Equus_caballus Locus WDR43
snOPY snoRNA Orthological Gene Database
Equus_caballus WDR43
Equus_caballus
WDR43
15
SNORD92, SNORD53, SNORD53
18309..18396, 29620..29698, 30483..30558
47734
TGAGCTGATGGTATCACCATTCACTTATTTGCTTAGGCCTTAGAGTCATCTTTCACTCA
TGTCTTTTTCTCACCCTTCACAATCAATCAATTTAGCAAATCTGTTGGCTATAACTTCAG
ATTATATCTTCTCACCACCTTTACTGTTTTCATCTGAGTCCAACCCACCATTATCCTTCT
ATCTTGTCTGTCTGCTTTCATGCTTGCCCCTCTACCGGTCTCCACCTAGCATCCAGGCCT
TTTAAGAATGTAGATCAATTTATGACATTCCAAATAATCTAAAATGCCCAGCACTCCCTA
ACTGTAAAAGCTTTAGTCTTCCCATAGCCCTGAGGTTGGTGTTTTTTGTCTTTCTGGCTA
GGCAATAAACTCTATCTGGGTTGAACAGTACCTGGCATTTCTTGCATCAGAATGCATAGA
TTTGGTGAAATATTATGGAGACACTAAAAATTGTCTATTTGATGTAGTAACATGGTATAA
ATCTTGAAGAAATAAAAGAGAATAGCTGCTGCCACCATTACTTTACACTATTATGACTGA
ATAAATTGTTATTATGTGCATACATGACAGGCTGGAAGCGGATAGAAAAAAATAGAAACG
TGTTACAATCATGGACTTACAAGTGAATATTTCTTTTAAACATTTCGTTCAATCATATTA
TTCAAATAAAAACCCCACAACCCAAACCCTTTTTTGAAGGTATGGGCCCCGCTCGCCAGG
ACAGTCACGTTCCTCCACGCGTCCCCTACCGCCCCAGTACAAGTTAGCTTTGGTCCACCC
GGCCACCGTCCACACGGTGAGCCCGCCCAACGCTCGCCTGCGTTGTGAAGAGCCACGCCC
TCGGCTCTCTGCGCTCCCTCCGCCCCACTTCCTCTCTCCAGACCCCGCCCCGCGCCGGAG
CGCCTCCCGCGTGCAAATCACGTGCCTGTCCGCGAAGCCAACACAGCACTGGGGGCGGGC
GGCGCTGCGTTGGTATATCTCTTGTCTCCGCGGGGGGTTCCCTGCCGCCTTCTTCTCCGC
GAGCCCAAGTCTACTTCGCTTTGGCTTCTACCGACGGGCACCTGCGAGTGTGGGAGACCG
CCAACAACCGGCTGCACCAAGAGTACGTGCCTTCCGCGCACCTCAGTGGTACCTGCACCT
GCTTGGCCTGGGCGCCAGCGAGACTGCAGGCAAGGGAAAAGCGGAGCGGGACGGCTGAGG
GCCGGCCCCTGGACCGAATTCGGTTACGCGAGGCCCTTGGCCGGACGGCGCTGAATTCGT
GTAGAGCCATGGCCTTCGACGCCCCGGGCGAAGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGGGCAGCTGAATGGACAG
GCTGTTTCCTTGCTTCCGGACAGCTGCAACCCGCTTGGGTGCCGGCTCACCACGTGTTCT
CTTCCACGTCCAGGATGTGGGACTCACACTCTTCAAACTCTTGACTTTCCCTGGCTCGTT
TCCATTTTCAGCCGTTTGAACCCTCTTGCTTTTTCATTTTTAATGTCTGCTCGGCTTCCC
TTTTATACACCTCTTTTCCCCCAAGGCTGAAGTCTGCATTAGGATATGGAGGTAGAGTGA
AGTTGTAGTTTAGCTTATTGAACATGAGTCCAGGTGAAGTTTCTCTTAGAATGGACACTG
CCGAGTTAGGGAAGGCTTTTCACTTAGGGACCCGTCTCATTCACTGTTGAGTCACTCGAC
TACATCTGCTCTAACTCACACGCACGTGGGAACTGCAGTTACGGGGTAGCCAAACCGAAT
CAGTCCAGTGTGATTTGGAAGCAACAGGTATTGTGAGATGAGTGGTGTTCAGCTGACAGT
ATGTGTACAACTTCAAAAGCTAGTGATTAGTATAGATCTTAACTCCATCTGACTGCTCTG
GGGAACTTTCTGCTAAATTTTTAGGTTGAAAGTAGAGATACATCTGACTTGTTATACTTT
GGATGAGTATGTTTAGGTATTTTCAAGTTTTAAGCTAGATTTTCATAGTCTGTAGGTAAA
GTGACTCCTGTTGATTAATAAGAGAAGCCTTCTCAGAGCTTGCACTCAAGCACAAAGCTT
GGACTTTTTTAAAAAAAATGATAGTTGTCAGTGTTAGAATTAGTGCACTCTGCATATTTT
TCCTTCTCAAAGTTGTTTTCTAGTTTGTGTTTTGACATTCCTGTAAAGTGATAATACTAA
TGAAGAGAGGAAATATGGAGCAGTGATTAGATGCAAGGACCCAAGCTATACTGCCTACAT
TTGAATCCAGGCTTGGCTTCATAGTAGTAATTGTGCCTCTAGTTCCCCATTTGTCAGATG
GGAATAGTAGTATCCACCTGGTAGAGTGGTTGTGAAGGTTAACATATTTAATAATGCATA
TGGCATTTAGAATAGTTCTTGGTGGGCAAGTGCTGCAAGTGTTAATTGTTATTGTTAGAC
ATGTGTATGTGTATACATGTACAAATATGAAGTACTTGTGTATTTCATATTCATGTGGTT
AGTCTTGCAAGGTGGATAAAGATTAACTTTTTGCCTTGTTTGAGAAGAGGAAATTGAGGC
TCTGGAAAGTTAAGCAACTTGTAAAAAGCCAAAAATGGAACCAGAATTGTATTTAGAACT
CAGTTCTCTATTATCTGCAACAAGTAGTTAATATTAGGCTGGCAAAAATTTGTTACCCAT
TTTGCCTTTCTGTTGACTTACAATTGCATTGTGTGCTTCAGGAATAAAACTTTTGCCTAG
TCTTAAATTTTTTGTTAAGAGTCTTAGTTTTAGAATATGTATAACACTCTTGATACAATA
GAAAAATACCTGGATTTGGTTTTGTAATCAGGACTCAACTCAAATTTGCTTTGTTACATT
GAGCAAATCCCTTTAATTTTGGGGGCCTGAATGAAAAATGAGAGTTGGGCTACATTAAAA
AAGTTTTTACAGGTTTCAGTATCTTTTTACCTGTATAGCTCTCATTTTAGCCACACAACT
CTGAGATGCCCTGAAATTATTATGTTTTTGAAAACTGAGAATCAGAACTAAAGTGTAAAT
GACTTCACGCAAGCTTTAATAACCAATAAAGTAGTTGAGGCCTCTAGAGTCGAGGTACCC
TGACTCCTGGTCCAGTGCTCTTACACTGTAACCTTAGATCTTGAGTCACAGAATTGAGAG
CTGGGAGGAATGTAGAGATATCCAGGCCTCATCATCTTGGGGGTTTATTCTCTTACAGCA
TCAATTTTACTTGAAAATTAGAGAAGCAGTTTTCCTGTATTAAAACAAATTTGCATATAT
ATTGTGGTGTAAAATTAAAAATTTACATGATTGTTAAAGATACGAAATGAAGAGTGATTT
TGAGCAACTGCCACAGTCTCTGCTCTCAGGTCCCCAGGTTCCAATCCTTGGCACTTAGGT
TTTAAGATGCTCTCATTTTATTAAGTCCTTTTATTTTACAACTTTGAGGCTTAAGGTATG
AGGCATGAAAAGAATGTTATTCTGAAGCCCATGTTCCCAGCACCTTGTTAAGATCTTGGT
CCTCTCAAATGGGAAGTGGAGCTTATGCCAACCACCCTTCAGGGTCCTCAGAGGGTTAAA
TGAAGCAATGTATATGACTGTTATAGTATGGTCTGGCATGGGGTAAATGCTCAATAAATG
TTAGTTGTTATTTTTGAATGAATCAATGAGTGTTCTGTATGGCCTCCTTTTATCATTTAC
GGCTCTGTTCTTCAATGTAAATCAGTTGGTAAGAGTGTCCTGCATCTGGGTCAGTAATTG
GCAGTTTGCCATCCAAGGAGAAAGTTTGGTGATGTTACTCTTATCATTGGAGAAATTTGA
GTGCTGAATTTCTTGGGTAACAGGAGTTAAAGCAATGGTTCATAAATGTTTAGAAAAAAT
AGATTGCTGCTGCTTGTTCTTCGTCACAGAATGATTATGATACTTTACATTTATGCCACA
ATAGTTTTTAGAGGGTTTTCATATATATTCCACAGCTGAGCATTCCATTTGGTTGATGGA
TCCTGGGGAAGAAGACCTCTAATGATGACAAGAAAAGTGGAAGGAGACAGATTGATGGAC
TATAGATGGGTGCTGTTTTTAGAGCTCCTCTAAATTTGTGTGTGTAAACTGGAGTAAATG
ATATGCCCAAGCCACACAGTAAGTGGCTGAACCACCTAGGAACTGACCCTGCTATTTTAT
TGCCCCCTTAAATCCCTCAAACTTGTCTGCTTTTCCTCTCCTAACTGCTGTAGAGCCCTG
GAGAAACAGACCTTGTCTGCTCTTGGCTACCACAGTAAATGCACTTATGCTGCTTTGCTG
TCACTGCAGTTAAAATGATCCCACACAGCTTAGTGCTTGTTGAATGAATCACATAGCATT
TCAGACATTGGACAGGGCAAGCACAGTAGCATTAAGAATATTTGTAGGAAAAATCTCGGC
TGAGTATCCCCAGTACCTTTCCTTAGAGGTGCAGCACAGTCTACTTCCTATACAATGCTG
TCTTAAGGTCTCTCCAGTATTTAAACTTTGAAAGAAGGTAAAGTTTGCAGATTAGATCCC
ATTGGCAGAAATAGAATTATAATTGTTGTTGATATAAATACTGTAGGTAAGTATTGTAAA
ATGCACGCATTTTGTTCACTGTTATCCGTGAAACTTAAACATTTGCTAGAATAAATGATA
GTAAGATAGGCCAAGAGACCGTGGCATAGGAGACTAATTGAGGAATGAAACTTGAGACTT
TGGCATAATTTTCAGTGTCTAGAGGTCAGTATTTTTCAAAAACAGGTTTTGATCCATTAG
TGGATTGCGAAATAGATTTAGTGAGTTGTAACAACATTAAAAAATAGACGATATCAGAGT
GTGTTTTGTGTGGTAAAGGATAAAGTTTTTGTGAAACTTGTTTCAGTTATGTATACATAA
CGTTTTTGGGAGTGTGTATATTGACTCTCCATGTAAACTCTTTTGTTACTCTGGGATCTC
AGTCTAAAAGTCATTGCTTAATTGATCAAATTCAGACTTCTCATCACCTGGGTGTGCTTT
TTCTCTCTGTCTTCACCACATCTGCAAACATCTTCTGTACCGTGTCTTGCTTTTATAAAT
TGTGCACATGTGCCATTCAGACTCTCACTCTGATTGTCAGCCTTCTGGGTCAGATGCTCA
TCAGCTTTCTTCAGACTGGTTTGGTATTTATTGCTTAACTCAGTCACACCTTCACATTGG
AAAAGACTCTTCAGTCTAAGAAATCACATCCTTTGGTCTTCACTCCTGGTACATCCAGGA
ACTCAGATTTTCCAGTCACAAATATATGAACTAAGTTTTTAGCCTACCCTTTCCATTACT
TTATTTGTGCATGTAGTTAATATGCACATGACATTGTGCTAGGCACTTTAGGGGAAACAA
AACTGAGTACGACTAAGAAATCAAAGAAGAAATAACGACATTCAGATATACCATGTTTAT
AATGCAGAGCAGAGTATGGCTTGTGCCTTAAGAGAAAGAAAAGGTTTTTGTGGAGAGATA
TTTGAGATGGACTTTGAAACATGGATAGATTTTTTAACCAAATGAAAATTGAGGTGAATA
GGAAAAGGCCCCTCCAAGTGGAGGGAAAAGCAAAAGCAAAACTGGAAAGCTTATTTGTGA
TTAGGGAGCGTCATGTAAGGACGGAATTGGAAATAAGCCTGGAATAGGTGGGTTGGAGTT
AAATTGTGGATGCTTTTGAATGCCAGAGAGTTGTTTATATTGATTCATTCTTCTCTGGGG
AGTCATTGAAGTTTTTGATCACAGGCGTAACAGGTTCAGAGAGAAAAGACCAACAAAAGT
CTGACATAATCTAATCATCAGTAGCACTAAACCTTTGGGTTCAGAAATATTTAGTAATGG
GGTGATATTTATAATATTAGATTTCACTAAAATGCACATTGCTTATATAAACTTATCTGG
TTGATGTGTTACCTGTTTGGGTGTGTTCACCTTGCTGAATGGGAAGTTATTTTTAAAAAG
ATCATCCAACTTGGAGAAAACTTGGATGAGTCAGTAGTTCTTTGAGATTAATTAATTGGA
TTATTATTTAAGTTTAGATCAGTGATCCTCAAAATTGGGCAGAGATTCTGTGGATTCTCC
TCCTGCTTGACTGCTTGCTTCTTCCTGAAATAGAGATTTTGCTGATGGGGAAATTAGGGT
TTTGAATATGTTAATGTTTAATTTCTAAAATTTCTTTGCCCTTCTTAATCCAAATTCATA
TCTGTAGAAAAACATAAATGTTTGGACTAGCCTGTGTTCCACACATTAGAAATCTCAGTG
TAGATAATTTCAATTTGATTTGGAAAAAGCAAGAGTAGAAGAAATAATTTCTGGAATCTT
TCATAGAAGAGTTTTCTGATGAGATAGTAGTAGGTTGATATACTTTCCCCCACTGTCCTT
GCCCAAAACAGGTGTTTGTGTTCATAACCTTATGCAGAAGCACATTCGCTCTCTGGAATC
ATTCAAAGGTGGCTTTAGAAATTCATTTAACTGAAGGTGGGACCTAGGACAGTCCTTGTG
CTAAAGTTTCAATGTTTCAGACAAATTAAATGTTACTGAGGAGACCATCAGACTTTTTAA
TTTTTATGGCTTTTAATTGTAACTTCTCTTTTGGATTTATTAAGGTAGTACATTTCTCAG
GACTTGCAAAATGTGCATTACGTTTTTCTGTATGTAAAAAGTTACCTTATTTTTTTTTTC
ACTTTTTTGCCTTATAAATTTTTTACTTTTTGTTGACCTGAGTGTGTCCAATGAAATCAA
ATTCTTCAAATGGAACATCCTCATGACTAAAACAAAAAAAAAGAGAAAGTGCTTTATAAG
TCTACTCCTTGATAGTCTTTGTGCACTGGTAAGATTGTAGTTTTCCTTGGTTGTTTTCAA
GTTGGGCAGATTTTTATGTATCCTGGGCTGCTTTTTTGTGCTGTAGAGCAAAGATCTTGC
ACTTGTTGAGAGAAATTCTGAAATTAAATAATTTTTCAGCATTATAAACTCTGATTTAGT
ACTCTGAAGTTGTGATCATTGATTGTCTTTTTGATGGACAGACAGGAGCTGTTAGTATCA
TTTTTGAAATAAATCAAAGAAGTCTTGTGGCATTTGACGCTAGATTGAAACTTGTTCCTC
TTAAGTCATTAGAATCAGCAAGACCACGTGGAACTTCTCAGACTAGCCCTTAGTCACAGG
AGCAACTTCTGTAGAGTGCTCTGTGCTGCTCTACTAGTTACAACTATTTTTTGACTCAAA
TTGAAGTAAATGCATTCTTGTAAATGTGAAAACACTCGAGTCCCTTTTTCTGCAAATGAA
GCTAGAATGCAAGGGAAGGTTAGGGGAGACGCAGGGGAGGCATTGGCTGCTTTGGTAGGG
CTCTAATCACTGCTGGGAGTGGAGGCTTCACTTTGGCCTGTTAGGAGTGGTTGGTTTCTG
AGAAGTGGAAGCAGCAGTGGGGCTGCTCGGATCTGTTGAGAGCATACCAACAGCATGCCA
AATTGTCCCATCTGACACCTTTCTTCCAGGAGGAGATGGGGGACAGAATTAGGAGCTCTC
CTTCCCATTGGAGTGATTTTTTTTTTTGTAAGTAGTGAGAAAGAATCATCTGAGAGGGAA
TCCACCTCCCCTTTTTTTAAAGATTTTATTTTATTTTTTTTACTTTTTCTCCCCAAGGCC
CCCCGGTACATAGTTGCATACTTTTACTTGTGGGTCCTTTTAGTTGTGGCATGTAGGATG
CTGCCTCAGCATGACCTGATGAGCAGTGCCATGTCCGTGCCCAGGATCTGAATTGGTGAA
ACCCTGGGCCACAGAAACCGAGCATGCGAACTTAACCACTCGGCTACGGGGCTGGCCCCC
TCCCCTTTTTTTAAAGAAGTGTCTTTTAGTAGCAGTCATGTTTCATTTTTTGTCTAGTGG
GCGTTTGCATTTATGCATTTATGATGTTTCAGTGTTTGAAATACAAAATAAAACAATTGT
TTTTTCTTTTTTCCCAGGAAACTCCTCAGAGGAAAAAAAGAAAATCAGAAGCTATCGGAA
CGAGTAACCAGACTGACTTGTTGGCTCTTGGTACAGCAGTCGGTAGTATTTTATTATACA
GTACAGTAAAAGGAGAATTACACAGTAAATTAATAGTAAGTACATAATGTGTGTGTATGT
ATATTTTATATAAAAGAGAGATGACAGGGAAACTGATTATTAGAGATTTATTTTCAAAAA
ACGGGCTGGCCCATTGGTGTAGCAGTTAAGTTCACACGTTCTGCTTCTGCGGCCTGGGGT
TCGCAGGTTCAGATCCCGGGTGTTGACCTACACACTGCTTATCAAGCCATGCTGTGGCAG
GTGTCCCACATATGAAATAGAGGAAGATGGGCACACATGTTAGTTCAGGGCTAATCTTCC
TCAAAAAGTAAAAACCAAAACAGTTCAGCATATGCTGTAGGATCTAGACTGTAGGGGTAT
TTTTCTGCCCCTTCTGCAATTAAAATTCTGAGTGGGAATATTTGATAATAGCTATGCTAG
GTGATATAGTCCTTATTATGGGTTAGAATATGAGGAATTGTTGACTAGGTTTAAAATAAG
AAAGGGTAAACACAATTCTAAGTATCAGAAATAGCAACTGCAAGAAGGAGCTCACTACCT
CTGGGGCTGGGGAACAAAGGAGGCAGTTGGAGTTATTGCTGAAACTCAGACTTTTGAGGA
GCAGGTGTTGCTCTCAGTGCTGCAGTCTCTTGAGGAGGTGTGGCCCCATGGCTTTGGGGT
CCAGACCTCTGAGGAGAGGGCTCCAGCTGACTