGTCGTG
TCCACCTCCAAGGTGAGCCCAGTATTGGTAGAAGTGGAAAGTCTTGAAGTCACCTGATGT
TTGTGTCATGACCAGCAGAGGAGAGTAAGCTTTTCTTCTTTGTTAGTCTGGCATTAGAGA
GATGTTGTGTTTCAGTCTTTAGGAGGCTGCAGTGGCGTGTAGACGAACCACAGATGGAGT
AACTAAGAGTAAAGTGTAGCAGCCACTGCCACTGAATGCTGACCTGGAGGCCAGCTGCCT
GCTACTGAGTCCAGCAGAAAACTGAAAACTTCAGGGTGTTTTTTATCTCCATAAGTCTTT
TAGCTCTTTGAGAGTTAGTTTCTTATTTTTATGGCAGAAGAGAGTAAGGGGCTTTTATCA
TCAGAGAGATTTAGTTCCGGGGGTCTGGACAGGCTTTTTTAAGAAAAGAGAAAGCCTCTT
TAGCTTTCTCTCACTTTGAGGTATCAGCTACAATAAGGGCTTACTGAAGAAAGCCTATTC
TAATTCTCTTATCAGCAATAGCCAGCAACGTCCAAGAAGGGATGTGTCTGTGACACTGGT
AGGCCTAGCAACTTTAAGGATGGCTTCTGCTAAAGAAGGGGACCAATGTCTTTCTCCTAT
AGATATTTCATGCGTGTATTAGTCTGCTCAGCTGCCATAACAGAATGCCACAGACTGGGT
GTCTTAAACAACAAGGATCTGTTCTCTCACAGTTCTGGAGGCTAGAAGTCCAAGATCAAG
GTGCCATCAGGGTTGGTTTCTGGTGAGACCCTTCTTCCTGGCTCACAGATGGCTGCCTTC
TCAGTGTGTGCTACATGGCCTTTCCTCTGTGCACAACGAGAGAATGGCTTCTGGTGTCCC
TTCCTCTTCTTATAAGGATGCTAGTCTGTCAGATGAGGGCCCCGCCCTTATGACCCCGTT
TAACCTTAATTACCTCCTCAAAGGCCCCATCTCCAGATACAGTAAAATTGGGGCTTAGGG
CTTCAATATGTGAATTTGGGGGCCATGCAGTTCAGTCCATAATAATGCCCAAAATAAAGG
ATCATGTCAGCCATAATTCTTCTGTGTACAAGTGCAAAGAATAAAGGTAAGGAATTCCTA
CTTGCCCAAAAGTAAATACACGAAAGGATTGGAAAGGCAAACAGAACAGGCTCTCAAGAT
GGAAGAAAAGGCAAAACAAAGGTCTTCCACTCTGCAAACTTAATTTTAAGTGGGCATCAT
GGCAGATAGCGTCTGGCTTGGGGAGATAGGAAAAGAAGATAGTTGTACTACAATACCGGC
TGATTGATGAGCCTGGTACAAATAGTAAATAGCTTTGCTGTATTTTTTCAGTGTTACAAG
GGCTTTTAGTTGGGATTATAGTTTTTTGCTTTGGGAAAGAAGTGATTAGAGGGGAATATT
TTTCTCAGCCTCATGCTATAATGGGAATCAAGGCAGTTTGGGGAGAAGCGTGACAAGGTT
TAATTTAATTTTAACTGGAAGGCAGATTTAATGAGCTTTCCTTCTTTGGTGTATTAAGAC
CAAAGGTAGGAAGTATAGAATCAAGGATTTGCTTGGCAGTGGTTTCTGGAACAGGAAGCA
CAGAAGGTTCTGGCTTAAACTTCTCAGTTAAGGTAGACAGCATGGAAAATTTCCGCTCAA
AAGACACTTTGGAATATGCTCCATCTGTTTACAGAAAGTAGCGTAATACAGTTTACAGAA
GCAATTATAATCTAAAAGACTAACAGGGAATGAAAGCATGCTGGGCAGATAGAGGCCCCA
GAGAAGTGTTTGCTTACAGGCTGAGAAATGGAATATAGCATGACCTGATTAGAGATTCTT
AGAGCATTAATAATCTGGAATAATTCTGAAAATACTTTGCCTTATTTTAGTGTCATTAGA
TTCTGGTGCCATCTACCACACAGGAGACATTAGCACCAAATTGACCAGAGGCTGAAGGAG
AGGGCTCAAGTTATATTAAGAATGTGCCCTAGGTTCTCCTTGGGTGAGAGGCTAGGGGCT
GCAGAGGATCTCCTTCCTAAGGGTGGGTTTTCATTGAACTTTGGGCCTTTGACTGTTAGA
AACACTCATCTTGCCAATGATCTTCCTCTCAACATTAATACAGTTGGGGTACAGCCTAAT
GATTCTCCACTGGGAGCGATTTTGTCCCCTCGGGACATTTGGCAATGTCTGGAGACATTT
TTGGTTGTTACAACTTGGAGAAAGTTACATCTAAGTGGGTAGAGGCTAGGGATGCTGCTA
AGCATCTTCCAATGCATGGGAGAGCCCTCCCAAACAACGAATTATCCATCCTAAAATGTC
GGTTGTGCTGAAGTTCAGAAATTTTGGTCTAGCCCATGGCTCTTATTGTGGTTCTGCCCA
TCTTTCCTTCTGCCCTTCCCTCTTTTTGTTCTCTTAAGAGAACATTTCTTAGTCTGTTTG
GGGGGCTTCAAAACTTTTGATCTTTATGACCTTTAACTTGCTTTTAGTAGATTCTGGCGA
AGTGATTTGCTAGTGTAAAAAGTGCAATTAAAGTATTGTTTACCAGAAAACAAAGGTGGG
ATCTAAGTTGTTCCTGGGTCTTTGGCCACAGACCAAAGTCATCCAGGCTCCGTCTTGGTG
GCATTATTTATGCCTAAATGTTTAAGAGAGACCTATTGTTAGTTTCTCAGTGTAGTCAGC
CACCACTTTTCCTTGCTCTTGTTTATAGTTGTTAATTTTAGTTCAGGTTTGCACTCGTCT
GGCATTCCTGCAGGATAGGGTAGCTTCTGTTAGTTTTGACTTGGTGTTGGGCTTCTGGTC
TTCTGCCGGGGAGGGAGGACAGTGATCTGACTGGGCGGAGTCGGGGAAGGGATCTGGAAA
CCTGACTGCTGTTACTAGACACACTTGCAACCAAGCCTCCTGGTTTCAGCCACATCTTTG
CCCTCCTTTCTGGAGGGACCTGCACCAATTCCTAAGCCTGTTGGCAGTTTTGCATGCAGC
TGGGGTTGCTCCTCAGCCTTCCTCTCCATCAGTTTAGGAGCTATAAAATCAGTTACCACT
TGTCCATCTGCTTTCTAGCTCTCAACACTGTGGGTTTTCTCCTCTTGTTCTTTTTGCCTG
TGCTGGGTTTTACCTTTAAACAAACTCTTTTACAGCTGTTTTAGTGGAGTTGAGAGTGTT
GGGGAGAAGGAGAGTAAAATTCATGTGTTTAATTTCTCGCTTTCCGTGAAAGTCCAGATA
GACTTCATTTTTACATACAGTTCTACCTCTTGCTTTTTCCATTTAACGTAATTTGGAGGT
TTTTCCATAGTGTGTATACATGTAAATTGTCTAGTTTTTTAAGAAAGAATGCTAAATATT
TCATTGTTTGGATAGATATACTGTGATTTATTTGACCATGTCCCTGTTGAGAGATATTTA
GTTTTTGTTCTTTTTCTTTTCTTCTTCTTTTTTTTCTGTCACAATCAATGCTGTAATCAT
TTTTACATCTACTGTGCATCTTTGGTTACACATGAGAGTGTAGTGTCATGATTGAGAGTC
AGACTGCCTGAATTTCTGTCCTAGCTCTGCCACTTAGTGACTATGAAACTGTAGGCAGAG
TTACTTCACTTCTCTGAGTTCTGTTACTTCACTCATAAAGTGGGGCTAATAACAATATCG
AACTCATAGGATTGTTAAGAGGATTAAATGAGATGTACTTAGAGTAGTACATGCAACATA
ATAAGTGCTCAATAAATGTTAGCCATTCTGATTTTCCCTTTAGAATAAATTCCTAAACTG
GAATTGCTAATGTAAAAGGTATACATATTTTAAATGTCAATAGAAATTGTTGAATGGTGC
TTCCAAAGGACTGCCCCAGTTTGTATTCCAGTCAGCCGCATATGAGAGTGCCTTTCTCTG
TTGTGTTACAGAAATAAAAACAGCTCTGAACCAATTTGTTTGTATCATTGACTGCGCTAT
TGTTTATTTTGTAAAAATGAAATATTTCTCTGTATCCGTATTTTTATCAATATTGGGAAA
CAAAAGACTATGAGAGAATGAGTGTGTGTTTTTACAGCGGGCTGCTTTTCTCAGGTATTC
TTTGAAATTTTTGACCCCTAGTATGTTATCAAACTTTAATCTTTGCTAAATCATATCAGT
GTGACATGGCTTTTCAGTATTTTAATTTGTGTTTTTAAATTTATGAGTGAGGTTGGTCGT
CTTTTCATGTTGTTCAATTATAAATCATTTTGGAGAATGTGTACTATAATCTATTTTTTT
ATAAATACTAATAGCAATTTAAGGTCCATCACATTTGGTTTAACTATTAGATCTCTTCTC
ATTTATATTAAGTGCTAATTGTTTCTTGTTTACTAGTCTTGTTTATCTAACTCGATGATA
AAGTTTTGGGGCAGGAATTGTATGGTACTTTCTTTTATCCCATGGCGCCTAGGGGAGCAC
GCAGATTTAGTATTTAATATTAAACAGTTATTCAGAAATAGAGAAGTAAGCTTTTTAGGT
TTAGAGTTTCATTGTAATTATTTGTGAAATGAATTTTTTACGAGTGATGATGAATTCGTT
CTGTAAAAATGACGCACCATTACAGAAAATTCAGGTATCGCAGAAAAATGCAAAGTAAAA
TAATCTACTTCCCAATGTCCAAAAATAATCATCATTATTAACTTTAAGGAGTTGTAAATA
TAGGCATTTTGCTATGGCTATATACAGGTCAAGTGGTTGGATGAATGGGCACACAGAAAA
TTCTATAAAAATGGGATATTATATATACAATTTAAAAATAAATAATCACATAATTAGTCC
TGCTTGAATTGACAGTTCAAGTAAAACTGTAAGAGTTACTGAATTATAATTACTTTTCTC
CCTAACCTTAGGAAGTTAATTTTTAAAATTGAGATTTAAGTTGTAGGTTTTTGTCACTAA
TTATATTTGTAAAATTTTTTTCTTTGTGTTATCTGTAATCATTTTTAGAAAGAGGTCTTG
CCTTGCCCCATTTTAATTTTGAAAAGACCTTAAGATCTTTCATTTGAGAATGTCAGTCTC
TGGTCTGGAAAGTGGCACGACCAGTACTTTTTGTCCTGTGTGAGATAGAACTCCAGGGCT
CTGCAGAGGTGCTGTAGAGCTCCTGTCTACTTTTCTGTTTCATTTGTTGAAGTTTTGTAT
AAGATTTTGTTAAGAGTAAAAAGTCCTGCTACTAAAAAGTTTGAGAAACATCAATGTTAC
ACATGTTGACAGCAGTCTAGAAAAACAAGAAAAACCTATTTATATAGTGTTACTTTTGTG
TTTCAAAATTGCTGAAGCACTTATGTCTCTTGGTTTAAAAAGCGTAGATGACTTTTATTT
CTGTGATTTAGATTGAAAACTGCTGAGAATTACTGTGAAGGTACTAACAGCCCCTTGATT
ATACTGGATTTTACTAGTACTACCATAATGTGTAAATGTCCATGAAAGTTAGCACAATGA
CAGTGACAATATAAATTGCAAATGATAGACTAATTATACTAAAGTTGAAAGCTTTGAAAA
ACTATTCTTGCTATTTCAATGGCTATCTAGTCACCACAGTAACCGATAAACCAAAAAGAA
TTTGCTACTGTGTTTGCAGAGTGATAATTCACCAGCCTCTATAGTGACCAGCAAGAATTG
AAAGCCTGGTTAAATTACTGCAATTTTACTGTCTAATATGTTGTGAAAGAATAATCACTT
AACAAATTTGTGGGCTTAAAATCAAAAGAAAGAAATTTTAAGAAATATGTGGTATAGCCC
TAGTTGTTTAGGAAGAATTCCTTTTTGTAATCCACATTGGTAGCTTCCCTATTTGTGTGG
ATTAAGAAAAATTTTTACTCGTCTCAGTTCAAAGAAAAATCCTTGAAGTTTAGGCCACAC
GAAAATAAAAATTATGCATTCGGCCAGCCCCCCCGCCCCCCACGGGGGTTATGTTTTATG
GCTAATGGATGCATTTAATGTTAACTTTGGTAGCTAGGTGGGTGCCAGTTTTTGTGGAAA
GCCAAGCTGGTACTGTTTTTGCCTTTTGTGAATTTTACACCTCACTTGGGGAATTAACCG
CCTTGTCAAATGATGGTATTATTTTAGGATCAGTAGCTTCAAGGGAACAGTCTTAGTGAC
TGTGGGCCCTATTATTGTGGGGGAGGTTTTCAGAAAACCTCATTGTCAGGCACATGCCTT
TATGGTACAAAACAAAACGACCTTGCATCTTGTCAGCCAACAGATCTGTGCTGATGCTGT
ATTTGGCTTCACAGAGCGTTTTTTTAGTCCCTCTTTCCTGCCTGAGCTTCTCGATGGGAA
TTGGAAATCAGGCTTCGCTGTAAAACCCAATACTAGTTCGTTGCCATCCAGCCTGGAGAG
TGGATTTCCCTGTCTCTTCTATACCAACACTTTTGTCCAGTTACTTGTGCTTGGACTTGA
GGCCCCACGCCCCTGAAAAATCTGAGAGGAACCCACACTCCTTATTCTTGGTTTGTGTTT
CTGCTGTGAGCCCTCCCCTGCGCCCTACCCTGGTGTTTTGAGCTGCGCCCTGACCCCAGT
CTAAGTTAGGGCTCACTGGCCCAGCCCTTGCCTTGCTGTACCCTCTATTGCCTAGAGCAG
TGGTTCTCAACCAGGGTCAGTTTGCCCCCCAGGGCACATTAGGCAAAGTCTGGAGACAGT
TTTGGTTGTCACGCTGGGGGTACTACTGGCCTCTAGTGGGTAGAGGCCAGGGAGGCTGCT
GAACATCCTGCAGTGTACAGGACAGACCCTCCAATGAAGAACGACCCTGCCCAAAGTGTC
ACCAGTGCTGAGGGTGAGAAACCTTGGCTTAGAGCGGTGTATTTCAAACTGCGTATCGTG
ACTTGTGGTGAAATCAGTTTACTGTGTCTTGACCAGCACTTTTAAAATAATGAAATAGAA
TTAAAAAATTTTGGAGTCATCCCAGTTTGTCAAGGGTAGGTATTATTTTGGGTAACTTTT
GTCTCAGTTTTGCGAGGCGGGGAGGTGGTTAGGAGGAAGCAGGGGAGGAAGTGGCTAAAT
CAGATGGGATGTAAAGTCATTTTTATTGCTACTAGTTGAAGTTTTTTTGAAAGTTTAAAA
ATGTGGACATTTGAGGAGAGCAGATATGACCAGTTAGCTTCACTGCTCAGAAAATCCTCT
GGGGACTCCCGGATCCTTCAAGATGGCTATGAGCCCCTCAGCACAGCGTGTTCGAGGTCT
TCGTCGCCGGCCTGCCCTGCAGGGCATCTGTGCCTTTCCGCTGTTGGACCTCGCGTTGGC
AGCACCTCCTCACGTGGACTCCCTTCCCTCGAGGCCTTTGAGTAAGCTGAGCTCAAGGTT
TCCTAGAGAGACAGGACGCAGGGGGCTGGTCTGGGAATATTTCCTCTGCTGAGAATGTCC
ACCTCCTCTTCCTCTCTCCTGCCATGCCCTGTCCCTTTTATTGCTGGCTGCTTTCAACTT
TATCAGCAGAACTTAGCGTAGAACTTCCTTCCAGCAGGAAGATTTTTTTCTGAAACGGAC
ACTCCACCCTCCCAGTCCCAGTCTGGTCTGCTGACCCTCCCATGTGCCGCCCTGACTGAC
TCCTGTGTATGTATCCATCTGTCTTCCCAGAGGATGGAAGAGCATGAAGGACAGGGACTT
TTTTTGTTCTTGTCTTTCTGTCCTAACGCAGTGCTAGCACATAGAGGTGTGAGCCCTTCT
GGAGCATTTCTGAGAGAGTGTTGTGCAGGACAGATTAAAGCAGGGTGAGAGAAAGATGTG
AGCCCATTGAGGATCCAGTCCTCCTCAGGGATTCTGACCCACAGGCCATTTCCTCATTCT
TCCTCTTATTTGTATTATTTGTCCAGTCCCCTGATTTTAGAGGTAAGGAACCAGAGTTGC
TAAGGAAAGAGTCCAATATGAGTATATGTTGCTTTAAATTTATTACCTATGGCATTCATG
TGATTAGTGACAATCCACTTATTCTTTCCAGGCCTTGGTTTCCTTTTCTGGACAATGACG
AGTTCGAATCAAATGATCTCCATGGTTCCTTCCATTTCTTTATAAGATTATATAATCCTG
TCAGCTGGTGAGAGAGATGGTGACGTGTTTGAGGGATAGACTAGCAGTTCCAGGCTCTTT
GATCACACCGGCTTGTGTCTACTACTACAATTTCTTAGTGAGTTAATTTATTGGTTTAAA
AAAAATTTTAGAGGCTGGCCTGGTGGTGGTTAAGTAGTGGTTAAGTTCATGCTCTGCTTC
AGTGGCCTGGGGTTAGCAGGTTCAGATCCCTGGTGTGGACCTACACATCAAGCCATGCTG
TGGTGATGTCCCACATACGAAATAGAGGAAGATTGGCAACGGATGTTAGCTCCAGGACAG
TGTTTCTCACCAAAAAGCATGCCTTTAAAAAAAAAGAATTTTAAAATGTTTCTTATTCAG
CTAAACCAATGGTTCTCAACTGTGGGTATTTTGTTCTGCAGGGGACATTTGGCAGTGTCG
AGAGACATTTGTGGTTGTCACATCTGGGAGAGTGTTGTGGGTATTTGATGGCTAGAGGCC
AGGGATGCTGCTAAGCATCCTACAATGCACAGGACAGCCCCCACAATAATCTTTCAGCCC
TAAATGTCAATAGTGCCACGGTTGAGAAACCCTGAGCTGAACCATTAAACCACCAGTAAG
GTTTTAGTACTTGCAAGGTAGAGCTTGCTCTTATGTTTCTTACCATTTCTTATACTATTC
ATGACCCTTTAAATTTGATAAATACTCCATATATGTCAATCAGGTATTCAGTGTTTATGT
TTAAAGGAAGGGGTCTATTTCATGGCTCTCTTTAAAAAGAGACATTAATGTTAAATACAT
GATCACGTTTTGCAAACAAGGTTACTTCAATGAGCCATTTGGCTGAGTTAGACTAGGTTA
GACCTGCATACTCCATGTCACTTCTTCTTTATTCTTTGTGTGTGTGTGTGAGGAAGATTG
TCCCTGAGCTAACATGTGTGCCAGGCTTCTTCTATTTTGTATGTGGGATGCCACCACAGC
ATGGCTTGATGAGTGGTGTCTAGGTCCATGCTCAGAATCTGAATCCACTAACCCCAGCCT
GCTGAAAGTGGAGCGTGCAAACTTAACCACTATGCCACCAGGCCAGTTCCTCTTTATTTT
TTTAATGAATGGGGAGCACTAGTTTTTTAATCTAAAAGTGGAGTAGAGCTTTTTGTCACC
CTCTTAATTTTGGATCCACAGCTGCAGGCATTATACCTGGTCACCTAAAGTCACACCAGC
AAGGAGAGTAGCAGAGCAGGTAAAATTTAAAGGTACTGGGGCAGATTTGCTTATAGGGCC
CAGCTTCCCATGCAGCAGAGCGTGGGAAGCAGCACAGAGGATTGGCAATGCAATTGAACT
CCAGTACCTGGATTCAAATCCCTGCTCCATCTGTGTAACCTGGGGACGTTATCTTGATAA
GTCTCTGTTTCTCCATCTCCAAATTCAGGTCATAATAGAACCTTCTTTATAGAGTTACTG
TGAGAGTTAAGTCGGATCCATGCGTAAAGCGCTTAACTCAGTGTCTGGCACACTGTAATG
TTTGGCAGATGGTGCTATGAACATCATCTGAATCACCAGCGTCATGCCTGCCTCATTCCT
CTTGAGCCAGATGCCCAGACCCACACACACACTGGCTCAGACCCCTGTTGATAGGCCCAC
TGTCCTCTGCTTAGGATGGCGCCAGAGGATTTCTTTATCATGAGGAGAGATTTCAAGTTA
CCATGGCCTGATGTCTACTCGTCAAATTGCTTGGACACAAAGTAGCAGTTTAGGGCCTGG
CCTTTTCCATCCTTTTGTTCTTTGTTTGCTCTCATATATAGTGTGTTCACTGTTGATGCG
TCACCCTGATGTACCAAGGGATTTCCTTTTTCTTTTTGAGGATTGAGTGAAAGAAAATTG
ATTTAAGTAAGATTTCTTCTCCCACCCGCACTCCCAGTGGTTTTCAGTTTTTAAGTTTGC
TTCATAATATTCTGGTAAAATTTACACTGCTGGGGGCAAAACAGCTAAGTAAGCTTATGG
AGAAACAACTAGTTAGGGCAAAACAACGTATTTTTACCTCTGTTTATAATTTTAAGATTA
TTATTTGTTTTGGTTATTATCCTTAGAGGCTTTCATGTTACTGAATCTGATACATTGAAT
ACTGTGCCTTATTCACAAAGAATAGTTTCTTCAGAATTACATGTGACCAGAAACTTGTGG
TCCCCCACCATGTCTGTGGATCAAAATAGCTATTGAGCTTGTAATAAGAGCATGACACCA
TTGCATTTCCTGACAAGCTAGCATCATTCTCAAGCAGAAGACTAAAGCTGTAGTTGTAGA
ATTTTATGACACAGCAAATCCTAGTGATGATATGATATTATAATATATGATATAATATAA
TATGTAACATAATCATATGATGATACTTTCTAACCTATTTTCAGTATATGGAATTCCTAC
TTGTACATGTCCAGCTTTACTGGGGCGAACTAGGAGGGTCTGCTTTTAGAACCACAGTCA
CAGGGAAAGATGGAGAGGCGGAGAGGGCGTAGAAAAGAAAATGCAGTGAAAAGTGACAGA
AAACTGGAATGCTAATTCACATGAAGTTTTTTTTTCTGGATTCATGTTACTAAAAAGGTA
CATTTATGAGATGGCTAAGCAGGAATAGGGATGTAACCAATCATTGTGGAGTAGTTTCTC
TGAATTTGCTTCCAGGTAGGTGATATCTGTTTCCCATGCTTTCATCTTGGTTAGTTCTCG
TGGGGTAAATTCATGTTTGCTTTTGGGGTCACTTGCAGTCCATTTGCTGAGGTGATGGCA
GACAGAACTTGATCATAATTTACCCTGAGTTCTAGACCCAACCAAGAGGGTAGTGTTCTG
TCCCTTCTTAGATCTCTCTTACTTGTACCTACTATGGATAAGTCAGCCAGAATCTTGAAC
TGTTAAATCTTGGTGCTACTTAGGGGAAAACATTACTAAGGATACTGTTGCTGAAGGATA
CCAGCTTTGAATCAGTTGCTCATGTCATACAGTTCCCTGTGCAAGAATAAATAATAGGTT
ATTCAGGTATCTTTGTGGCTACAAGTAAGGAGAGATGGGAATGCTGTTATTCACACATAT
GTACTACTAGTGGGCTGTGCTGCGTGTGCAGTTGAGGAGTATAGAAAGCGTAGGCTTTGC
CAGTTAAATGCCTTCTAGTCTAAGGTGAGAGAAATGCAATCACAGAATAAGTAGGTAATA
GAATAGTAAGACTTTTAATTGCAATAAGTTTGATACAAGATAAAAGTCAGAGTAGGATGG
AGTTGCCAAAGGAACTGGAACTTAAGATGAAAAGACAAATAAGAGGGGAAAAGTATTTTT
AAAGGGGAACTTAAAGAAATGCCTCGAGTATGCTGGCTCACATGTTTGAGTCATTTCTTA
CAGCTCTAAACTAGTTCAAAGAACTACAGAAAGATTAACCTGGTGTAAAGTGATAAGTAA
TAGGATAGTTCTCTTTAGGAAAAGGCCTTTCCTTGGCTGTAAGACTACAGTCAAATCCCA
AGTGAAGGCAGGCTTCTCAAAGAGCTGTTCCAGCTAACCGCCGAGAGGAGCAGGGTGTTA
GAAGGGAAAGACCACCTGAGTTGAAAGTCGGGAGGCCTGGGTGCTGGTTGGGGCCCCCAC
GCTGATTCTGTGGCAGGATGAGCACATCCCTGAACCTCCCTGAGACTCTGTTCGCGTTAT
TGTAAAGTGAGGTTTTGGACCAGTTGGTCTTTAAATGCCTTCCATCTTTGAATTTCTTTC
ACTCCTTGTCTTTTCAGCCAACATAAACTTACAGATCTAATACTTGTTCGTGGCATTATT
TTGAAAACATAGGACGAAAACAGAAGTAATCTTCTTTATTGAAAACTTACTTTTAGAAAA
TTTTCAGGATTTGCTGTTTGAACATAATTTTGGCAGTGTGATAAAAGGATGAAACTCATT
TGTATCAATATTATCTTTTCAAATTATTTTGTTTTGAACTTGACAAAATTAGGGCTGTGT
TCCCTTTTCTGGGACATGTTTTGATTCTTTTTTGTTTCATTGAGATGGAACTCTTAGGGT
GAGAGTCAGAGACCAGCCAAAGTGTTTCAGACCCCCCCCTCATTTCTTATCAAACACGGA
TACCTAAATAGTATCCCTGTGTGACTTGCCCTGCTCCTGCCTCCTACCTGAAGGTGAGCC
TCTATTCACTTGACAGGCCCTGAACCTCAGAGTTGGTGTAAATGGGGTCTCAGTTGCTGG
AGAGGGAATTGTTGGGGGGAGGGGGTTGCCTCAGCTGACAGCCAAGCCACTGTGAGACGT
CTTGAGTGAGAGCTGGCTAAACAGAGACTGTGTTCTGTGGCAGAAATTGTGAGTCCAGGG
AGAAATTTACTACAACTAACTTTTATCTTATAACTTTTATCTTTAGGGGGTAATTTTCTC
CCTAATTTGTCTGTAGAAAAATATATTAAAAAGAGCAAGATAGGAAAATTCCTTTAAAAT
GGAGCTTTACTAAAAGAAGGGATTTTTGCCAATTTTACTCTTCTCCCTGTCTTTCAGGAG
AGGGTGCACCCTGCTTACCTTTTAAACATTTCTTTGATAGTTTCTCAGCAAGAAATGGTT
CATCTTTCCTAGAAATGCTACCAGAATATTTCTGACTAGGGTGATTTTCTGTTCTTAAAA
TCTTTTAAATTTTGTTATGCTACTAAGGCATGCTTATTGAAAGTTTTAAAAAAGCATAAA
TGTGTAAATTAAAAACAAATGAAAATAGCCTGCATCTCTTCCCCCCCTCTACCCCTCTCG
TTAATTCAGTCTAAAAGCCATTCAGTAGAGTTCAGAAAGGTAGGAGTCTGTGTGACATAA
AACTTAGAAGCTGTAAGAGAATAGATTGAGAACTAGAGGACATTAAAAATTTTCTGCATA
GAAAAAATTCGGCTACCACATGGACTGGAAAATCTATTTGCAACTCTCACGTTCAAAGGG
CCGATTTTCCTTATACGTAAAGAGTGTATACACATCAATTAGAAAAAGAGCAACCCAACA
GGAAATCTGCAAGGGAGAGGAACAAACTGTTCATAGAAAAGACTCATTAGCATATGAGAA
AACGGCTGTTCTCATTCATAAGAGGAATGCAGTATACTGAGATACCACTTTTCATCTGTT
AGATTGACAAAGATCCAGAGTTAAAGCATCTTTTGAAAACTATGAGGAAGCAAGGACTTT
CAAAACTTGCTGGTTAGATTGTGAATTAACACAACTTCCATGGAGCACAATTTGGGAATA
CCTAGTAAATTTACTACTACAGATTCCTTTTGACCCAGTAATTTCACTTCTAAGAATTTA
TCCTACTGATAGACTCCCACACAAACTGCCAAAGGTGTAAACTTATTCGTTGTAGCATAG
TTTGTAACAGCAAAAGAAGGTAAAAAAAACAAATGTCCATCAATAAGGGGCTGGTTAAAT
AAATTACACTGTATCTATATAATAGAATACTATGTAGCCATTAGAATATAAACTTCATGT
GGCATTGTCTAAGGTATACACTAAGAGAAAAAAATATAGATGTATAGAATATGCTACCAT
TTGTGTAAGAAAAAAGGGGAAAGGGTAGTAAATGTATTTGCTTGTGTGTGCATAAAATGT
TTCTCCAGAAATACACACAAGAACTGATGACATTGGTTGTCTCTAGACTGAACAGCTGGG
TGGCTAGAGTACAGGAGTATGAGAGACACTTCAAAGAAGACCTTTTTAGGTCTGTTGAAT
TTTTAACCATGAGGCTTTACCTATATAATAAATAAATTTTCAGTTAAAAAATTGAAACAC
CTTTCAAGTCAAAGAAAAAATAAAAAAGTGTCAAATTTATCAAAAACTTTTACAGATCCT
ACAGACGTAAGCATTAGATAATTTTTTTCTTTGCTACAGATACCTTAACTATCTCTCTGG
AATAGGATTATTTACTAAATTTCTTGAGTCATTCCTGGAGTGATCCCTATGTGACTTTCT
TTAATGTCTTGTGAGTTTATATTTGTTTATATTTAAATTTTTTGCTTTAATGGTTAAAAC
TGAGATTTGTTTGTCGTGGATATTTTTGATTGTTGGTCATCTTTGACCTTTTTTTAAAAT
TTTATCAGGAAGATTGTTGCTGAGCTAACATCGGTGCCAATCTTCCTCTATTTTATGTGG
GATGCCACAGCATGGCTTGATGAACAGGCTAGGTCTGTGCCTGAGATCTGAACCTGTGAA
CCCTGGGCCACCAAAGCGGAGTGCGTGAACTTAACCACTACACCACTGGGCCAGCTCCCT
TTGACATGCTTTGATAGGGATATTATTGAGACTTTGTAAAAGAATTGGGAAGATTTCTTT
TTCCTTTTTTTTTTCTCCCTTGCTCCCCAAGGCAGACCAGCTGAGTTGAAATTCTCTCGA
TACTTTTCCCTACACACTACTTGTCATTTTACCCACAGGAAGAAGAAGGAAATACTTGCA
AAACACAGAAAACCTCCTGGCTTCAAGATTGTGTTTTATCCTTATCTCCAACCAATGATC
TGATGGTTATAGCTCGGGAGCAAAAAGCTGTATTTCTAGTGCGTAAGTACTCTCTTTTCA
GTGGCCTTTATTTTAATGTGTAGAATAGAGCAGAAAATGGATTAAGTAGGAAGAAAAAAT
GTTATTTCCATTGTATGTGTTATATGGTGGCATTCTATAGTTTATTTTTATATATTATGT
AACACTTTTTAAATCCTTTTTAAAATTTTTCTCTCTCTCTTTTTTCTTTCTTTTTCCTTT
CTGTTGTGTCTTCTCTCTCTCTTTCTTTCTTTCCTGGCTGCAGATACTTTAGCTGTCTCT
CTGTGGTGCTGCAGAGGCAGTACTGGGCATGGTACAGTTCTTGTAAGGGGCAGTTAGAAC
TGAAAAGGTCGCTGACCCCTTCTTAGTGTGTGATAATGTGAGTGAGGTGATTTTCAACTA
TAATTTGAAAACTCACAGTGTAATTTCCTATTTGGGGCATAAGTTCTCAGGTCATAATTT
TTGTTGATTACAGTTGAAGTTTGGGCGTACGTAGGATATGAAAACCTATTTAAAATGCTT
ATGAGATGGCCTTACAAAGCAGATTTACTCTCTAGTAGCATAAATCTAATAGATAAATAT
TCTCTGCCATCTGAAGATAAAAGTAGTGTTATAAATAAAATGTCAGTGGTACATAAGAAT
TAATAAGTTTATTCTGCAAGAACTGTGACAGCATGATATTGATTTAATTGGAGGAAGGAG
AGACTGAATGCTAGGAGACTGATAGAACTTTATTAAAATCTTACAGAATTTTTTAAACAT
TATCTTATATTTGCTTCTGAAAAGACCCAAATCAATTAATACAGAACAAATAAACTTTGT
CCTCATCATTCTAAAGGGAAAGAGTGAAATTTAGAAATTACTGTTGTAGTGTGCTGTAGT
TAAAGTTATTTTATATAACTTAACTTTTTCAGCAAAATGGAAATATAGTGATAAAGGAAA
GGAAGAAATGCAGTTTGCTGTTGGCTGGAGTGGGTCTTTGAACGTTGAAGAAGGGTAGGT
ACCAGTTAATTTTTTGTCTCTGTGTTAAATGGCTACGTGAAATTGTTTGACTTGTAAGTG
AATCTATTAAAAAGCTTCATCGTTTGGAATGTTTAGTAAATGTATATTCTTCCCAACTTT
AGAGATTGTAGAGCATGATTCAGTCAGCAAATTTTAATTTTACTCATCATGTGATTACTT
TTAAAAAAATGCTCATTTGGAGAGGATTTGAAGAAGAGTTCAGAGAGAATCCCATAACAT
CCTTGCCACATTTTGTCTTTTCACTCTGTTCTCCATTACTAACTTCATTCAGCCAGAAAG
TCAAGGGCAGTCATTGTCTTCTCTGCTTTGCCAGCACTGGGCTCGTACTTGAAGGGGACA
GTGCTACATTAATCCTTAAACTCATAAAGACTTCACAAATGCGAGTTGGTATATTCAGGT
TTCCTACTGACCCAGTAAGTTTTAAAACCAGATCTCTAGTGTGGTTACATGATGGAGCTG
CTAGCCTGCAACCTGGAGCCAAAAACTGTTTCCAGTTAAATTTTTGTAACTGAAAACCAT
GATCAGAATGAAGAAGATTCTTCAGACTTTGAATTTATATAAAAGACAACCAGATGGAAG
GCTATAGTGTGTGCCTGGCCCATTGCAGATGCTCAGTGAAATGTTTTCTACTCTTATCAA
AGTAAATGATAATACTTCTCTTTATGTCATTTAGTCTAAGCATTGTGAAGACATTTAATT
TCTGTCAGAAATGCAAAGCAAACATAATGATTCGATTACTTTAAAGACAACAAACAAAAA
GATTAAATTTTGTTCATTGATTACCTAAAAGGATGGATGGGTCAAGAGTGTTCGTGATTT
CTTGGATTAGCTAGTGATGGTCCTGAGGTTTGACAGGTTAAATAAGCGTCAGTCAGTTGA
AGCTGTTTTAATTTTGAGCCTTGGTCTCTGAGCTCCTGACAAATTTTTCAGATCTACATG
TCAGAAAAAAAATCCCTTAAAGAACATCCAACCTAGCATGTGCTTAGAAATAGGTCATCA
GGGGCAGTTTCTGCAAAATATAAAAGAAGCAGCCAACCAATTGGAAATACAGTAAGTCTC
TAGCATAGTGTACTCTGCAGAAATGTGATTGACACTTCCTGCCACCCTCTGCCCGAGTTC
TTAGCTGATGTGGAGGAGAGGGGGCCAGTGGGAAATGACAGCCTGGTGATCAGTTGATAC
TTTCTCAGTTCTCTATGTAATCAGTTGTGTATAGTAAAGTTTTGCTTTTTTTTACTCTCC
TGCTTTTCATGACAATACAGAATGAAAAATACTGCTTTTTATTAACCTCAAGTGAATGTG
ACATTACCTTTTATGTGAATGAATTTTTGACCCTACTTATGGTAGAGTTTTACTATATTT
TTGACATTTTGCATTGAATAAACGTGGTCCGCAGAGCTCATCTTCCGCTTACTGCCCTTT
AACACTAAATTACAGAGAATTAAAAGTGATTGATAAATCCATTAGATAAGCATATCATTT
TGTTTTTGTTTTCAGGGAATGTGTAACCAGTGCTCTATGTATCCCACTTGCAAGCCAAAA
GAGGTAAGGATAAATAAGAGCTATTCGTTTTCTTTGCCTTGATTTCTGAGCCGTGAAGGT
GATAAATTTCGTCTGTTACAGGAGTTCCACTGGCCGTCCTGACTGGACCTGCATTGTGGT
GGGCTTTACCTCAGGCTACGTGCGCTTCTACACCGAGGTGAGTCGGTGCTCAGCACTCAG
AAAACACCAGCTGACGGGGATACCTAGTCATCCCTCCCCACGGTACCCATTTGTGACTCA
TTAGATGCTGCTTGGGAATGTGTAGTTGATACTTGATGGGTGTGGAGGCTGGTGGGGGGA
GCAGGGTGGTGGTGGAAAGTTCTGGTAGAAGCTATAGAGAAGAGAAGCTGTATTCTTCTA
AAAAGAGAGTCGCTGGTCTCCATGAAACAGTGCTGGGGAAATGATGCTCTCTGCTGGCCA
TACCTGTTCAGGTATATTGGTAAGAAGACGATCAGGGCTCTTCTCTGTGCTTCCTCCTAG
AGTGGTGTCCTCTTGCTTGCACAGCTTTTGAATGAGGACCCAGTGCTACAGCTTAAATGC
AGAACCTATGAAATCCCACGGCATCCTGGCGTGACCGAGCAGGTAGTATAAAAGAGTGTG
TTCAGAGTAACAGTAGCTTTACTTTGAAGTAGCTTCTTCCCTCTTGATTGGCTGAAAACT
TAAAGATACCCTTGTCTGTGGCACAGTTCGCTGTGCTGTCATGTTCTAGAAATATAACCT
ATTTATAGCTGAGTAAAGAATACCAGTGTTGCTTTTACTTAATGAAATATTGTATGTTTT
GTCCTACAGTAAAATAAAACACTTTAGTCAGAAGCCAAAAAAGCTTTCTTATTAAGGTAA
AGCTTTCTACTTAAGGCAAAAATGCGGTATTATATAACTTTATATCTTTTTTATTTGGAT
TTAGGTATCAGAGTTATACAGAGTGAAAGAAAAAAGTTCTGGCCTTACTATTAATACTTC
TACTACATTGTACTTACCTGTTTCTCAGAAAAGTGGTTGTTAAGTTTTTGTTTATAGTGG
AAAATATTTTATATTTATTGAAGGTCTTGACAGAAAATAATACTGTTTAGTATCTAAGGC
TCTCCACAGTTTTCATTTCTTCCTAGGTACTGTGTGAGATTTTGATTATCTCACAGTCGA
AAAATAAATGTAGAGCCACATAAAGCAATGTGCTTTTGTTTGGCTCACATAATCAAAACT
ATACAGTATGCCATCCTTCTTTGTGCTACTCTGCCTTCAAAAGATTTCAAGTAAACAGAT
GTATATATTGTGTGCCTATGTCAACTTAAATTGTATGATAGAAGGACTGGAGCTATAGGG
ACTGAAGCTATAGAAGAAACTTAGCAATCTAGTAAGAGAGACTAGACTAATACCTGTTAA
TACCTATGAATGAGCTAATCAGTAATATAAAGCAATACCTAATTAATTGCTAATTTATAT
GGACAGACTAGATTCTCTACAAATTTGGAGAAAGGGGAGCTCCGTTAAGACTAGGACAAT
AAAAGAAAATTTCATTGAGGGGGCAAGATTTGAACTAAGCTTTGAATAATGGGTATGGAA
TTTAGTTAGTTAATGGGAAATGAGGGGAAAGAATTTTAGGTAGTAAGGAGAGAAATGAAG
GAAGGTTCAAATGTAGGACTATGTATGAGACAACAGAGAAACCTATGTTAGAAAATATGA
GAAACTTTTGGATAGCCAGAGTGGCCAAATTTTTCATAAATTTGAAAGCCAAGTAAAAAT
CAGAATTGATTCAGGAAATGAAGCTGCTAAAATTTATGAAAAGGAAGTGAGGTCATCAAA
GGGATATTGAAGGACTCTTTCTTCCGGATGAATTGGAGTTGTGAGTGCCTGGAATTGAGG
AAGTTAGTTACCTGTTTTGTTCAGTTATCTGTAATAGACATGGAGTGTTGGGAACCAGGA
CTGTAATGGTGGTGGGAAGAGAGAAAGGACCACTACAAAAATCATTTTAAAGGAACAATT
GACAGGACTTAGTTATTGTGTAGAGATGTAGGATATTAAAGAGAAAAATGAGTTGCCTCT
AAGATATCCATCCTGAGGAATGCTATTGACAAAGTTGAAAGAGAGGACTGCTTTGGCAGT
AAATAAGGGTTATTAAATTTGGTTTGGACTTGTTGAGTTTGAGATGATGGTAGGAAATAA
AGTGAAAATACCTGTATGCCTGTAATGATGTTACCGAACAATGGGCTCGTTCTGCTCCCT
GTGATCTGAGCCAATTAATGACAACGAGTTAGGGATCGAGAAAGGAAGTTTTAATTCGAT
TAGCCAGCAAATCGGAAGACAGGTGACTAATGTCTCAAAAAATCCATCTTCCAGGGTTAC
AGAATCTTGAGGCAGTTATAGGGGCAAAATGGGCAGGAGTGGGTTTAGAAATGTCAGCCT
TCAGGCATGACGGACTCCAGGATCTTTCATTGTCCTTTTCTCCTATCAGTGGTGATGAAT
ATCTTGTAGGTGTGTTTCCTGCCTGTGGTCAGCCTGTTCCTGGTAGAAACTCATAGAACA
AAGTTTTAATCTATCAGGCTATAGGAGAGTACATACGTAGGCGGAGGCCATAAATCAGGA
GAGCATGTGAATCTTTTAGAGTATGTGCAGAGCAGTGAGTAGTCACACAGAGGAGGGGCT
GCGGTCATTTAGCCTAGCAAGATGGCTTCACTTATGTTCATGTACAATGATACAGAACTA
CTGTCTAGGGACGAAGACTAGATTGAAGGTGGTGGTTGAAGTCATGGATAAGGAACAAAT
TCTTCCAAGCAGAGGATATGGGTAGATAAAACTGAAGACTTCATCATAAAAAGATAGAAG
ATGAAACTATTGAAGGAAACAAAGAAGGAGCTGTTGGAAATCTAAAAAGATGTCTGTTCA
TTGAAGATTATCTCTCAAGATCTGTTTACCATTTTTCTACAGATTCTCTGGATGGTGAAG
ATTCTTTAGACACTTTAAGCTTGGTTATGTCTTTAATACTCTTTTTTTTTTAGAGCTGGT
GGAAAAAATGTAATTATCATTTAAATACTTGCTTGCTATTTGCTATGTGAGTGACGAAAA
TCTTTTGGCTGAAAAATAATTCTTATTGAACGTGGAGAGAGAAGTCTTTGTTGTTGCTCT
CTATGCTGCATAAGCACCTCTGGATCTGATACCTCAATTTATATATTGGCTGCTTCTTCT
CTGTACTCCCAAATCTATTAAAAAACATGGGAGCAGATTTCCTCTAGTTCAATTTTGGGG
GCAATGAGTGTAGTAGGGGTGACAGTGGGTCATTGCGGGAGAAGATTCCAAAGAGAGATC
TCTTTCTAGAATGTTACAGAAACTTCTGTGGCTTCTGCACAAAGATCTCTGTCACCTAGC
ACAACTTCTGTAGCTTTTGGACCATGATGTTTGTATTAGTATCTTGAGGAAGACCATCTG
TTTTTGGAGATAATTGACTTGCTGGTGATTAGTTCCTCGAAGGCAATGAGGAGGCTCTCT
CTCCACTGTCATGCTCAATGAACTGCGCAAGCTTGGCCTTGTGGACGGGTCATGTGAGCT
GTGAGCACCCAAGTCAGCTGCCTTCCCCCTGGCTCTCACCCCTCGTGACCCACAAATCTC
TTTTAAAAATTGAAACAGCCCACTAATCCAGTGGAAAAAGGGCAAGACAATTCTCAAAAG
AAGAAATATAACTGGTCAAAAAGCATATGATAAAATTTTGAACCTTAATAATAATCTAAG
AGCTATAACCAATTACATTTGGATAATTTTTTGCCTTTCCGGTTGGCAAAGATGAAGATT
AACAAAACTGTTGGTGACAATATGGAGAAACAGGCACTCTCATGTATTGTTGGTGGAAGT
ATAAAGTGATAGGTACTTTCTTGAAGGCAATTTAATAATGTGAATGAAAACAAAAATTGT
GAATACTCCCTGACCCAGTAGACCCACTTGAGGGAATTTACATGAAAGTAATGTGGAAAG
ATACATACAGAAGAACGTTTATTGCAGTGATGTTTATAATAAGGAAAATGTATTAATTGA
TGAACCAGGCACACAAGGTTCCTGCTTTCATGGAGCTCACTGTTTGGGGATAGTGGAGGG
AAACCAGCAATAAACAACTAGAGATACGAAGATGATTCCGGTCTCTGATAGGTGCTGTGG
AGGAAGTAATCATGTTGATGAGATAGCAGTGTGGCAAGAGAAGGGAGAAGCTATTTGAGA
CAGAGGCTCAGGAGCAGCCCCTCTGAGTAGCTGCATTTGAGCTGAGACCTGAGTGATCAG
AAGAATTAGGCAGGTGAAGATCTGGGAGGTGAAGGTCCAGCCACGTTCGGTGCACTGAGG
TGATTCAAGGGGCAAGGAGAGACGACATTAGAGGTATGTGCCGGATCTTACAGGCATGAT
TAAAGAATTCGGGTTTGATTCTAAATGCAGGAGGAAGCCATTGGAGAGTTTTAGTAGGAG
AGTGGTTTGATTTGCAGTCTCACGAAGATCATGCTGGCTGTGTGGAGCATAGACTGTAGG
GAGCAAGAGTGGGAGCAGGAGGCCAAAGTCAATGTCCATCAGTAAGAAGTGGTGAACTGA
ATTTTGGTACATATAATGCAATACTGCATAGCCATGACAAAAAGTGATTTGCTCACTTAT
TGAAATGGAAAAATATCATTGACATATTATTGAGTAATAAAAAACATTTCATAGAATACT
GTGTGTGGTATAGTGTCATACAAAAGCGTATAAGGATGTGTACTGAGACATGTCTGGGAT
TTCAGATGAGTTTCCTTTTTTCTTCTTTCTACTTTTATGTATTGTTCCTATCTGCACAAT
AACTATATTTCATTTTTATGAAACATGCTTTTTTTTGTTAATCTCACCATCTGTCCTGAA
AGTATTATTCACCATGCACAAAAGCTCATATTTGAGAAGAATTTAAGTCCTTGACCAAAG
CGCATTCTGAAATTAATTTTCCGTTTATTTTTACTGTTCCTTTGCCTCACATTGTTCGTC
TGTTGGTAGTTGACAGTGGTTTAGTCATCATATTTTTTATTTTTCATTAATCATGACATT
CGGGTATAATAGAAAAACAGATATGCTTATCTGGCTATGATGAAAATGTGTTATTTTCTT
CTTTCTTACTTCTTTAATAGAATGAAGAGTTAAGTATCTTGTATCCAGCTGCCATTGTGA
CTATTGACGGATTTAGCCTTTTTCAATCTCTTCGTGCTTGTCGAAATCAGGTAGCAAAAG
GTAATTTTTTAGTAAGATGTATTTAACTTCTGATGATGTTCATCTTATTTAATTTAACCT
ACTTAGAAAATTAAATGTGTCCTCTAAATTAAAAAGGTCTTTCAAACTAGATTTATGGAA
AAAAACCTGCTGCTGTAAAAATGGGACCGCATTGTTGGGTAGATTGCTTAGTAAGATAAT
GGCAAGGACTGAATCATCACCACTCTTGACATTTGCCAGTGGAGAGTGTGACCAGCACAG
GCTTTCTTCACTGACACAGCGATAGGTCTTGGCCCGTGACGAGAGAGATTTGTGCCTGTG
TTGAGAATCAACATTGGGGTGAGGAATTTAATTGCATCTAGCTAAGGAACCAAATTTCTC
ACTAGATCAGCAGCTAGGGGGCCAATATTCTAAAGTCTTGTGATTCTACATGGCTTCTGT
CCTCACTAGGGGTAAAGATACCACTGTGTGCAGGGGAATTTTTCCCTATGGCAGGCGGAA
TATCAGTTTCTTTTGGCTAACTTGGAACACTTCTGAATGGAGAAGTTAGAGGCCTAAACG
TAATGTACATATGGGTAACTACATTATTTCCAGAGTTGGGGGTGAAAACTGTCTCACTTT
TACTACCTGTAGTTTACATTCTGATGCTATTATGTCTTTGGAAGAAGATATCGTATTTCA
TTAAATTCAAGATGCTATTGATTATAAGATGCACTGTTATTTTATGTACCACTAAGAAGC
AAAAATGCTGCCAGTGAAATACACACCATCAATTTTAAGATCCCAGTTTTAGAGATGTTC
AAACATGAGGAAGAAAAGCCTTAATTACAGCCAATGAAAATACAGTACTAGTGCTGACTT
CCTCTTCTGGTTTTGGGTAGAAGGGCCTTATTGGCCCTAAAACAAAGTTTAACTCTTAAA
TGATTTAGACAGCTGCCTGGAAATATAAGTTAAATAGGATGTGTTTGCAGATTCATAAAG
GTTGTTCATAAATCCAGAACTAAACTGTAAGGTGTAAAGTAACTTCCTATAGGGAAAAAA
ATGCAGCATCTTACATTGCACTAGAAAAATTTTCAGTGTCTTTGTAGTGGGTTGATGTGA
TTGGTAAAATCCTGAAGTCTTGGTTATGTGGTTCTTTAACAGTACAAGATTTTCTATAAA
GTCAGAGTTCGTTTGAATTTTTATACCTATTTTCATAATCTTTTAAATTATTTAAATGCA
GCCCACTGTCATTGTCATTTTCTTGGGAAAATTTAAAATAGTCACCATTTAATATAAGTG
CCCAAAGAGACTGGCAGTTTTCTGTAAATAATAATTCCGTCAATAAAATAAACTAGAAAT
AGACAATTGTGTTATACCTGGTATTGTCAGCATTTAATTTTTACTATTTTTGAATTCCTG
TTTATTTTGTTATGTATAATACCATAAAGCCATTTTGTCTCCCAAGAAGTAAGTAAGCTG
CTTAGTGCTCTCCTACTGTAAATTGCTCTAAAAGAATTCTGATTACTTAGCCACAAATTG
TTGTGACATTTATTTTGGGATGTAGGAAAATTCTCTTTTCTTGTCCTTACTATCAAATCT
GAAGTCCCAAGAGGATTATATTTTTCTTTATTAAAGTACTTTTCCTCACTTTCCAGAGTA
AGCAACCAGAATCCAGCTGTATTCTTATGCATGAGAATTTACATAAACCTATGGCAAAAG
GTGTAACTTGCTTTTTTTCTCATAACTCACTCACTAGGTGGAAATAGGTGAACAGCGGCA
TTGCGTTAATTCTTTCTGGCGATGCTGTTGCTGTTAAGCTATCTTTCTATCAAGCCTGGC
CTCAGTTACTTGCCTTAGAGACCTTGCTGTGTGTGTGCTCCTGCCAGGCATATAGAGCAT
CAGGTTTTTAGTTTTTCACCAAATAGGGCACTGGTTGCTGTTCCCAGGATTTTATCCACT
GTCTTTCTCAAGGGGGAGAAATTGCTTATTTCACTACAATTGCAGCTTGAATTCATCTTA
AATTTTAGTAATAGTCTAGAATTTTTAATAGTCTTTTCTAACTACTTGAGTGTTCCAAAA
TCTCCTGTGACAGCCAACTTACTCTTGTAGTGTTTTCATTTTATGTGCACTTTCTTGGCA
TAAATAAATCTCACTTTATGCCTTTTTACATTAACTTGCTTCATTATTATTAGTTGAAAT
TTTAGAGTAATAAGTCAAGTTATCACAATTTTAATGATTTTTTTATAAAACTTCATTTTA
TGCATTGTAGTTAAGTTTGGATTGTCTGATTTTTGTCTTTGACAGCTGCAGCATCAGGCA
ATGAGAACATACAGCCACCACCGTTAGCTTATAAGAAATGGGGTCTACAAGATATTGACA
CTATTATTGATCATGCTAGTATTGGTAAGCATTACTAGTTCAAATTCTTACAGAATTTGC
TGCTTTTTTTTTTTTTGCTGAAGTATCTTATTTTAGAAATGTACGTTTATTCTTATGTGA
AAAGAAAATGCATTCCCTTTAGAGAGACACCTGGAAGTTAGTTCATACTTACAGATTATC
GTAGGTTTATGTCTCTAGGAAATGGTTGCAGTTTTAATAGTTATGCCCTCAGCAGCATTA
TTGTACAGTTTTAAGTCACTCACCATTTGACTTAATTTTTCTGTGGACAAGTTTAATCCA
TGTAATTATCGTATAGATCAGTCTTCTAAAAATGTAACCTTTAGACCAGCAGAATATAGA
TAAAAGTAGATTTCTTCTTGCAACCAGTACTTCAGGGCTTACTGTGTTAGGCATTGAGAA
TACAGAGGTGAAAAGACATGGTCCCTGCTGTCAGGACAGCTAAGTTTAGTTGGAGGAAAT
GTAAGAAACTAGTTATAGTAGCACAGCATAATGATTGTGGTAGTAGATGCGTGGACCAGC
TAGGGTGGGAGCAGAGAAATCAGGGGCACTGGGGGAAATCAGGAAGAGGAGGTTGACTTT
AACCTGAGATTGAAAGAATGAGCAGGGCTTGACCAACAGAACAAGCACAGAGGAGGCATT
CCTGCCACTGTGTACGTAGGCTTGGGGTGGAAGTGCATTGTGTACCAGAAAAACAAAAGG
TGCCAAGGTGAGCTGGCAAGAGTGAGGCCACATATGTAAATAGGAGGCAGATTTTGAAGA
GTCTAATATACTAGGCAGAGGAATTTAGGTCTTTCTCCTAGCCACTTTGAGAACCATTGA
AGATTTCTGAGCAAGAGAATATTATCACTTAGCCTGTTAGAAAAATCACTCTGGTGGAAG
TTTTGAGGCTGCAGAGTCGGGGTCAAGACTAGAAACTAGGTGCAGTAAGGAAGCTATAAT
AATCTTGGTAAGGAGTAATGGGCTTCTGAATTAAGGTAGTAGAAATGGGGATGGAGAAGA
AGGAAATTCTATTTTAAAATGTATATGTGTTTTTTTCTGTTTATCAATATAGTATATGCT
TGTTGAAAATTCAAATAGTGCATAAATATATAAAGAGAAAAAGAAAAAGGAAAAATACCC
CTTAAATCCTACCATCCAGAGATACCCACCATTGGCATTTTGACAAACATCTTTACAGAC
GTGTGTGTAAGTGCATGTGTAATATGTGTACGGTGATGTAGAGAGATGTGTTTTCATAAA
TAAGATTAAATAATGCCGACTATATTAAAGTCTTTTTTCTAATCAACATATTATGAAGAA
CTTTTCACATCAGTTTTGCTAAATATGCATTTTATCAGGGTCCTAACAGAAGACAGATGG
CATCCTTGATGTGGGATAATTGAAAGGGATTTTATTCACACAGAAACTATTTATAAAGAT
GTGGTAAAGGACAACCACAAGGGGTAGTACAGTATCTTAGGACTCTGAGCAGCCCAGCTG
TTAACCACTTTCCGACCTACAGGGATGAGAGCTGGGAGCAGTTCTAGAACTTGGAGACAG
TGAGTGAAATCAACGCCCTAAGAGCAGGATGACTTCTGTTCAAGGGTCACAGGGAAATAG
ATACCATGACTTCGTTCTCATTTCTTTCTTTGATCTCCTGATGGGGCTTCCCATTGTCTG
AACCCAAGTGGAAGTCAGCATAATCTACACACACTGGCCCCTGGGAGAAGCAGGGGGAAA
AGGAAGGAGTGTGAATCTAGAGGGTCAAACAGGAGATATCTGATACACAGACCACCTTAG
TTTATTGTCGTGTGTTCTTATATGGAAAACTCTGTGATAAATACCTTATTATAGACATTC
AGTTCGTCTTTACTTTTTTGCTAACATAAAAATGCTGTCTCCAAAGTGTTGAGTGCAGTT
CAGGGTAGCTTCCCTGTTCTGTTAATTAGACTTTGGAACATTGAAACAGGCTAGGAAAAC
TGATTGGATAGAAAATATTACTCTATTCATTTATCTCCTAGCCTACAAAGTCGGAAAAAA
AGGGTACAATGAACTTTATTGTATGTGTGTCTTTATATAAAGGTGTGATAAATGCATTCA
ACAAATAAATGAATACCTGTTATGTCCCAGGCGCGAATATTGGTGCTAGAAATTACAAGG
CAGACAGGACGGACCCCTGCCCTGATCAAGCTTACACTCTGGTAGTGTGGAGACAACCAA
TAAACAAACCAAATGAATAAATATGGTGATATCAAAATGTTAGTATGGGTCATGCGGAAA
ATAAGCAGAGGGTTATGATGGAGAGTAAAGGAAGAGGGTACTGTAGGTAGACAGATGAGG
AGAGGCCTCTCCGGGGAAGTGACATTCAGACTGAGACGTGAAGGATGAGAAAGAGCCCGT
TATGTAAAGAGGTGGAGGAAGAGCCTTCTTAGCGAAAGGAGCAGCAAAGAAGTAAGCTTG
CGGGGCCTCAAGACCTGAATGTTAAAGAAACAGAGAGGAGGTCAGTGGGACTTGACTGTA
TAGAGTTAAGGGGAAAATGGGCTGACGTAAGATTGGAGGTGAGAACTTGGGTCAGATCAC
ATAGGATGAGGAGTTCGGATTTTATCCTGAATGCAGTGGATGTTGTTGATGGATTCTAGG
TACCGGATATTTAAAAATATCCCTCTGACTGCTTTTTAGAGGGAGGACTGTAAAATAAAA
AGTGAAAGCAAGAAGACCAGTAAGGAGTTTGTTTCAATAAGAGAGAGAGACGGCTTTGTC
TAGGGTGGAGGCCGTGGAGTTGGAGAGAGGTAGATAGATTTGAGATATGTTTTGCACTTG
CTAAGGGATGGATTTGAGAAATGAGAGAAAGGAAAGATTCGGGGATTTCTTGGTTTTTAA
ATTTGAGCAAATGAGTAGATGATTAGACTGTTTACTGAAATGAGAATAAGGAGAAAAAAG
AGATTTGAGGTGGACAAATTGAGAGTCATGTTCTTCACAGGTTAACTTCTGATGCAATTA
TACGTTCAGGTGGAGGTGTCAAGTAGACAGTCAAATATATGAGTCTGAAGCTCAGAGAGG
AAGTCTGGATTATCAGTATATATTTGGGAGGGAGTGGTGAACTGTGGAGTGCTTCATAGA
ATTCAAGAAAGGGGGAAAGTCCATTGGATGTGATAACATAAAGCTCTTCATTGACTCTGA
TATGAGCAGTTTAAGTGGAACAGTGAAGATGAAAGCCAGATTGGGGTAGGTTTAAGAAAA
AAGTATTTCCACCCCCTACTTTGAAAAATCAGAAGCACAAGAACAAGAATTCAAATCACA
GCATCTCCATTTTTATCTGCAGTCCTAACCTCTTCCTTAAACTTCATACTCATTTTCCAA
CTCCTACTGAATGTTTCCACCTGGGTGTCCAGACTAAACATATACAAAACAGAATTCTTG
ATTTCCTCCCATCAGACCTCTCTCTCCTTTTTTTCTTCTGTCTCCCTTATCATCTCTCTT
CTTGTTCTCGTGTTCACACCAAAAGATTTAGAGTCATCCTTGACTCTTGTCTTTTTCTCG
TGTTCTTTATCCAGTCCATCTTTTGCCTCTACCCCAGTATGTCCTGAATGTGACCACTTC
TCATCTTCGCCATTGTTAGCACAGTGGTCCAAGCACTGTCATCTCTTGGCTGAACTTTTG
AGGAAAAAAATTCTAACTGGTCTTTCTGCTTCCTTTTTTTCCCTCTTTACAATCTGTTCA
CCAGTTAGCATCTAATGTGATTATTTTGAAATATAAATCATATTTTTGTCACTCTTCTGT
TCACAACCTTATAATGGCTTCCCATCTTATCCCTAATAAAATCCAAAAGCCTTACAATGG
CATACAAGGCCTGACGTTGTCTTGTTTAGGTACTTCTTTTACCTTATCTCCTTTAGCAGC
CCCCACCTCTGTGTTCTACCATGCTGATCTCCTTGTTCCCCTGACACACCAAGCATCCCC
CCGCTTTAGAGCATTTGTAATTGCTGCTCCTTCTGCCTGGAAAATTTTACCCAGCTAGCC
ACGTGGCTCTCTCCCTCACTCCATTCAGGTCTCTGTACAAGTATCATTTTGTCAGAGGCT
TTCTTTAACCACTATATTAGACCTAGAAAATTATCCAATGAGTTTGACTTTATGGAAATT
TATATTAAGAGGAAATTTAAGATGTTTCAAAGTGTGGGAAGGCCTCAGACATTCAGGGAA
AACCCTAAATGACAAGGTAACGATAACTGCAGGAAAAAAAAATTCACATCTAAGAAAATG
TAGTTACAGTAGGCAGCCTGTCGCAGCAGTGCGTAATGTTTACAGCATTCTTAATAATGA
AAACAGTGAATGTGAATTTCGTAAAAAAGTTGAGATATGGGTTTATTAGAAGGTTATGGG
GAGAAGAGGAAGACCTGTAAATAAGCTGTATCTTCATTTACTTTAAGTCAATGAAAAATA
ATGCTAAAATTGGGTATTCAAAAGACGACAGTCCTGTAGAGTCCACCAATTTGCTGCAGT
ATAGAGAACAGGACAGAATGTTGAATAATGTACAGGAATGCAGTCAGCAAAACCTAGACT
TTGGGAAATCAGTGTCAAACAGCCTGGTTTCTTCAACAAAGAGATTTCAAGAGACTGGGG
ACATGGGAAGGGGTCAAGGAGTATAGTAGGATTTGGGGCTGGTCTTTTATACCCATTTGT
TTGTGGTCCTTCCTTTGAAACCCAGATGTGTTGTTTTTCTCTGGCAATGATCAGCTGTTT
TGCTGCAAACAGCAGAGAATGCAGACAGTTTAGGTCAACAAAGGTTGAGATTTAGCCAGC
TAAGTGTGTAGAGGGAGAAAGGGACAGGGGAGTGGTGGGTTTTGATTATGGTGGAACATG
AATCTAAGAACAAGGGAAGTGATCACAAGAATTGCTTGATAAATAGCAGGATTAATGAAT
TGAAACTCTTAATGAAATTGTGGAATTATTACAGGAAGTTACTAGAATAATTAAGATGGA
AAACTAAGAGGTGGTGGTCAAAAGGTGATATGCTTGATATCAAGGTTTCAAAGAATATAT
AATTGATGATGACAGTATCTAAGGTATAGCATTGAAAGTAGACAAATGTGGAAAGAAAAA
GATCACTAGTGGTAAGATGGAAAGAATGGATCAGCCATCTCTTTGGAATAAATTCACTTA
AAATTTTGGATACGTATTACAAAATTGTCCTCTAGATAGCTTGTAGCAACATATACTCCC
ACCTATAGTGTATAGGAGTATGAAGAGAAGTTATGTTAAAACTTAAATTTCAATTTATAT
GCCACACAGTTCACCCTTTTGATTTTGTTCTGGTAGAGTCAGGCAAGACTTATGCTAATT
TTATCATGTAGTGAAAACATTTTATATGTTGAATCATGTATTCATTCATGAATGTGAGAC
GAGCATTCTCATCTTTCAGAGTCATCCAACTTTTACAAGATTATTTGATCCCTTTTATCC
CTAAATCCAGTAAATGGTTTGCTTATGAACTCCTAAAATTATTTCCTTTCCCAGAACTTT
TCTTCAGGAGGAGTACATTTTTTGACTGTTTGCAGGCAAAGTAGAGGCAGTACCTATAAA
TGAAAACTAGGATAAATGGTGTTCCATCGTATAGTATATTTGAGTTCAGAACCTCTCAGC
CAGGTGTCTTCATGGACCGTGTGAGTACCCGGGTTTGAAGGCACTGCCTGAATCCACGTG
TGTTGGAATCTAGCAGCAGATCTTTACTTCCTACATCCTCCCTGTCTTTCTCTCCCTGCC
ACTCAGGTGAATTTAGATAACACTGGTTTTTCCTCGGCTGTTCCACATAGGCGTGTGGAT
GTCGGCATTCAGTCTGTCTGCTTGTGCTCCCAGAGCCTTGGGGAGATGAAAAGTAGCTCT
CATTATAAATGGGTGGGGATTTCTGGACTATGAAGTAAATATTTGAAAGTGTTTGTTTTC
ACTGTGTTGGGAAGGGTATGGGAGCACAGATGCTGTGTCACCTTCTTGGCAGGAGTGTAA
ATTAACACTACCTCTATGGAATGCAGTGGAATAATACTTAAATTTTTTTTAAAATATAGA
TCATCTTTGAGCCTGCACTTCTGTTAATAAAAATTTACCAAACAGGTAGACCTCTATGGA
TTTGCAAAGACATGTCAAGGATATATACTGCAACATTATTTGTAGTGGCAAAAGATGGGA
AACAACCTAAGTGAACATCAGTAGGTCAAATCAATTATAGGATGGCCACACAGTGGGATG
CTCTGAGTGACTGAGGAGAATGAGACATGTCTCCTTGGTATTTTATTAAAGAAAAAAACC
AAGGCACACGTCACTTTATTTGATGTGCTGTCATTTATATATGTACAACGTCTCTGGAAA
GCAGCATAAGAAACTGTATCAATTGTTGCCTCTAAGGTGTGAACTGATACCTGGAGTATA
GGTGGACTATACACTTCTTGTACCATTGAATTTTGTGTCTGTTTAAAAAATTGATATTTA
AATTTTGTTTTTTAATAGCTTAGAGGAAATGATAGATGGCAATTCTGATATCTTATGAAT
ATTTTATGACATCGATTTTGTAGCTTTTAAAACTGACTTTTGTCTGTTAAATAAAACTAA
GCAGTTAGCATCTTAGAATGAAGTAAAAATTTAATGACCTACAATGACAATGTCATTTCA
CTGTGTTCAAATCACGTGTTGTTGTTGTGTTATCATTAGGTATTATGACTCTGTCCCCTT
TTGATCAAATGAAGACTGCCTCCAATATAGGTGGATTTAATGCAGCAATTAAAAACAGTC
CACCCGCCATGTCTCAGTATATCACTGTAGGGTCCAGTCCATTTACTGGCTTCTTCTATG
CTTTAGAGGTAAGCATTTTGTCACTGATCCTAAGTAAGGCCATCCTTACTTGATTTTTCA
ACTTGTCTGCAAATTGGATATGGTAACTTAGCCTTAGAAAGATTAAGCAGTTTACATTTC
TACGTTTCAATTTAAGCTAAAATTAGTCCCAACTCACTTTCTTCTAAATTCTTTAGATTA
ACTGAAAAGGTGCTAAAATCAATATCAAACAAACAAACTTCTTTGATTCTGATGCCCTGA
GTTCTTGGACAGTTGAGTGGTCTTTAAATACTGGTACAATAGTTAGAAACTTGGGGCTGT
TAATGATGTCACCCCACCAAGGATTTGAGTAAATGAAGAATTGTAAAGACAGAAAAAGCT
GCCAGCTTAGTTGGTGTAATTGCTTACTAAAATATGAGAAAGTTAGGTGTTGGATCTGAC
AGCTCTTATTTCTTGTTTAAAAAGCACACTTCTCAGAACTGTCTAAACTATCTTTTTACT
TTAATAAAAATATATATTTAACAAAAAGAGAAAAGATGTGTGTAGATGAAATCCATACTT
CTGCTAGAATAATGCCATCTTAATGTCCTAGTTTAATTTTTTTAATTAAATTACGATTTA
AAGAGGGAAATCCTAAAAGATGAAATAGACTACTAATGATTTTACTTTTAAAGTATAGAG
TTAAAACTTTTGATTATACTGCTATCTCCTAAAATAAAGTTTTTATGGTACCCTCCAAAA
GATGCTGAATATTGTTGCTAGTCCAGCCTTTACAACTTTTCAAAACTTTTTAAAGTAAGC
ATTATTTAGAAAGTATATTTTCTTTCTGTGGTAGCTGTTTGCTTTCAAATGTTCTGTTTT
TCAGGGCAGCACACAGCCATTGTTATCTCATGTTGCACTAGCAGTTGCCAGTAAACTCAC
TTCAGCTCTATTTAATGCTGCCAGGTAATTACATAACAATTACATTGAAAATTATCTAAT
TTGTATCTAGCTTGGTTTTAATATATTTTGAGAGTCTGCACTTTGAAACGCTGGAAGCCC
TGTTTTTATTCTAAGCTTGCTTTCTTTTCAGTGGTTGGCTTGGTTGGAAAAGTAAGCACG
AAGAAGAAGCTGTCCAAAAGCAAAAGCCCAAGGTGGAACCAGCCACCCCATTAGCTGTAA
GGCAAGTCCATCGTGCTCTTCTTGAATTTTCATATTTTTAGAAGTATACTGTGCAGTTTA
TGGTCCTTCAGTGTGCTTAACGGATTTGTTGATCTCATGAGTCTTTGGAGCTTCTGAAAG
TCATTCATGTGGGATATTTTTTCCACCAGAAGGCAAACTCCATGAGGACAGTGGTTCTTG
CCCATTTTGTTCACAGCTCTTTCCTGTGATGTAATAGGTCTCAGTTGCTATCTGTGGAGT
CTGCTTTTTTACAAACACCTATGAACTTAGCTTAAGTACAGGAAAATTAGTTTTGTGAGA
GCTGTTGAATTTCTTACTTTAAAAGGTTTAGTTTGTCAGTAAGCTGTATAAACTTCAAAA
GTACCTAGTGATTTCTCTTAAAAAAACAAAAACGGGTGTCACGTGCATTCAGGCACTTTT
TAGAATGCTGGTTTGTGCTCCTTGCTTACTTCAGCAGGGCTGCAGGATATCTAGTGTATT
CATCAGGTTTTAGAGGGGGAAAGGCATGGTTTTTACTTGATTTTATTTTTTAAATCATTT
TTTATTACCCAATATAAAGTTCTACCATGAAGGAAAATAAAAACTTCCTCCCTTTTTTAG
ATAGTCTTCAACTAAAGAAATATAACTAATTATCTGTTATTAAAATTTCTTGAGATTTAT
CTTCTAAGGTTTTTTCATCTTATTTTAAAATGTTATGTTATAACACATCACATCTTCTAA
ATTCATGCAAGAATCAAGAAACAAGCCAAATGGCCTGTGCATCCAAATAGATGTAAGAAA
GTTTGCGCACTTGGTCTCAGGGACTTTTCTGAAAGTGAGCTCTCTGGGTCCTTGCTCAGT
ACCTCTGTACTTTTATTTTACTCACAGTTCTAATAAGATTGGTTATAGACTAAGAGCAGT
TTAGAGAGAACTATTTAGAAGGAAAGTTCTTGCTTCAGGCAGATACATTGGTGTCAGCAA
GATATGAAATCTAGCAAAAAAGAGAACAGATTAGGAATAAGAACTTAAAATAGATGAAAG
ATGCCTGTGTAGGAGGCAAAGCATTCTAAAATTTTGTTGGTTGTGAAGATGTTGTTTCCT
ATGACATGACTACCACTCAGTCAAGGAAAGATAGTTATACTTGATGTTCTCTAAAAATAT
AAGGTTGTGGACTTCTATATAGAAAATCTGTGAAATAAAACATGTGTTTTCATTTTATAG
TAGAAGAAACTTCTTTATGTATTTTATAATACAAAATATCAGCTATGATTAGTTAATAAG
TTAACTATTAGTCCATGCAAAGTTCATATAAAAACAAATTTGGCCTATTTTATTTGTGCA
TTTTATTATTCTGTTATATATTTCTAGATTGGAATGTGATTTGAGCTTTTTATTTTCTTT
TAAATATCAGGTTTGGACTTCCAGATTCTAGACGCCATGGTGAAAGTATATGTCTGTCTC
CATGTAACACACTGGCAGCAGTGACAGATGATTTTGGCAGAGTTATTCTATTGGATGTAG
CTAGAGGAATTGCAATACGCATGTGGAAAGGTATTTCCTTACAAAACATCCAGAAAGAAA
GTGGATTTTCCTTTTATCCCAGTTGTTGAGCAACATGATCGTCCTTTAGCTTCTGGTTGA
TAAAACTGTTTACTTACTCCTTTATGTTTATGCTTTGTTTTCGGTTTTGGACATGAACTC
AGATCAGCAACACTTGATCTAGTTGTCCAGTTGATGTATCCTTTAAGTCTGATCAACTTT
TAGGGACTTTTAACCTCTTTCCATTCTCACTGTCAATTCCTGAATTCAGTTTCTTGCCCC
TGCTACATTCATTCCACTTTTCAAGGCTGTACTTGAGTGAAATGTTCTCCTCAAATCTAT
AATGCCAAGTCTTTCGGATTTAAGTAAGCAAAACCTAGCAAAATCCATCTTTGCTGACTT
GACTTCCATATCCATATGCTTGGGTCAGTTCACTTAGCTTCTTGGTAACTATGCCAGTTA
GGAGTTGCATTTAGCTGCTAATAACAGACCCCAGTAAAGGATTGATATGATATCCTCAGG
AACCCAGTCTCCATCTGTGTAGCTTCCCCGCTCAAAGTTATCTCATGGTACAGATGGCTG
CTGGAGCTCTAGCCCTCCTGTCTGCATTCCAGGAAGAAACAAGGGGAAAGGAAGAACTGT
CAGCTAAGTCAGTCCATTTTGAAGATACTTCCTGAAGTCCTTCCAACCTTTTTCTAAATA
CATTGTCCAGGACTTAGTCACGTGGTCATACCTAACTATAAGGGAGACTTGAAAATATTT
AGGCACATTGTCAACCAGAACAAAATAAAATCTCCTTGACTAAGGAAGAAGTGGAGAATA
CATTGTTTGGAATCATCCAGAATAGTAACGTGTCAGCACAGACTCCTGTTTGGAAACTGC
AGTTCTGGTGCCATGTGGTCTGTACTTAACAATGTGAGGAGTAATGGATTCAAGGACATT
AAGTTACTCTGGACCAGACTGAGTCCATTGTCACCTTCTTGCCAAAGAATTCCTGCAGTG
TTTGCCTGCCACGTGTTTGTGTCTGTAGAAATAAGTTTCCGTGCTGCAGGTACATCATTT
CTCCTTGGTGTTTGTCTTCTGAAATAACCTCAAGGGTATCTTCTCAGCAAGACTTTTCCA
GAATATGGAAGACATAGGTGTGCCAGCTGGTCCAGATCCAGGATGGTGATCTTATTGCTG
GCATTGTTGTCTGTCATTCTGGGGCTGGTGCAGTCAGTGTCCTCCCCATACCGAGGAGAG
AGGGAGAGAGGGATCAATTACCTGTGAGAAGGACCACCCTAAATGGAAGACAGCGTCAGC
TGTGTCTTTCTTCTCACTTGCGGGAGCTTCCTCCCATCCCTCTACGGCCCATGTTTTCCC
TCTCTCTGCGTACCACCTGGGGACTGGAATAGCAGGAAATCACTTTGATCTTTTTCTTAT
ATTTTAACTGGACTTTTGTTTTAAATCCAAACCTGATAAAAACCCCAGAATTTTTTGAAG
AGAGGGAGGAAAGGGAATGGGATCAGGGAAAGGTACTCATGAGGTTTCAGTGATACGTGT
TTTTAAAGAAAAAAAGTGATTGGAAGCAATTATAGCAAAATATTAAGATGTAATAAGACT
TGGTGATTAACTCAGTGTTTATTATAATTATTACTATTTTATGATTAAGATATTTCATAA
TAAAAAGATAACATAGTGTTATAGCTTTTCTTAACTAGCCCCCCCCAAGAAAAATATCCC
AGAGTGCTTCAGAAGGCCGATATTGAACTTAGATAAATAAACTAATTAACTTTGCTTTTC
CTCTGTCTCCAAGGGTATCGGGATGCACAGACGGGTTGGATCCAGATTGTAGAGGACCTC
CACGAAAGAGTACCAGAGAAAGTAGATTTTTCCCCCTTTGGGAACACTCAGGGTCCAAGT
CGAGTAGCTCAGTTCCTCGTGATCTATGCGCCAAGAAGGGGAATCTTAGAAGTGTGGAGC
ACACAGCAGGGGCCTAGAGTAGGCGCCTTCAACGTGGGAAAGCACTGCAGGTGAGCTGCA
GCCCCTGGCGTTCTCCTGGTTACAAACAGGAATGCTTTTATTGAAGGGAAGCTTTTATTA
AAGCTACTTATTAGATTGCAGGTTGTTTGAGAATTGAAATGTTCTTTATTGTGGTTTTTC
CTGCAAGCGCTTGGTATGTAATTAAGGATTAAGTATTTAATAATGAAGGAATCTTATTGA
AAATCAGGCATGATATGCTGCTGAATTAAAGTCAGCTTTGGTGCCGCCGTTTCTCCCCAT
CCCTTGCTTACGCCGTGGAGGCTCTGAAGGAAAGATTCCTTCAGATTCCCCTGGTGATGA
TGTTAAGAGGGGTGAACGCCTTGTTTGCCATTGCAGCAGAGGCCTGATTGTGTTCCTTTA
ATTTTCCAGCACATTTTAACAAGATAGAACTCAGCCAGTCAAGTTCTACTTTACTTATAT
TTTTGGTATCAGTATTTATTTGCCATATTAATGCTCCTGAATTGATGATAATGTAGGGGT
CCTTAGCTATAATAAAAGCACCTTTGGGAATTTCTTCTTTCTCTAGTATTTTTTACCATG
TTGGTATGTGATTTTCTCAGGCTTCTGTATCCTGGCTATAAAATAATGGGCTTAAATAAT
GTTACCAGTCAGAGTTGGCAGCCACAGACTTACCAGATCTGTCTTGTTGATCCAGTGTCT
GGAGGTGTGAAAACAGTCAATGTCCCTTTCCATTTAGCATTGAGGTAAGGTTAACGGAGT
GTCCGCTTATTAATGTCCCTTTGCTGACGTTGCCTACTCCCTTATTTTGCGATTTGTTTT
GCGGTTATTGTTTTGTTTTCTTTTCTCATTAGACTGATACCTTTAAAGTTAAATAGGAAG
AATATGAAGGAAAAAGAAATTTGGAGCATGTGAAAATTAGAAGGAAAACAGTTTCACATT
CTGTAAGAATTTGTTGTATTTATTGTTTTAGTGATAAGAAGAGTGAACGAGCCAAGGACA
TGCACTTAGTTAAGAAACTAGGAGCCTTACTGAAAACAAAATCTCCCAGCCTCGGTATGT
ACCGTTTAACAGAAAGAAGAAAGCATACTGTTATGTCGTTTTTAATAGAATATTCTAAAT
GGAGCAATCAAAACACTCCAGTGTGTTTGTGAGCTATTGCATCTCCTTTTTGGAGTGAGG
TGAGGTACCAGTAATCACCTGTACTTTTTACTGGAATTGCTTTGTAAGGATGAAGTGTGC
CATCTAGGGAGGGTTAAAATTTGTAACAGTGAAACAGTAATTCCTGAGAGAACCTAGAAA
TCCTGTAAACTGATGGTACAAATATGTGCATTTTTCTTCCAGAATAAAGTTTACGTGTAA
TAGAAGTGAAAAATTTACTTTGGTTAATTTTCTCTTTCTAGATTTGATTGAAACTGAAAT
AAAGGAATTAATTCTTGATATTAAGTACCCTGCAACCAAAAAACAGGTAAGCATTTATAA
TATATGAACCATCCTGCTGAGTAGCTTTCCCATATCCCTCTTAAGAAAACCTTTTTTCCC
TATTTCCCTCTAAACATGACAGGCTAAAGTCTTCTTTTCATGTTTTTATTCATGTTCATC
CTTTTTTATATTCCCATGTAGAAGTTCCTTTTGTCTCTTTCTTTCAAATTAATATTACGG
TACACGCAAGTGCATGTGTTTTATTCACACACACACTCAAATCTACACATAACACATATT
CAGATTAAATAATAGTAAAGCAACCACATGTGTGTGACCACCCACCTTAGGAAACAGAGT
GTTACAGGAACTCTGAAGAGCCTGGCATGTCTCTCCTCCATCCCAGCCTCTTCTCCCATC
CCTAAGGTGACCAGTGTTCAGAATTTTGTTTCTCTCTCTTTTGCTTTTCTTTATGGTTAT
ATCATTTCTTCATGACTCTTTTAAAACATAGTGATGCATTTTCTGCCTTTTAAAGCTTTA
TGTAAATGGAGTCATGCTCCATGTCTTCTTGTGTGACTTACTCTGTTCTTCAGCATTATG
TTTCTCTGAGTCCTCTGTGTTCATACACGGAGCTAACGTTGATTCATGCACTGTCCTGTG
TGAATCCCACTTGGTGACTATCATTTATTCATTCACTCTCCTGTCAGTGGACATCTAGGT
TGTTTCCAGTGTTTTTGCTCTTACAAACACCAATACTATGATTATCCTTGTGCATGTGCC
CTGGTGCACATATGCAAGAGTTTCTCTCGAGTTTATACCTAAGAGTGGGATTGTAGGGTA
TGAGCTTCTTCAGCTGCACTAGTTGATGATACATTGCTTCTCAAAATACTCATACTAATT
TCTGTTCCCTCTTGTAGCATATAAGACGCTTTGTTGCCCCGTAGCCTCAACATCTCATGG
TTTTGTCAGACTTGCCCTTTGCCAGGCTTGCAGTTATAATATGATAACTCATTGTGATTT
CTTTTACTCCCACTTCTCTGGTCCAAACTCCTCATAATGCTGCTCAAGTTCTAACTCTGC
GCCTTCTTACGTGACACTCAAATCCCCTGGACACCTCTGAACTCCTGCTCTAGTTTTAAT
CAGAGTCAGATAGCCAAGGACTCCTTGTTTTCTAACTATTTCATGTATATTGGTCATAGC
TCCTCAACTTTTTCCTATTTACCTCTTTTAAGCTCCTTCAAATGATGTATGAAAATACAT
CATTTTCATAATCCACAGCATCTCAAATAATGTCAGATACATGGGAGAAGTCAGTGAACA
CTGATTTCTTTTCACCCCTTTTACTTTACTGTTGCAGTCAATTTTTAAAAACACTTTTGA
TTGTTTTGTTGTAGAACAGGCGAGTCCCTGTGGTTTTTAATGGGGTTTTCCATTCCCCTG
ACAGTGCTAATTGGCTCTCATTTTCCTCAGGGTAAAGTCTCAGTTATGAAAGATGACCCT
CTGATTTCAAGGTGGGCAGCTAGAGAGGCAGCTTAGGGAATCTGTCGCAGAAAAGGAGGG
TTGTAACCCAAACAAGTCTTCTCATTCTGATACCATCTTTCTTCTTATCTTATGTCACAG
AGCAACAAAATTGGAAACTTTAGCATAGTGCACACTGTCTTCTTGATTTTTTTTATTATA
CTACTGAATTATGTACAAAGCTATGAATTTTATAAAAATACTGGAAAGCTAATAGTGAAA
GTTGTATATTGTTTTACGACACTAAAGGGAGAAAAGAAACCAATTCAGGCTTTGGAAGAC
TGAATAATGGGAAAGTAAGCCAGCTGGCAGCTTGTGTCGTAGTAGACAGAACAGAGGCAG
ATTACTTCTTCCTGGGTATTTGCCTCTTTCCGTCTCTGTCTTTATATCCTCCATGTGGTT
GCCTCATCATAGGTTTGACCAAGCTCTTGAGCCACCATCCAAGTCCATCTCCCCCACAGA
CACACAGAGGTTGTGTCATGATCTGATATTTGTCTTATGCCACATTCTCAGCCTACCTTT
TAAACTAAGCTCATCAATAAAAATTAATGTAGGTTGGCTGGCACCGTGGCCTAGTGGTTA
AGTTCAGTGCAGCCCAGGTTCGGTTCCTGGGCGCAGACCTACACCACTAGTCAGCGGCCA
TGCTTGGTGGCGACCTACATGCAAAATAGAGAAAGACCGGCACAGATGTTAGCTTAGGGC
AAATCTTCCTCAACAAAAAAATAAAATAAATAGTGTAAAGTGCTAATATGACAGAATAAG
TATGCACTTTAGCTGCTGTGTCTAACTTATTCGTGATTCTGATGGTTACTTCTTTAGGCA
TAAAGAAATATTTTGGAATTGGTGATGAGGGCTCTTAAATACCTACTGGGGGCCAGGAAG
GGGTAGGTGGGGTGAAGTAGGGAGTATATATATCTAGCGTGGCCTATAGATCAGCCAGCC
ACACTCATATGCAGTAATTAAGCAGTAGTTAAGTTGTTGTCAGTTTTTATTATGGACGTG
ACAGTAATAGCCCCTGCTTGTCATTTGTACTTAAGCAGTATAGATTTATCAGCCTCTTCT
TATTGGTGAATAGCTTTATCTCTGTTTCTATTTTGTCTTGACCATTCTGTTAAACATCAG
GTACCTTCTAGTTGTTTCATTCTCAGTCTGGACTTTGTGTCCTTATACCATGTTTAGCAT
GGCATGAAATTGATTACATATTACATATGATACAACTTTAATTCTTAGGTCTGTATAGTC
AAACATGTTAAAAGTGGAGTTTCCCTTTGAAACTTGGGGTAGTGAAAGTATAGGCATAAA
TATAAAATTTTTTAAAAAATCATTGCCTTCTAATTAGAATTGCTCAATATCTTTCCTCTA
GGCTTTGGAAAGCATTTTGGCAAGTGAACGTTTACCATTTTCCTGCCTTAGAAACATCAC
TCAGACTTTAATGGACACTTTAAAAAGTCAAGGTAAGGAGCTGGCCAAGTGGCTTAGTGG
TTAAGTTCTCCTGCTCCACTTCAGCACCCCAGGGTTCTTGGGTTCAGATCCTGAGTGTGG
ACCTACACACCACTCATCAAGCCGTGCTGTGATGGCATCCCACATACAAAATAGAGGAAG
ATTAGCACAGGTGTTAGCTCAGGGACAATCTTCCTCAAGCAAAAAGAGGAAGATTGGCAA
CAGATGTTAGCTCAGGGCTATTCTTCCTCACCAAAAAAAAAAAAAAAAAAAATCTTGCAC
TATGCTGGGAATAAACCAAACACTATTGTTGAGAATCCATGAAATCATCACTAGTTTCAA
GTTCTACCTATTAGTGAGATTCCTAAAAATTTCAAGTATTTAGTATGCTAAGTTTTATTA
TGGCCGTAACAGCTTACATAATATTTGAGTTTACTGTATCCTGAGTAAAAGTTCTTGGGG
ATTTTCAATGTCTGCCTTTTTAAAGAATAAATATTTGGTTTTTTATTAGATATAAGTATT
TAAATTATCATACAAAAATGTATGGTATAGAAAGTGAGTATTTTTCCAGCATTAATCTTG
AAAAAAACCTGATTGATGGAGCACATTAAGTGGGATTCTATTTTTGGTCCCTTTGCCAGG
CTTTCTCGAGGCTACATCTGTCACAGTCCACAGTTTCTGGTAGGATTATGGTATCTTTGT
CGACCACAAGAGCAGGAAGAGCCAGGCAGCTTTCTGTCTGTCTGTCCTCAGCGTGGGAGC
ATAACAGGCAGCATGTGGGTTATGGGAAGAGGGAGAACATTTTCAAAGCTGTTTCCAGAT
CCTTTCTTTAAATTTGAGTATTTCACTAAGGAGTTCTTTTTTCTTTCTTTTTCTTTTTTT
TTTTTTCCCTTACCATTAGACCATCTTACTTAAAAATTTAGACATTTTGCCATGATGGAA
AAATTGTCTTTTCCTTATTAATCTGTTGTAGCTTAAGCATCCAAATATTTAATAAAATAG
AACATCAGGGAATTATATAATAGTATTGAGATTTAATGAAAGAAAAGCCTTTTTATGAGT
CTGTTAAATATATCTCTTTAATGTGTTTTTTTCCTCCCTTTTAGAGCTTGAGTCTGTTGA
TGAAGGATTGCTGCAGTTTTGTGCCAATAAACTGAAATTACTTCATCTTTATGAGTCTGT
CAGTCAATTAAATTCCCTTGATTTTCATTCAGACACGCCATTCTCTGATAAGGTGAGTAA
TCCCATTACTTATTATACAAAATAATCTCTTTGATTATTTTTAACTTTTTTAATTGGTAG
TAAAGTAGTAAGAAAATTAAGAATTTTTATAAAATGTAAAAGTATGTTTTCTTTTCAAGA
CCCCCTGCTGACTCTGTGCCTTACTGCTAAATTTATATTTATGCTAGAATATTGAATTGT
ATTGTTAATCCATTTTTGCTACTCTAGAAGAATTTGGTTTTTCTCAATTTGTCTTTTGAG
GTTCTTACAGTACAATTTCTAGACCAGATTTGACAATTAAAATATATTCTGTTCACTGAA
GTAGCAAAACTTTAATTTCTTTTAAAGAAAAAAAAATGATTCTGCCAAACAGAAGAGACC
AGTTTTTCTATGTTGTCATTGTTAGCAAACTCATACAGCTTGCTCTGTTGTGTACTACAT
AATGAAATACATTTAAAAGATATTCTATCTTACATCAGAGTGTTTAAGCTAATTACAGTT
GTGTGCCACATAGTGCTGTTTTAGTCAACGACGGACCACATATACGGCAGAGGTCCCATA
AGATTAGTACCATACAGCCTAGGTGTACAGTAGGCTGTACTATCTAGGTTTGTGTAAGAG
CACTCTACTGTGTTCGCACAACGACAAAATCACCTAATGACGCCTTTCTCAGAACATATC
CCCGTCGTTAAGTGATGCATGACTACACAGTTCTACGTTTGTGTTCCACAAAACATGTTC
TATGTTTGTATTCCACAAAACATGAACGAGTGACAGCACCTTGTGAGCTTTCTTACAGTG
CAGCATTGCTCCTTTCTGAAGAGTGTATACAAAATTCTTACTTTCCAGGCAGAGAAATGA
AGCTTCCTTAATAGAGAATGGGGAGAAATACTGTCCTCTCTTCTCCTCAGATCACTGTGT
GACCGTGGCCAGGTCACCTGGCTTCACGGCCTCATGTCTTCTACTTACCTAAAGGAAAAT
TATTACTAAGATGATTTTAGTGATTTGTCAAGTCACTAGTAATGCTTTAAAAAAATTATC
TGGTATATCTGAAAGTTAATTGAGGTTTAAAGTGGAAGCCTTTTATTTTAAATATACATA
CATGAATAAAAATTTTTAAACAGAAAAATGGGAGAATTTTTCTCTCTCTAATGGAAACAG
CTTGCACATTCTAACATCTTTTTTATCTTTGGGATTATAGGTGGAATTTATAAAGCATTT
TAATAATCTATTCATAATAATATTCTGTGATTGCCTTTATAAATGACAAGGCCATTTTTT
CAGGGCCCTGTTTTTCTGTCTACTTCAGCAATAGTGTAAGATCATTCAAGTAATAAGAAA
GTTCAAGTTGATTAAGCTATGTTTACATGATTCCCTTGGCATTTCATAGATTTTTCAATG
CCTAATTTTTTCATAAGATCGAAACTTGCTCCCTGCTAAAGACAGGTAAATATACATCAT
TAATAATCCCACACACAGTTCCTTTCCACTTGATAGCCCCATATAGTGTGCAAAGATAAA
AGAATTATAGAATTTTAAAAATCAGTTGGCAGATTGTTCTTTTTTATTTTTTAATTTTTA
AAGCACTTTTTAAGAATTAAAGCCGTATTTTGCTGTAGACTTGTTTAGATCCTTCAGAAA
GCATGCAGTCAGCTTCTAGGCTGAATGGCTAATTTTGTACATATGAAACTAAAACGCAGA
CCTGAATCAATGCATTTTTGCTGTCTGTGGACATAGTTCATGAGTTCCCCTTATGACTTC
AGTATAGCATTTAACTGCTGGTATGTACTCAGTAGCATTTTGCAGTTTACTTCTTGTTTT
AAAAAACAGCAGCCTTAAATAAATAAATAAAGCTGCTCTGGTTTAAGAATGCAGCTTTAA
TTATGTAGCACAGGGGGAGAAAGTTTTGCTTGCTATACAAATTTATGATCTGTTACGTGC
TCGTGCGTGTGTGTAAACTTGCCCCTAATTTAGAAAAATAATAGTACTATCAAGAGATGT
TTCTGCACATATGGCGTGTAAAAATAGTTTGAAAGGCTGGCAGCTAGTATCTGTGACTTC
TCAATCTCTGAATCCCAAGAGCCACACAGAGGATCTGTGTGTAGATACAGTGAGATTGTT
CTCCAGTGTTTTTATTTGATAGCGTTTATGTTGCTTAATAAATGTGTTCAATTTCTTATT
GAATAGCTCTTTAGTTTCCTCAGAATCACAAGAGTTGAAGTTGACAACCTTTTAATTTTT
TTTCTGATTACACAATATCTTTAAAATTCAAACATTTCAAGAAACTTTCTAAAAATGATA
CTTTTAGCAATATGTAATGTTTCAAGATGAGCTTATTTAAATAACCTCCCAGTCATGAAC
TTGAGAGTAAAGTTTTAAACAGAGTGCATTGTAGCTACCACAGTCATTAAAAAGTTATCT
TTTGCTCATGGTCTTGCGTTTCATTCAGATGATGGGGTTGACACATATGGCAGATTCGTG
GAAAGAAACGTGGTTGATTGAGGACTTTTTTTTTCTATTTTTAAGGACTTGGCTGTGTTA
CTAAGGCTTGATGAAAAAGAACTCCTTCAGCTCCAGGCATTATTAGAGAAATATAAACAA
GAGAACACCAAGACTACTGTCCGATTTTCTGTTGACAAGGATGGTGTGCTGCCTGTAAAA
ACATTCCTGGAATATTTAGAATATGAGAAAGATGTGATCAACATAAAGAAGATAAGCGAA
GAGGAATATGTGGCTTTAGGTAGGGAGAATAAGAAACTGCTCTTTGAATCCTCGCTCTTC
TAGATGAAGGCCTGGAAGGGGATCCCAGCATCTCAAAGATTCAGTTTGTTTTGAAATTAA
ATTAACCAAGGAATTTAAGGTATATTTTCCAGTCAACAGTAGATACTCTGGATGTATAGC
TTCTATGTCATGAAAGTTGTGTTAATAAGTGTGCTTAAGAAACAGTGTTAGACATGTGAT
GATTTGCCTTCTGCTTTCATAAATCGAGCAAACTGAACCATTGCTTTCCCTTCTCTCCTG
TTGTTTTGCAACTCTGGGGATCTAGATTGCAACTCAGCAAGATCGTTAGTCCAAATGGTA
AGCAGTCGTTGGTTAATGCGTTCTGTTTTTGTGTCACTAGGGAGTTTCTTTTTTTGGAAG
TGTTTGCATGGAGAAAGCTCCACTGAGGACATGTGTCACACTTTGGAGTCGGCTGGACTT
AGCCCTCAGCTGTTGTTGGTAAGGTTTCTTGTTGCTAGATGCTATCTTTCTTGCTAATGT
CATCCAGAAGTGTCAGTCCTTTTTTTACCACTGGCTAAAGCATATCGTAGAACATACATG
AAAACTTTCTAAAAATGATCCAAGAAGTTTATAATCACCATTTTTAACTGGATAATATTA
TTTTATTTTTCTCATTCCCTGTAAATTATAACAAGCATATTCTATAATTGGCCTAAAATA
AATTTAGAATCTGACATGGATGCATGTATTTACAATGGACCGTGATCATCAGTAAAAATG
TTCATATTAGAACTAAAAAAGATCTTATTTAGAGAACAAAGTTCCCTTAAAGTAATATAG
AATTATCAAACATTCCAAAACTTTGTCTATATGTTAGGATTTAATCTCTGTGCTGTAACA
AATATAAATAAAAGAATCATCCAATGGAAAAACTACACTAAATTTTAGTCCTTTCTGAAA
AGGGCAGGGGAAGTTACCCCACCATCATCAGTTCTCCACTTTACCACCCCCACATGTACA
CATATATACATACTCTTTCGCACCCCCACTCACATCTTATATTTTGGCCAGGATTTAGGC
ATTCTGCCCCTATGAACTTATTGAGTGTGTTAATGCATTGTTTTAATTGAATGTTTAAGT
TCTTTAAAAATGCATTTTATTCTTCTTCACTACGCAGTATATATGTCAGGAAGTAAAGCA
GTTAAAGATACACATAGGATGTACGTGGATGTTCATAAGCAGCTTTATTCATAATAGCCA
AAAACTGAAAACCACACGAATGCCCTTCAGTCTGTGAATGGTTAAGCAAACTGTGGTGCA
TCCTTACCATGGACTATCACTCAACAATAAAAAGAAATGAGCTATTGACATGCTCAGCAA
CTTGAACGAACCTCAAGGAAAATATGCTGAGTGGAAAAAAGCCAATCTTAAAAAGATGCA
TATTGCATGATTTCATTTTTGTAACAGTCGTGAAATAGCACAATTACAGAGATGCAGAAC
AGATTAGTGGTCGCCAAAGGGTAGGGATGAGTTGGAGGAGGAGATGGGTGTGGCTCTAAA
GGATTAACACAAGGGAGTCTTTTTCTTTTTTTTAAAGGTACTCAAATACATCTCAATTTT
ATTAGGATCTTCTATACACACATTGTTTGCCACTGAAAACTGAAAGAGCACAAAAAATTG
TTAGAATTCAAATTTTTGAAAACTTGAAAATCTAGTTAATGCACCCTGCTCTGATCATGC
TCTAGCCAAACCACCCAGTGTTTTCTTTACATTCTTTCCACAGGAGTTACTTTGCTTCAA
ATTCTTGATGTTGGGTTTCATCGTACTGACTTCAGGCTTCTAAAACACAGGCAATACTTG
AGACATCTTACTGCTTCTTTGGGTCAAATCAAGAAGTTAAAGTATATTGAAGTCATTCAG
ATGCAGACTACATAGATTCCTTATAAATTACTGGTATCGAGGTAGAAGAGAGATGCAAGA
AAAGAAGACATCATAGAACTTGTATTACAGATTATCAAAATACTGGTGTACAGTCCATCT
GAGCATAGCTTTCCCAAGCTGTTGCATAATGATCCTAAAATTACTAGCAAGAATAAGGTT
TGTGGCTCAGTCAGCTCTGTGTGATAATTATTCTCCATGCTAGTATTCTCAAAAAGATCT
CGATGATACAGGCAATAATGACAGCTACATCTAAATCTTTGAGTTCTTGATTGAACCTCA
ATTTCGTGGTTCTCTTTGAAGCACAGGAAGTTGGCTAGAGTAGCAGTATTTAATAATTTG
TATCATCCTTTGCATCCTTTCTTTCCGAGCAGTTAACAGTGTCCTTACTTCCCTTCTCCT
GTAGGGTATGCCATCACATAACCCCTAAAATTTCTTTTCTCTGTCAAGCTATTTGGGTAG
ACATTCTGGTATAAGGGGAGGGAATTTGGTACTAGGGTTGAGAGTCTAGTTACTAAGGTT
CTTTGTTAATGCTTCTGAAATAGGTGGCGAGGCAACTGGATCTTCCTGGGACTTTTCTTC
ACTGGGCATCTGAGAGGACTCCAGGGTCCAGGTTGGGTTAACTTTGATGAGTCCATTGGA
AGTTTAGTCACAGCTTGAAGCTCTTCCTAGATCTTTGGGTTGAGTAGAAGGTGATGGGCA
AAACTCTCCAATTGCTACAGAGTAGCCTGGCAAGAACTATATAGCCTAGAAAGAGTGAGA
AAAACTCAACTCCAACAAACTGTGATGAGAGAAAGAAGTAACCGAGGGAGTCCTGTACTG
ATGGTCTAGTTGAGTGTCTTGATGGTGATGATCATGCAAAGCTACACGTGAGATAAATTT
GCATGCACACCCAAATGAGTGCATGTATTGCCTGTGAGATTTGAGTGAGTTCTATGGATT
TTACCAGTGTCGATATCTTGGTTTTGATATTGATATTGTGTAAGATGTTAACATTAGGGG
AGGCTGTGAGAAGGGTGCCTAGGACTTGCCTGTGCGTGTCTTTGTGCCACAGTGAATCTA
AGTTAAAAAGAAAGGAGACAAATATTCAAAGTTGAGATGATTAAATAAGATGAATACACA
ATACTTCTTATTTTACATTGTGTTTAATCAATATCAATGAAATTTTGTTGTCTGCTTTAA
ATCTTGGGTTTCTAAAGAAACACTTGAAAAAAATGAACTTCAAACCTTACCTCAAGCCAT
ATTTAAAAATTAGGTCAAAGTGAAACATAAATGTAAGAATTAAAACTACAAAACTTACAG
GAGAAAACATAGGAGAAAGCTTGGTTTAGGCAAATATTTCTCAGGACACAAAAAGCATGA
ACTGTAAAAGAAAAATAACTGATAAATTATGCTTCATCAAAATTCAAAACTTCTGTTTTT
TTAAAAGGCTCTGTTAAGAAACTGAAAAGGCAAGACTTTTTTTCAAATCTGATAAATAAA
TTGTATCCACATTATACAAAGAATTAGTACAACTCATTAAGACAAACAATACAATAAAAA
AAAATCAAGATTTGAACAGACGCTCATCACCCAAAAATATACCTAAACAATGGCAAATAA
TCTCCTGAAAGATATTCAACATCATAAGCCTTTAGGGAAATGCAAAATAAAATCACAGTG
GTCTCTTTCCCAAGAGAAATGACTAAAATTAAAAAAGACTCATCTTACCACAGGTTGATG
AGGATGTGGAGCAGACAGAACTCTCAGCACAGCGGATGGAGATGCAAATTAATATGACCA
CTTTGGAAAACAGTTTGAAAGTTCTTATAAAGTTGAACATAGATATACCATAAAATCCGA
CAATTTCACTCCTACGTATTTATCCAAGAGGAATGAAAATATATGTTCACATCGACTTGG
ACTGAATATTTACCCCAGCTTTATTTATAATAGCCCAAACTTGATATAACTCAAAGATCC
ACCAACTGATAAATGGATAAATAAATTACAGTATATCCATACAATGGAATGACCTACTGA
TATGTAAAATAACATAAGGGAGTGTCAGAAGCATTATGCTGAGTGAAAAGACCCAGAAAC
AAAAGACTACCTGCTGGACGATTTCAGTTACATGAAATACTAGAATAAGCAAAAATATAG
TGACAAAGGAGATGAACATTTGCCAGGGGATGAGGGTGGGGGTTGGAAACTGACCACAAA
GAGGCACAAGGGAGCTTTTGATGGAGACGCACTTCATCATGTTTATGGTGTTGTTTACCC
AACTTAAAATTGGGGAATTTTATTCTAAATATATACATTATACTGTAATAAAGTGATATG
TATTTATGGGAAATTTCCCTACTTGAAACTCATATGGCTGTGATCTATAAGTATATTATT
GTGCTATAAAATTTATAAAATGGGTTATAATTTTAAATTAAATTATTTTTTAAAAATCAT
CTAAATCTGGGAGACTGTGTTTCACACATTCCAGATGATTGATCTCTTTTCCCATTGCTT
TTCCCAGAGGAAGATTTTATGGCTGGGTTTCATTTTTTAAGTATTATATCAACAGCTGAA
TGCTTTTAAGCAATCTTGTAATTTTTAAAAATCCTATCGTGAGTGCAGAGTAATAAGGCA
TTTTCACTTAAAGCATGTAATTAATAGTCGTGAATGGGAAAGGAAGGGGGAACTTCTCTG
AAAAAAAATACAAAGCCCAAGAATTAAAGTGAGAAATTGAATGTATAATAAAACAAGCTT
TTTAAAAAGGCTGCTTGGTCATCGTGGTCACATCGATCAGAGGAAATGGGAGCCCACACC
CTCAGGCCTTTCCTAAGCCCTCTGGCCTTGGGAAGATAAAGCGCAGGGGTACTGTGCATT
CTGCTTACATCTTGCTCATTCCCAGAGCAGTTAGTGCAAGTGTCAAAACAGACCAATAAC
GTCTTCCTGAGTTATTCAATTTCAAGTAGTTTTTAAAGAGAATAAACAAACTTCTATTGT
ATTAAAAGCGTAACAGACTTTTAGATACAGAAATCATGAATAAACAGTGATGTCTTTCAG
CAAAATATGTTATTAGTGTTATAAAGACAATCTGTTTGACATGCTCATTCTTCCTCTTCT
TTTCTGATTATTTTCTGAAAATTTTAAATGGTAATTTTATTGGAATTATGTTCATGAAGA
AACTTGGTATTTATAATCTAGGTTGTAGAAGTTTTCACGTTTAGAAAGATTTCTAGATGT
ACTATACCCACAAATTTTTCGGTAAAACTTTCATTTGATTTAGTCACTCTTTTGCTATAT
TAGTATGATTCATAGACAACAGCTGATAGTTTTTCACAGCACTTAAAACTTTATAATTAT
CTTCAGTGGAATTTTACCAAGTTTTAGCTTCTGTAACCTAAGACGAACCCCAGTTTTCAG
GAAAGACTAGAAAATAAGGCTTCTCCTAGAGACTGACAAAATAGGGTTTTTTAAGTGTAG
ACAGGCAGGGCTAGCAGGTGGCTTGCTCCTGTCCTCCGCCAGCGTTTCCACTGAGGGAAG
GAGCAGAGCTTTTAGGATGGCAGTGTTATAGGAGGACACTTGGCAAAAGGCGAAGGTCGT
TAGGTATTAGAAGCATCAACCAACGCCTCATAGGATTTTTTGTTTCATTCTTAGGTACAG
GTTTTAACATCTTAGTTACTACTTAACTTAGAACAGAGGCATTAACTAAATTTCCTCTGA
AGATTTCTATTATTCAAAATCTCTTACTCACATTTCATCTGGTAATATGTCAGTATGTGA
CATTTATTTATATGTGAAATAATTCACATTTACAATATGTGAATCGGTGATATGAATGTT
CACATTCTGAATAATATAGTGTGACATTATTTGCTATGATGTTTTGAAAGGATATCTTAT
TTTGTATTTGCTAGTTATAGAATAGTTACCTTCCATATACTGTCTTTTCCTGTTGTGTGT
GTATGTGTGTATGTTTCTCTGCGGTAGCTCAATTTATGTCTGTATTCTCTTCTTTGATTA
TTTTTCTTCTTTCACCTCCATTTTTTCTAAAGTTTAAAGAAATCTGTTGCCTGTAAGTGA
TTCTAAAATTGTATCATTGTGCCCTGATGGTTCCCATGGCATCCTGTCTTTCACATTCTA
TGTGTTTTGACCTTCTGTATCAAACAAAAGCTTAATTGATTGGAATTTTTAAAGTTTGTT
TAAAAAAAAACACTGTAGGTTATAAGCCAAGATTACCTGGTTGGACGAGAGATAAAGAAG
GGCTGACCTAGGAAGAGATGGGGAAGAGGAGTTAAGCAGAGGAACAGGTTCTTTTCGTTT
GTTTCAGAATTTGCTAAAGGTCGTGGTGCACAGGGGGAGTGGTTAGTTGGAGAGAAAAGT
AGAAGAGCTCATAGTGTGAAGAGAGATCCAGGGCATGGTGTTTAATTTATCTAAATATAA
TTTAGTCTAAAATAAGCCTTTGGGTTGCCAGTCTTTATGAACACTTTGAAACTTTGTTGC
TGGTGGGGACATGAGTCAAGCTTTGAGAGACACTGAACCCATTAGTGTGTTTAGAAACCC
GGTGTACTCTTAAAATAAGTCCTGGTCACACATTTTGTGCCTAAAATTAATCAGAACGAG
TCCAATGGCAACTTGAACAGTGAACCTAAACGATAAATTCTACTGTCCCCCCTCCTTGCC
TTTTGATTTGCTTCACAGCATATGTGCGTACAAACCCCGAGAGTAATTTCCTGTTGATAA
TGGAATGTCTTTGTTGCCTACTCAGGTAACCAGTTTTTTCAGCCTGCCCTAGTGATTACA
AGCAGCAGTGTTGTATGAGGCTAAGAGGAAGTCTCGAAGAGAGGGACTAACCTTGATAAA
TGGATGTGGTCAGTCAAAATCTGTGGGCTACACAGGATGTTGTGTGACAAGTGGAATGAA
CATGGGATCACATGATCCCATTTTTGTAAAACAGTGACCCCCACCTTCTGTCCCCCCTCC
ATAGTACTCTTGTGTCTATACTTAGAAAGCCCTAAGTGCCATTATTTGGACATAGTAAGC
TCTGTATAACTGTTAGCATTTATTGCTGATAACATTCTCATTGTTTTATGAATATGAGGA
AAAATATGAAAGGACAAATTTGGTTGTAAAAAATAAAAAGGTTTCTGGATGGGATGAAAT
AGAAAGGGGGCTGACGTGGGGAGAGACGTGGCAGGGTTAAAGAAAAATTAAAAAGAGGGA
GAAATAGAAGACTTCACTTTAAAAATTGTGTTTTTATATTTGTAAAAGTTATGTACATAT
ATAAAGCTATATGTACATGTACGCACATACGTATGTACTACTTTTTAGAGCGAAAAGAGA
AGATGTGTGAGAATCAGGCAGATCTCGTTCAGACTGCAGTTCTAACTCATTAACTGCATG
GTGCTGGGTTAGTTATTTTTCCTTCTCATCGTTTGTAAAACCTGCGTCATCGTCCCTGCC
ACGAGAGGTTGTCAGGACAAAATGAGGTGACACGCGTGTCAAGTACTTATCATAGCTCCT
GGCCCATAGCTCATTCTCATAAGTTAATTTCCTTCACACACTTCTTCAACTTCCTACTCT
TATGAATTTTTGCAAATTGTTTATACTAATACATTTAAGCTGATAGTCAACCTTTTGTTT
GAGAGCTTTTTATCACTGAAGGTACTACGGATTATAAGCAATCAAAGCCTCTCACAGACA
CCAGTATTCACAGATGTGGCACCATGCCATTAAACTTGTCATTATCCCAGACTTATCTGT
GTACAAATTTGTAAATTTTAAGAGGTTTCCACTCAAAGTAGATATGCTGGTTCATAGGCA
TCTTAAAAGTCACTTATGTTGATTTAAGTGTTTTTGTTTAAAATCTGTTTCTCATGATTT
GTTAGTGACTTAAAATTTGGAGTTTGATAGTTTTACATACTTCTTCCCTACTGCCAAGTC
TGCAGTGCCTTGGTGTGGCCAAGGTGAGGGCAGGGTTCACAGCTCCAGATCCTCCCTCTC
TCCTCCAGTCTCCTCCTACAGCTGAGTGGCCCCTCACCAATCTATAGGGAATCCATGCTA
GTGTGGTAGTGTCCTTACTGGTGATATGCTCCTAATAGAGGCTCGAACTGAAGGCAGTGC
CTAACCCAAAGAAGACATGGAAGTGGCGGAATTTAGATGTCTGACAGATGTTAAAGAATC
TCTTAGGTAGACACAGTACCTTGTTCTGCCCCTCATGTTACGTGACATAACAAGTAACCA
CTTATTTCCCAACCCAAAAGACGGAATCACTCATATACACACATGTGCTCTCTAGAAAAG
TACAAGATTTTCTTTATGTGAAATACTCTTTTAGACTGAAAGAGATTTAAATTTGATTTC
AGTCTCTGCTCCTGAGTGTTTGGCTTTCTAAGGAAAAAGATATTTTGGACAAACCGCAGT
CTGTCTGCTGTCTTCATACGATGCTGTCCCTCCTGAGCAAGATGAAAGGTAACGTGCCCG
GGGATGCCGGGTCGTGGTTCCGAGTTCTCAGGAATGTGGGCTGCTGCTCTCAGAAGCAAA
GCTTAGAGTTTGAAACACCACAGAAGCGGGGAGGAAAGATCATTTCTCCTAACAGAAGGA
GATGACAATGCACAAAACATTTCACTAGAGAGATTCTTTATTAATAGAAAGCTCTTAATG
CATTCAAAGTACTTTATGAAAATTAAATTTATACTATGTCATCATCATTGTGTCAAAAAT
GTGATGTGAGCCATGAATGCCTTTTCTTAAGTCAGTGAGGTAAATCGAATGGGCTTTGGT
GGAGATAGTCCTTTTCTTATTATTTTTGGCATGATTAGAACACTAACCTATCATATGAAA
ACGTCCAGTAGTATTCAGCAGTGATGAAAATATTCCAAACAGGGATTTAACGTTGATTCA
GGAGCAAGACGACTAGCACAGCACAAATAATGGAGTATACATGTTCTGAATAAAATAGAT
TGCAGATTGATCTCCCAGGTCATTCAGAAGTGCACACACATCTATGGGGAGTATTGTTTT
AACCTTAGTTTAGTGTGAAAGATTGGACAAAAAACAAATTGACGAACGAAGAGTTTCTTT
TTTAACTTCTCCCCTTTGCCTCTAGTGGCCATCGATGAGACCTGGGATTCCCAGTCTGTG
TCCCCTTGGTGGCAGCAGATGCGCACAGCCTGTATCCAGTCTGAGAACAACGGAGCTGCT
CTGTTATCCGCGCATGTTGGGCATTCTGTGGCCGCACAGATATCCAACAACATGACGGAG
AAAAAGGTAAGTGGGCAAGGGGGCAGCTTTGATCTGGATCTTTCCAGGTGGCTAAGGGAC
TGCTGCTCCGTTTCTGGGGCTACATTGCCTGTAGTGTTGTGGAGCATCTAGAATTTGACG
TGTGTGTCCATCAGGTTCTTGTTTGTCTTTCTCGGGGGGAAGGGTGCTGCCCTTAATTTG
CTTACTCAGACAACATGCTACTTGAATTTAGCCACAGGGCCTAAGAGGAAAACTGGAGTT
GGAGTACAGAGATCTGGCTCTCTGCCAATAGCTGCTGATTTGCGGTGAGCCCCTTCAAAT
GAGTCTGTTTCCTCATGCAAAATTGAGCAGGGTTAGACTGCATTATTTCTCACGTTTTTT
CTGGCTCTAAAGTTCTACCATTATATTTATAACTTCCTTTTATAAGCATAGATTGTTTTT
GGCATGTGGCATTGAATAACTCAAATGAAAGTTTCCCATTGACCTTTTGTTCTGTGGTTT
TTCATCTCTTGAAGACACAAGTTTATTTAAAAAAAAAAACAAAAAGACTAACATCCCTTA
TATCTTCTGGTAGATCACATCGTTTTTACCAGGGAGCTATTGCATTAAAGTGGAGGAGAC
GCTTAAATGGGTCTATAGAGATTCACTCAGCGTTGTCAGTCTCAGTTTGCAGGCTAAATT
TAATATCACTAGCTTAAGATGTTTATAGTAATGGAGAGAGAAGAAATTTGAGACACATAT
TTTATGTTAGCCAGTGCATTCTGAAAAAATAGCCGTATCTTGGTCCAGATAGAAAAAGCT
GTAGCTATCGTCAAGGATGGCCCTGAAAACTTTTGGAGCCTTGAACGTTGGTTGAATCAG
GTGTATTACTGCAGGTCCTTTGTAAATGTCCAGACTCCATCATCGTTGCCCCTAAATCTC
CAGTCTACTCCTGACTCCTATGTTTCACCCAGCCAAGTAGTAATAATTGTGAAACAGCAT
CTGTTTGTCGCTTTGTGATATGTCCTGACTGTCCGTCAGTGTTTGAGTTAAAAGCTCATT
CTAGTTAATGTTGATTCAGAATCTCTGCCAGAGTCATCACCGGTGCCTTCTCTGTTAGTT
TTCCCAGACAGTTTTGGGTGCGGATTCGGAGGCCCTCACGGATTCCTGGGAGGCTCTTTC
TCTCGACACTGAGTACTGGAAACTCCTGCTGAAACAACTGGAGGATTGTCTCATACTTCA
GACGCTGCTTCACAGCAAAGCAAACATGCAGACCGCCAATGTGTCCTCACTGCAGACTGA
GCCACTCCCGAGGCTTTCTGTTAAAAAGCTTTTAGAAGGAGGCAAAGGTAACCTGAAGTT
TATTTGAGCATTTGTATCTGTATGTCTATATTTATATAATATAGGCTTTTTTTTTTAGTA
GAAATGACTGAAAGAATAAGGAAAGAGACATACACTCAGATTTTTAAAATGAGTAAATAA
CCAACCACGTACTTCTTCTCAGTTACTCTTCTTAAAGTATGATCCTATCCGTTCCCTGCT
CAGGAGCTCCCAGCAACTTCCCCCGCCTTGCAGAGTCAGCAACCCTTCTCAGAGAATGGT
CAGAGCACCTCCAGAGCCCTCCCTTTCCAGCCTCCTGTCTGTCTGAGGCCAGACTTCCCT
CTGGTATTTCAACCCAAGCAGCAGATCACAGGAGATGGGATGCGGAAGCTGATCGGAGAA
TCCAGACATAGGCTGGACGTTCAAGAGAGCTGCAGAAGTGTAGTGCCACTCTTCTCACTA
AATATCGTTTTTTTGCTTTGGGAAATATAATTATTTTCATAAAATATTAACATGTAATGG
GCTCATTTTTATTTTAAAATGAGATAATATTTTTTACATTTCTCAGTTTTAATTTCTAAT
ACTATAAATATTGGTAAATGTAACTCACAAGCTCCAGTTCTTTGGGGTCGTCAATAATTC
TTGAGTTTAAGAGACTAAGAAGTTCGAAGACTGCTAGAACAAAGTGTGAACTCTTAAGCC
TGCTCTCCAAGAACTTTTGACTTTGAATCCAACCCATTTTTCCGTTTCTTGCTTGCTTGT
TGCTAGATTTAGAGTTCAGATGAAGCATCTGTGTGATTCCCCATCTCTGGATCTGAGCCC
GTCGTCTTCCCTTTCCCCGCCTCTCCCACGCATGGATTCTCAGTTTTACTCATCTTTCAA
GGCCCAGCGGAAATGCTGCCTCCTCCAGGAAACCTCTCATGATCCACTCACTGCAGATTT
TCTCTTCTTCCTCCTCATTCCACAGAACTTTATACCTCCTTTCTGATGCGTCACTTTTTC
CTGTCCTGGAGTCATGGGGTTCCTGTGCTTAGATCTTGCAGGACCATAAGCATCTTAAAT
CTTGAATCATCTTGGCATACTCCCTCTTCTTCCCAGCAGTCCTGTGGGGCATTTGATACT
GGAATGAGTGTATTTCTGGGTTTATAAATACCCAGGAATTTATCGATTTTTGTTTGGTTA
GCTCATTTTCTCATTATTTATCATACTTGTGAAAATTTTTAACTGTAAATTCACTGCACT
CTGTGCTGCCACCTGGTGAAACTGTAGGAACAGCATTTTAATACTAACCTAAGCAATGGG
GGCTTGCTTCCAGAGTAAGAGTAATCAGATGATTTAGAAGCCAAACATAAGAAACTAGAT
CGCCCAGCACACTGCTCTCCTGTATTTTCACTGATGATTGTGATTTTACTGTGAAGCCTT
CTCTTTGTGGAAAGGTTTTTATTTGAATCCAAACAAGAGGAAAAGTTTTGGTAAATTATA
GAAGAATGTGTAGTTTGTTTTAGGTAGTAAATGAGACTCTTCATCTTGAATGTTTTCTGT
TTGCATTTATACATTTTTGGACTGTATTGGTCACTGAAACATGGTATAGCATCCTCTTGT
TGATTAGCTTTGCCATGGCTGAATTTTGGCCATAAATATCCTATAGAGGCAAATTAGTTG
ACTATTGAAAGTAATATTGCCCTAAGAAGCCTAGATAAATATCATGCTAATCAGTCTGTT
CTCACTGATGTTTAAATGAGAGTGTTTAAAGATGTACTCGCCCCTTCATCTTTGTTAGGT
AAAGTATATTTTGAATTTGTGGGCCTAGAAGGTCTGTGGTACATAGACGTCTGTATGCAT
ACTCATTGATAGTTATCTAACATTCTACCAGAGTGGAAAGGTATCAGATGGCGCACTTGC
CCTCGCCAGCTGAGTGGTATGTGATAATGCTACTGTGAGTCTTGTGGCTTTGGGGCATCA
CTTCCAGGCTTAAAACTGAACGTGGCACTTCAGTCTGCTCACAAGGAGATGCGGATCGTT
CACTGTATTGGCTCCCTTTGGCAAGCCCTGTAAATGTTCATTTTCTTTCTTGTCTCCAAA
CTATAGGTGGCATTGCAGACACTGTAGCCAAGTGGATATTTAAACAGGACTTCAGCCCTG
AAATATTAAAACTGGCTAATAAAGAAAGAGATACAGAAAACCCAGATGAGCCTAAAGAAG
GTATTAAAAGAGGTTTATTTGAGATGTCAGAGGTAGAGATGGACCTGGGAGCCATTCCAG
GTAATACATAACTACAGAGAAACGTGAAATCCGGAGTGGACATTTGGCTGTTTTCAGTAA
GGAAAGACTACAACCTCACTCTCTTCTGACTTGCAGACTTGCTGTGTTTAGCCTACAAGC
AGTTTCCATGCAGCCTGGAGCTAGACGTGCTGCACGCACATTGCTGTTGGGAGTATGTTG
TTCAGTGGAATAAAGACCCAGAGGTGAGGTTCTCGTTACCTCTTTCGTGTTAATTCTGTG
TCTGTGCTCATGCTATACATACATAAGACAGTTTAATGCAATGACTTGTTATAAACACCG
GGTTGTTCCCCTGTGGGATGTCCGGATACTAGGAGCTGTGCTAGGGCCTCTCCAAGTGCC
TTCCCTAAGGACTCGGCTGCGTCAGCAGCTGGGCCGGGATTTCAGCCTAGGTTTCTCTGT
GTATAACACAGTGTGTTTTGCCCTCCTCCTAGTTAGATGGTAAGAAGTGTATTTTTTATT
TCCTTTTGAGTTCCTGTATGAGACAGCGCCGACCGTCAGAAAATTCCTCATATTCTAGTC
TTCATGATAAAAGCCTGAGGAAAGATCTGACGCCAACCCATGTCTGATTGTTAAGACAGG
CCTGTATGGGTTCGTCACTTCTCTTACATTTGTCTCCGAAGAAGAATCAAGAAAGCCGTA
TTGCCTGCAGGGCTGACTCTAGTCCAGGGTTAGCGTTGCTGCCCTCTCGCCTCTGCATGG
GCATCGTTTTCTTCCTCTTTTGGTAACCACACTTTCTCCCAGGGCACTCACAGTCAGGAA
GCAGTGCAGGGAGAAGGCCCAGGCTGGGAGCAGGGGACCTGGATTTGGGTCCCAGACGAA
TTTCTGAACAAAAGTGTGGGTTTGGGCCAGTCACTGAATCTCTGAACCTGCTTTTTTCTC
TCTCTACCGGGTTGGTGTTTTTGTTTTTGTTTTTGTTTTTTGCTAAGGAAGATTAGCCCT
GAGCTAACATCTATGCCAGTCTTGCTCTATTTTGTATGTGGGTTGCCACTGCCACCATGG
CTGACAAGTGATGTAGGTCTGCGCTGGGGATCCAAACCTGTGAACCCAGGCTATGGAAGC
AGAGTGTGCCAAACTTAGCCACTAGTCGAGGAGGCCAGCTCCCTCCACCACTTTTTTTTT
TTTTTTAAGATTTTATTTTTTTCCTTTTTCTCCCCAAAGCCCCCCAGTACATAGTTGTAT
ATTCCTCATTGTGGGTCCTTCTGGGACGCCGCCTCAGCATGGTTTGACGAGCAGTGCCAT
GTCCGCGCCCAGGATTCGAACCAACGAAACACTGGGCTGCCTGCAGCGGAGTGCGAGAAT
TTAACCACTCCGCCACGGGGCCAGCCCCACCCCCACCGCTTTTTAATGATGAAGGTGCCA
GCCCTTCAAGATTGATGGCAGGATCACCTAAGATGTAAAAACATGATGGCAAAACAAACT
CTTTGCCAGTAAGTCCTTCACGTCGGCCTCCCTAGTCAGTGCCCTGGGAGATCGTCCCTC
TCAAATCAAAATTCTTCCCTTTATTGTCCTTAGATTATCAGGTTGCACGCTTGAAGAATA
ATCTCACTGGTGAACTAATTCATCCTCATAGATTAACGGTAACAATACTTTTCCTTCCTC
CAAAAAAAAAAAAAGTAATTATTCACATATTAAAGGAAGACAGTAACAGTAAGTGACTTT
AGGACGGGGAACCCTCTTCAGTTGACTTCCCTCCAGCCTCAGTGGTAGTCGTAATTCGGC
TCTCTACTTAAAGAGAGCCTACTTATTTCTCCTACATGAAAGACCTCTATGTATTCTTCC
TACATGAAAAAAGAATGTTAGGACTTGAACAAGGACATAATAATTTCTAAAATCTGAGTA
AATGAATTCCAGATTCAGGTCTAAGAAAGTGATATTTAAGGAAAAAACTCTTATTTTACA
GCATTCATTTGTAAACCAAAGGCTGTTTGCATTGTGGACACAGACAGAGCTGAGCTCAAG
CTCCTTGCCACTGCTTATTAGCTGTGTGACCTTTAGCAGCGTTTCTGATCCCTCTGCTCT
CAATTTTCTCCTTAAAGTAAATGAGGGATATATAGCACTAGCTATTTCGAAGGATGCATG
CATAGTATCTGGAATTTTAATTAGTGTTATCATCATCTATTATTAGGATTGTTTACATTT
AGAATAAGTGGCCATTTTTCTTGTTTGTTATTTTTTCCTGTTAAATATTTATCTCCTTGC
CTCACCCAACCCCTGTCCCAATCCCGCCATTTTACTCACACAGCTTATTATGCTCAAACC
AACTGAAGTTGCCTTTGGGGAGTTTCCAACACCAGTATATGTTGGCACAGGGGATGCGTT
TAATCTTTGTACAGGCCACAAAGTTATTTAGCCAAGACCTGGATAATTTGATCAGTTTTA
CATACTGTATTTGAATTTTAATATGTCAACCACCTTGATCAGGAAGAGTTGAAATTCAAA
CATCCCTCTGGTATTTCATATTTCCTTTCACTGCTTTCTCCTTGGCACTTACACTAACAT
AGCACACAGTTTACTTACATATTTATTCTCTAGCTCCCTCACTAGAATGTAACCTTGGTG
AGGGCAAGGGTTGGGTCTGTTTTGTTCATCACGGTATCCCGGGTACCTCGTGCATGGTAG
ATGCTTAATAAATATTTGTTGAGGAATGAATGAATGAATGATATTTGCAAAGAAGTTAAC
CGATTATTGTCAAATCTGTGTGAATTCAAGTATTTTTTGGAGAGAACACTACTGTGTTGT
ACAAACCACAGTAAATTGTGAATCCAGATGTCAGCATATATGACCTGGGGGTTTCTAGGA
ATCAATCACTGTATAGATAATGTGAATTTAAGACAGACAATTGACGTTATCTTATAAAAA
ATTACTTTTTCCTAATAATTCCATGTTCTTATCACAGCATTCTTGGGTAGCTTTATACAG
ACATTTATGTGAGAATTCTCCGTTTGTATGTGAAACGCCTATTAAATGATACGCTTTTTT
TTCTTTCTTTCTTTTTTTCTCCCTGTATGTAAGGAAGCACGTTTTTTTGTTAGGTCAGTA
GAACACCTGAAGCACATTCTCAATGCGCATGTTCAGAATGGTGAGTAAACAGGTGTTACA
AACAGGACTGCTTGATTCAAGAGAGGCACGGATCTTTAAATTCACCTCCTGTTAATTTTT
TCATTTGGTCCCGCCACCCGCCACATGACTGTGTATTGCCATATGCAAGGTGCTGGCTGT
TTCAACGGTTTGGAGGAACGCTCTCCAGAAGGGGGCGGGGGGCAGTAATGATCACCTCCG
TCCCCACCCATCAGTTTCCCAAGCTGACAAGTGTTCCTAGGTGTGAGTCAGGAGAATATT
CTGCACGAATCAGTGATTCCACGTTTAGTTCACAGGTAGATAAGGAAAGAGGGATGGGCT
GCTTAGGACTACAATTCCTGATGAAAAAGTCCAGGAGCCGGAACCTGATAATACTGTACC
CCGGAAACTGCCTTGTGCTTCTTGTAGTAAATGTGCATCTTCTCCATTGGCTGCCATCCC
ATGGGGACTGCCGGTGTCTCCTTGCAAGAATGTTACAAATTGTTGTTGAAAAATTGTAAA
CAGGTTGTTGGTTCCATTTAATAGATCGATGGGTTCCCCTTCAGGAATTAGTTGAGGAGC
TCAGCACCTCAACTTAGTAAGACGACTAAGTGGTGAGACTAGGTGTTGGGCCGGGTAGGA
GGGGGATCGCCTTGATGTCTGTGTGGTGAATTCTTCGCCTGCACCACCTTCCTGCAGGTG
GAATAAAGTCAGATTGCAGGAGTTCTAAAATGTTTCATTTTACTTGAAGGGAACTTGAAA
ATTATTTTATTTATTCGTCTCTTAGATTTTACCTTCTTCAAAGAAAAAAAAACATTTAAA
GTGGTTCATTTGTAAAATATGGTCTCTAGAGTGTCCTGTCCTTATTGTTAAAATTAAATT
ACCTTCTGACTTCAGGCTAGGATTTCTTCCAGTTAGAGCTGTAGCCATTTGTACATTGAG
GAAGCATCCTGGCTTCTTCACAGCCTTTGAAGCCTGTGTCACTCCTAGACACGGAAGCAG
CTATGTGGTAATAATAATTACTACATATGAAAAAGATGTTTCACATGAAAAAAATCATTT
GGTGGACATCGGGTTGTTTCTAGTGTTGGCCTACAATGACTGAAGCTGCTCTCAGTGCTG
TTGAACACACCTTTTTATCCATTTCTGCAGAACTGCTGGGTCACAGGGTACACACATATT
TAGCTCTAGTAGACACAGCCACACCGTTTTCCGAGTAGTCTTATCAATTTATTATCCCAC
CAGCAATGTATGAGCATTCCAGTTGTTTCTCTGTCATTGCCAACACTTGGTATTTTCATT
AAAAAAAGAAAGTTAGCCTTTCTGTTGGTTGTGTAATGATATCTCTTTGTGATTTTAACT
TATATTTCTCTCAAAACTGATGATTTTGAAAAAATATCAGTCTTTTCTTGTGCTTATTGG
CCATTTGAATATCCTCTTATGCAGCCCAGTTCTGATACTTATTAAAGATAAAGGTTTTTA
ATTAATTTTATAAATATTACATAAGATATAAGAAATGATATCTAAATAACTAGCCCATGT
AGTTTTATAAGCTTAAGGAAGACAGTAATTTATGTCTGATGAAAGTGGAAGTACACACAC
ATTCTACTTACTGCTTTGCCTTGACTTGCTCATAGGCATTGCGCTGATGATGTGGAACAC
ATTCTTGGTTAAAAGGTTTTCAGCTGCTACGTACTTGATGGATAAGGTAAGGCAATTTTA
AATTCCATGTACTGACTTCTTGTTTATTTGGTTCTCTTAAATAATTGACTGATGTTAGAA
AGATTGTTTACATTGGGCCTTGTTAGACCATTTTTCGTTTGATGTTTCGTTTTACTCGTG
CTCGATTAAATGTAATTTCCAGTGCTGGCATTTGGATGACTTGAAGAAGAGCCCCAATCC
TCGAAAGAGAGTAATATACTGTAAAAGCCTCGAAACCCAAGAGGTTAGGACTGGAGGTTG
ATTCAAGCAAGGACTTGCATTTTATTTTAAGTTAAAACATACAGTGTGCACTTACTCACC
AATCTTTGGACATAAGGCCAAGACGTTTTCTTTGAATGGGTTTGACGGCAGTTCTGTTTT
GATTTTCTGACATCAACCTCACCCATAATGCACTGCCTGTGATTTCTATATCCTGTTTCT
TTGAAGTCGTGATGAATCTGTGGGTAAAATCTTTAGATTTTTATAATTCATCCCCTAATC
TTTGTAGTTGTTTCCTCTCTATCTAATCCAGTAGACTTAGCGGTTAGCCACTCTTCTCCA
TAAATCTTTTTAAAGCATTCAACATAAAATTCATATGAACAGCTCCTTTTTTTTCATTTG
TATTTCATCAGGTATTAAATTAAATTACATAATTACAATGACAGGTGCAAGCAGCATAAG
TAGAATAAGTAGATTTGGAAACAAACAAGTAAGCACAGGACTCGGCTGGTGGGAGTGGGA
GCTGCTCCTAGTGAGAGTAGCCTGCTGGCCTCAAGCAGTGCGGCTGGGGCCTTGTCACGA
TGTTCTGCAGGCCAGTCGGGAATGTAGGTTAATCTGGCATCAGTTTGGTGGATGTCAGGA
GAACTGCCACCATAGCGACAGCACGTTCTTTTAAATGCACAGAGATGGACATTCCTAAAC
CATGACCAGCACTACAGCTCAGAGCCACTTTAGGCCACTGCTCCTCTGAAATGCTTTCTT
TAACGTTAAGGGTAACATTTCTTTCTAGTTAAATCTAACTGTTCTTTCCTGTGTGCTTGT
CTTCCTTGTCCACTTAACTGCTTCTTTCTTGAAACTCATCCTTCTGGCCTCTATGATGTC
GTTCCCTTCTGCTTCCCCTCCGACCGCCCGTCTTTTGCGAGAATAACGCAGAGCCTTTAT
GGATGTGTTACTGTTTACAGTTTTACAGTGTTCTCACATCATGGTCACATGATCCTCGCA
ACTGGGATTTGGGTTTGAACAGGCCTGAACTAGGAAGCAGAGGGTTTATGATCGTTCGTT
CACTCAGTGTTTATTATAATAAGCATTCCTTATGTGCCAAGGACTGTGCCAGGTTCTGTG
GTTGCAGAGATAACAGGCACGGTCCTGCCCTCAGAGAACGCACAGTCTAAAAGCCGATAG
GGACGAGAAGTGCGTGTGAACCAGTGAAAAGGGCTGAGCAGAAGCGCCCTCCGCAGAAAG
TCCTGGAGATGTGAGGCAGGGTGTTGGACTCAGAGAGCTGCTAGAAGCTTCGTACTGCTG
GAGCACAGGCTGTGGGAAGGAGCAGGAAGAGTTTCCTGTGGAGGCTGCATGTTTGGGGTT
TTCTACTAACTTTTGGATTTTCTAATTATTTTCTAATCCTATGTGTAAACTGCCTAGCAC
ATATGCTTGGCCTGGCACTTATGGTGAGGGCTCAGTAAATGGCAGCTGTTAGTTTATCTT
GAAGACAGTGGAGCAGTTTTAAGCAGAGGAATATGTCCAGATTTGCATTTTAAAAAATGA
TTCTGGCAAGAGGGTGTAATATGTTGGAATTGGGATGGGCCGAGCTTGGGTGTTGGAAGG
CGGGTGCAGTCATCTCAGCAGGGGCTAATGAGGTGAGGAGTCCTTTGTACTGGACTCCCT
TCCTCCACTGTCACTGTCCCCTGTGAGTTCTTGTCTTAACAAGTCACATTGCTGAAGGGC
AGAACTTTTATCTCCCACTTATTACCTTATATAAACTTGACAGTAGACTCTTATTAAGTA
CTGATTGAATCAAGGAAATCAATTGATTTTCTGAGCTAGGAATATGTCTTATGTCTGCTT
TAGATTGTCTTTTTTTCGTTCTGACCTTTTAAAATTGTGGATCTTTATCAACAAGCAAAA
TTCTTAGCTGCTGTTTATTTAGAACCTTGAGTTTGGTTCTGAGTTTTAAGGCAAAACAGT
TCTTTGATTATACAAAGTAAGGACCAGATTTTTAAAGTTGTTCATATTTAATAGTTTGAG
AATATTTATTTTTGAAAAGGATTATTTGTAAGTCCAGTGTGGCGTATTTTTCATAATATA
TTTTTAGGTTCCCCCATAGAATTAGTTGCGTTGTGTTATAAATGAGTAGAACTAAAATTT
AATGGATGAAAGGTTGCCACGGTTTTATAGCTGCATTTATGTTTTTAAAATTTGGTTACT
TTTTACTATTTGTACCATAGTAATGCCTTTTTATATAAATTACTAAATAAATACAGCGTT
TTCTGTCCTTTGTCTTAGGTTGGAAAATCACCAAAGGATAGATTATGCCGAAGGGTAAGT
GCATTCCCTGAACTAGATGTCTAGTAGTTAATCCTGCACTTTATGTGGTATCTTATTAAC
TGGAGGAGTGAACTTTGCCTTGTACCATTTTGATGACACATCAGGAGATAAGAAAAATGG
AAAGAGAATACTATATTAAGGAAACTGGTCATGAACTATGGCCAATGTTAATTTACCTTT
CCAGATTGTCAGATAGAATGTTTAAGTTTTCTCAAGCCGTCTTCAACTTTGGACAGAGGA
CAGGAGGTGAGCATGCTGCCCTGGCTGCACATGTTTGCTGTACTTTGGATTAGGGATTTA
TAGTGGAAGCATCCAACATCAAATTGAAGTAGATTCATATGAGTAGTGAGTTTAATCTAC
TTAAATGTAATAACCATTGTACAAATAGTCTTAAATAATATTCCGGTCCATGGATACGGG
GGCTTGTATTTGAGGCCAGTGATTAATAGTGCCAGCTTTTGCTCAAAACTTTGAAATATT
CTTATTACAAATATCTTAAGAAATACTGGGACACACGAATCCAGCCATTATAGGCCTTTA
GTTCCCAAAAATCACCTTTGTTGAAGAATTCTTCTGTTACAGTCTTAAGAATGGCTCTAT
GACCAGTTATACGCACACTCTGAATTGTTTACTTCAGGGATTGTATTGGTTGTTAGTTTG
AAAAAGACTATGTGAATGCAGTAGTCTCTTGGCAGGCCCTAAAGGGAGTCAACAGGAACG
ACATGTTGCCCACAGCGTTAGTCTGGTATTTCGTTCACAGGCTTGAGGGTTCTAGTTTTG
TTCAGAGGGTTCAGTTAAGTCCCTAAAAGACGCTCTGAAGCTAGACCAGTTTTCTGAGAA
CTTTTTTGGTTGGCCTCTCGCGTGTGTGTATCTTCATGCACACGCCTGGCCTCAGCAAGC
TGGACAGTGAGCGCCAGTGCCGCCCTCTGTGGTAACTGATGGCACCGTGTCTTTACAATA
CACAGAGAACACCGATTTTTGAAACTTCATAGTAGTACAATCCTTTTTAAAGTCTAATTT
TAAAATCTGTTAAGTCTAAAGAAAGGAATTAAAATGTACTAATGCCTTGACTTTCAAATT
CTAGCTGTCTATTCTTTGTGGGAAGTCAGTTGAATAGATGTGTCCTGTTCTGTTCTTTAT
TTTTCTGAGAGTAACTGTAGCAGTTTTGCTGGCAGGAGCTAATTATGTTCCTTTTTAAAA
CCAGGATGTGGGGATGAGTGACACAGCGGTGACATCTTTCCTTGGCTGCTGCTTGGATCT
TCTTCAGACTTTAATGGAGGTAAAAGAAATATATTTTCATTCTGAACTGTCTCTAGAAAT
TAAATATTCTGAAAATCATTGGACTTAAGAAAGGACTATAGAAAGAGATTGCTTTTCATT
GATTCATTTCTAAGTTTTGAGTTAAGCCTAAAAAATAGCGATGTTTCTTATTAGATTCTT
ATTGGAATTAGATTTTACCTTTTTTATTATAATTTGGGATGGGAAGAAATATGGGTTTGC
ACTTTGCTGCTGGTAGACTCATTAAGATATTTGCAAGCTATTCTTTCTCTAATTCTGAAC
ACAGTTTTCTGTTCTCAAAACCTGTAGGCAGATGTTAGCAGGGATGAAATGCAAGCGCCT
GTCCTGGATACTGAGGATGCGTGGCTCGCTGTCGAAGGACCAATCTCAATAGTGGAACTG
GCCCTTGAACAGAAACACATCCACTACCCACTGGTGGAGCACCATTCCATCCTCTGCTCC
ATCTTGTACGCGGTTATGAGGTTCTCTCTGAAGACTGTGAAGCCGCTTTCCCTTTTTGAC
AGTAAGGTAGGTACCTCCAAGGATTCAGAGCCGTGGTGGAGCTGAGGGTTTGCAGGCACA
GCAGCACTGTCTTTCTTAATGGAAGTTGTTCAGTAGTTTTGTGACTTACGGAGGATTATT
CGTCGTGGGGTTCTTTGCTCCCTGTTCCCCCTCAGATTCCCTGTTCTTCTGATTTACCTT
AAATATTGGTATTCCATGGGTTTGTCCTCTCAGCTGCCCACCCTTCTCATTCTGCATGTT
CTCCTGGACAGACTCATTTTCTCCCTCTCGTATCTCCAGGCCTGACCTCTCCCAAGTTTG
AGGCATATATTTCTGTAGAACATCTTTGGACGTGTCGTGGGACTTCAGACACCTCATGCC
TAAGCTCTGTCCCCATATTGACCCCTGTCCTACCCTTGACCTCAGTTTGCTGTTCCTCCT
GAATGATGGCTAGCTGGTTGATGAATGATGCCATCACATGTGCACTGGCACCAATTAGGA
CCCTTGATGTTATCTAGCTCAGTTCCCTTCTTCATGTCCCCCTTTCATTGTAAATTCATT
CTTGTAAGTTCTTCCTTGAATCTTATCCGTCCGTTCCTCTCCATCACGGTAACCCTAGTT
CAGGCCTCATTGTCTTTCCCTTGGCTATTGCAACGGCCTCCTGTTTCTCTCCATCCAATG
CCATGCTGCCAGAGTTTTCTTTCCAAAACACAGACTTAATCGTATTAGTTCCATGCCAAT
TCATAAAACCCATTTCTTTCCCACTCAGGTGCCAAATGAGAGACAGACGTAGGATTCAGA
CAGAGATTAAAATTAAAATTCAGACAGTTGGTCAGCTGTATTACTGAGCTTTTTACTGAC
AGAAGCCAGGTGGGAGAACACAGCTCTTACCCTTATGTGAGAGACTTGCACAGCCAGGGC
ACAGCGGGACACCTGAAGGGTCCTGGCCCTGGAGAAGGAAAGCAGGTGCTGTTGAGAATG
CCCAGCTCCTCCCAAATTCCCCAGTCCATTTTGGGGAGCAGTGAGGGAGGGGTGGGGCGG
GATGCTCTTCTCACAGAAGCCCTGCCGCACGGAAACCTGGAGCCAGAGGAGGGAGGCTCC
CCTCAGCCGTAACTACCTTTCCTGCCTGCCTTCCGTTCCTCTCCACCCTGTGCTGCAGCC
ACTGTTAGCTACCGTCCCTCCCTCGGCAAAGGCGGTCATTTGCATCATTTCGTGTCTTGT
TTATATTGTTCCATTTTCACAGACAACTACTTTCTATGTCCAACTCCTATTTATTTATCA
CTTAAGTGTCACCTTCTCTTCGAAATCTTTGTCTACATTACCTGAACTCGTCACCTCTTC
ACTATGTTCCCGTGTCTGGTGCCATGCCTGGCACATAGAACAGGAGCCCAATCCGTGAGT
GATGCAGTTATAATGAAGATGCTAAAGAAAAGTTGCATGGCCACAGTATGCGGAAGAGAT
GAGTGGATATAAGTGAGGAGGGTTTTGGAGACCATTGCAAGTCAGGAGTTGATGAGGATA
TGGACTGGGGAGAAGCGATTAAAATCATAGAGGGATTGGGAGGAATCAGGGACCTAATGA
CAGTCTGGGTTTAGTGCTGGAGGAGATGGGAGCGGGTAAAATTCAATTCAACTCAAGCTG
GCGAGACTGGGCAGGCCATTTACAAGGAAGCCCATTCAGAATGATTTTAGACATGTTGAT
TTTGAGAGTAAATAGAAGCAGAATACTGTATGTTTCAAGAAATTCATGTTAACATTTAGA
TCCCGACGGTTTAAAGGCAGACTAGAAGTCTGGTGACAAATTTTCATCTTCCTAATAAAA
TAACAGATAATATTTATATTTGTAAATACAGATTTTGAATGAATTATATCTTTCGTTTGA
GATTGTAAAAGGAGAGTACTTAAAAGTTAGGTTGTTTTTTTTTTAAGAAAAACCAAAATA
AACTACCTAGTTCAGTACTCCCCTCGAAAAGGGAGTTTGTGAAACCAGAACATGTCCAGA
CTTGGATAAGCACAGCAAGGATGTTAGTCCCAACCCATGTCATGCTGGCATGACCTGAGA
CAGTCATGTGCCTCTCTTATGTAAATAGAGACGCAGTGCCGTTTGGCTAGTGAAACAGAA
TCCCAGCTCTGCCGGTGGTGTTTAGTTTAGTTTCTCTCAGCCTTTCTCATTCAGAAGTCA
TGATTCCAGTGCCTTCCTCATGGTAGTTCTGAGCGTTGAATGACATACTCAACATGAAGT
GCTTAGCAAAGCCTGGAACACAGTAAATAATAAATGGTACTATAATAGATGTGCACACAT
ACTCTCCACCTCAGAGGCCCTCATGTAAAATGGGCGCTTATATCTAAGATTACCAGGTGG
AAGCTACAGAGAAATAGATTGTGGGTGAATGCATGGAAAAACTTTCAAATGGTGATGCCC
ACAATTCACTGGGTTGCCCTAGGAAGTCTGCTGTTTCTCATCACTAAAGGATGAGTAGCT
TTACCTAGTTGGCCACTCAGTAGATGACTACCCTCATAGGTGATTAGGTCTAGAAAGTAC
CTTAGAAGATATCTGGGATGATTTGTTTGCAGGTGAAAAAACAGGAGCCGGGATGGTGGG
GTCCTTTGTCCAAGGTAACCTGGTTGGAAGTGGTGGACCTGGGACTAGAACCTGGGTCTT
CCAACTTAGAGGCCAGTGCTCTTTGCTTTGTATTACATTTCCCTCCAAGGAACTTCGGAA
ATCCTATTTCCTGATATTCTGTTTTGGCTATTCATACACACATCTGTTCTCTTAAACAAG
GTGTTTTTAAACAGTTCAACACGTGTTTTTGAGAGGATTCAGAGTACACACTATGTATTA
GCTATCTTTATTGCATAACAAATTATCTCAAAACTTAGTAGCTGAAAACAACTAATATTT
ATCATTTTTGTGGGTCAGGAATCTGGGTTCCTCTTATCTATGTGTCTCTGCTCAAAGTCT
CTCATGAGTCTGCAGTTAGGGTGTTGGCCAAGGCTGTGGTCTCATCTCAAGGCTCAAGTG
GGGTGGGGACAGGGGAATCCACTTCCAAGCTTACGTGATTATTGGCAGGAGTCCGTTCCT
TGCCACCTGCACCTCTCCATAGGGCAGCTCACAGCATGGCAGCTGTCTTCCCTCAGCACG
AGTGAGAGGATGAGTACCTGGAGCAGAAGCCACAGTCCTTCTGTAACTTAAAAGTGACCT
GCTCTCATCTCTGCCTAATTCTGTTTGCTAGCAGTGACTCACCAGCTATGAAATTACACT
CAAGGGACAGAGATTCCACAGGCATGACTGCCAGAGGGCTCACTGGGGACCACCTTACAG
CATGCCTACTACGTACTGGATAGTTGTTATAAATTAAGTGAATAAAATACTTAAATGTTA
TTGTTCAAGGAGAAAAAAAATCAACCATGAGATATTCTTGATTAAATGACTTAGTTTTTT
CCCTTCCCCTCTTCCTTTAATAATAATCCATACTCATCAGTTTTCTTGGTCTCTTCTTTC
TTTTTAGGGGAAAAATGCATTTTTCAAGGATCTAACTTCAATTCAGTTATTACCTAGTGG
GGAAATGGATCCAAATTTTATTTCTGTACGACAACAGGTAAATTAGTTATCGAGTTTTCT
TTCTTGGAAAAATTGTAAAGCAAAAATCTAGCTAACCTTTAAAGGATGACCACTTATAAG
GTGTTCTTGAAAGCTAGTTTCCTTTTAAATTGCGTGTTCTTTTTTCATAATTAAACAATT
TTAATGGAAAGCTACTCTAATTGACAGAAAAGCCAAAAACTGCTTTGAATTAGTTTTAAG
ATTGGCACCAAAGCTAACATCTGTTGCCAATCTTTTTTTTTTTCCTTCTCCTCCCCAAAA
CCCCCCAGTACATAGTTGGATATTCTAGTTGCAGTTCCTTCTAGTTGCGGCATGTGGGAC
ACTGCCTCAGCATGGCCTGATGAGCGGTGCTAGGTCCATGCCCAGGATCCGAACCGGCGA
AACCCTGGGCCACTGAAGTGGAGTGCACAAACCTAACCACTCAGCCACAGGGCCCGCCCC
TGAATTAGATATTTTTTAATAAACATATTAACAAGACGTTGTTGTGTCTCTTCTCCATTT
TCAAGTTCTTGCTGAAAGTTGTTAGTGCAGCTGTCCAGGCTCAACATTCAGTTGCAAAGG
ACAAAGATTCCCCGGAAGAGGCACCGACCGCTCCTTTCGGGAAAGACCAAGATTGGCCGG
TTCTGGCCGTGGATCTGGCCCATCACCTTCAAGTCAGTGAGGATGTCGTTAGAAGGCATT
ATGTGGGGGAACTCTACAACCACGGAGTGGACCACCTAGGAGAAGAGGTAATCATCACCC
CAGGAGTGTCACTGGGCGCGAGGGATGAAATTGATAGCGAGAGTGAAAAATCAGTCAAGT
CTCCAGTACAGCTTGTTGCTTTTCCTTTGAATCTCTATGCACAAAAATAGAACAACAGAA
TATTAAAATATAAAACTAGAGTCAAATTCCTGTTTCTGGTCAATGTTTATAGTAAACTCT
GCAGGGTGCCAGGCCTATTCTGTGCACGGGGTCAGAGCAGTCAACAAAACAGATATGGTT
CCTTCCTCACGGACCTGATAGTCTGCTGGTGGGGCAGAAAAGTCTGCTGTTTTCTACTGA
GTGATAAATACTGTGAAGAAAATGAACAGGATTGTGTGAATAAACAGGAGCTTTTACAAC
AGGGTGTCAGAGGTGAGCCCCAAGGAAAAGCCAGCAGCCAGCCACTCAGAAAACTGGGGG
AACAGTGCACAAGGCAGAAATATCGAGAAGTACCAAGGCCCTGAGGCGAGGACTAGCTTG
ATGAGATCCTGGCCAGAAGGGCCAGCATGGCTGACCATACAGTTAGCAAGGAGTGAAGAA
AGATGAGATGAGGTGGAGAGGCTGGCGGAGGCCAGATCATAGAAGGTCTCCCAGCCCACG
GTTATTGAAAGTGCATTCAGAAGCCGTTAGAGAGTCTTGAGCAGTCATGATGTGATTTAA
TATAGTTTCCTTTCTTTGCCAAAAGCTTGGAAATTACTCATGTAGTCATACTGAATTAAA
AATCAGGTGGTAAGAGAAAAAGAAATTAAGATGATGGCAGAAATTTGGGTTATAAATGCT
GTTTGATTTGGACTTTATTTTGTTTGTATACATGGCATAGCTCAAAAATGCACTAGCATC
TCTTTGCTGGCAGTGCCTTCTGTGGAGTCACTGATCTGTGAGCTCTTACAGTCTATTTGT
CCATGTGCGTTTCCTCAGGCCATTCTCCAGGTCCAGGACAAAGAGGTCCTGGCCTCTCAG
CTGCTGGTGCTGACAGGGCAGAGGCTGGCTTATGCGCTCTTCCACACCCAGACGAAAGAA
GGAATGGAGCTGCTTGCCAGCCTCCCACCCACACTCTGTACCTGGCTGAAGGCGATGGTA
AGTAGAGTAGAATGAGACAAATCAGAAGGTCAGTGGATGTTTTCTCAAATGTATATTTAA
TAACAGTTAAGGAGAAAATTTAAATTATATGTTTAATTTACTTAGTTCAGAAGAAAAGCA
TTTTTTATTGGGAAATAACCATCCTGATAACTCTTAAGTTGGTAACAATTCAAGTGTTGT
TTACTTGTATATAACTGATGGGTTCCTTTTGTGTCCCATTTGCAGGACCCCCAGGATCTT
CAAAACACAGAAGTGCCAATTGCAACCACAGCTAACCTAGTCCATAAAGTAATTGAGCTT
TTACCAGAAAACCACGGGCAGTACAGTCTAGCCTTGCACCTCATTGACGCTGTGGAAGCC
ATAGCTAGCCCCTCTCTATGACAGTGCGCACCTACCGAGCAGTCTAAAATTACATGACTG
CAATATGAACTCGTGCATGGGTATTTTACATAGTAAGATCTGGAATTTTATCAAGGGAGT
ATGTCTTTTTTTTTCTTTTGTAAAATAAATAAAAATATATATTACTTTTAAAAAGTGCAG
TCCTGGCTAAATCCCACTCCTTTGGTTAATACTAAAGATAAAATATAAACAAATATCAAT
TACACTATTAATTACTAATACAGATGTTTTACTGTTTATTTCTAATTCAAGCACTGAAGT
AGCTTTATTGTTAAACTTTGCTATTTAAAATTGGTTATAATTTACAGATTATGTTCTTAT
TATAAGATTCTATATTTCATACTCAAAATGTTATTGTTGTAATTAAATTTAAATGTGTTT
ATGTATAGTCCCCATCGGTAAAATTAGAGAAACATCCCACTCTCCTTTAATCAATGTTGG
GAAAATGCTTTGTTATGACGCTTCCCCCATACTGGACGGCCCCCTGGAGTTCTGGATCCC
GACAGGCTCCTTTCCCAGAGGCTACGCTGCTGCCCTCAGAGGACGATGACCCTGCTTATG
GAGGAATACTGGCTTCGAGATCATCATATTCACAGGAGGAACACTAAACAGAACCCTTAA
CCTGTTGTACTTGCCAAAAATGAGAATCTGAGATGCAAGCAATACAGCAAAATTAATTAT
AACGCAAGTTCACATTTGCTTTTTGCCAAGATTCAAAGTTGTAGCCACATCAGGTAATTG
TAAAAATGTATTATCTTGTAAAACTTATGTTTAAAAAAAGGCAAAGATGCTAAAAATTTC
AGTCCAACTTTATTTTTCCTACAAGTGTTTGGAGACGTCTGCTGCTGGGATCTGGTGATG
TTACCTGTTCTGGGGAGCAGGACAGAAGATGCTTAGTGACGGTACAGCTTTAGCAAACCT
ACCTCATGGCTGGATTGAGAGGATAAAACACAGCTAGTTGTGTACCCTACAGTGCCTAGA
GCAGTCCCAGTGCCGAAGAACCATTTGTTGATTAAAATCAAATTAACCAAAACTCTGTAA
GAAGTGCTTTGAGCTGTACAACTACCAAGTATTTACTGTGGTGTGTCTTTGGAATGTAGC
CATACAGTGTAATTACTGCTATCTGTCATGGACCACAGTTGTTATTCATGGTAACTCATT
GTGATACAGAAGTTTGTGTCTTCATTTCCTTGTAAGAAGCCAGCTCTAGCCATCGCACAA
AGTTGAGGAGCATGGCCTTCAGGGATATAAAGAAAAGAGTCTGACAGTTGAGGATATCCC
AGCGTAAATTCCTTTTACCTAAAAGATCACATCCCACTAAGAACTTACCTGCCTAAAACT
TAAATTATTGTTTAAATTCTTGAAAAATAAAATTTTAAGATGTCTTGAGTATTTTGGGTG
AGGGCCTGTAAGTGTGACTGAGGCGCACACTGTGTGCGGTGTGGCCCTGGCGCCAGTCCA
CC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1141, 19679..19743, 38918..39041, 39932..40013, 41535..41582, 41661..41736, 42060..42161, 46700..46799, 49065..49163, 55839..55987, 56824..56903, 57031..57120, 58510..58649, 60433..60649, 61220..61363, 61591..61673, 62021..62085, 64921..65011, 66104..66231, 68745..68958, 69340..69437, 77222..77327, 77965..78125, 79198..79426, 81486..81659, 81756..81862, 84693..84759, 86375..86445, 88938..88973, 90184..90258, 90567..90785, 94267..94356, 94865..95086, 96018..96176, 96405..97041
79345..79426, 81486..81659, 81756..81862, 84693..84759, 86375..86445, 88938..88973, 90184..90258, 90567..90785, 94267..94356, 94865..95086, 96018..96176, 96405..96557
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved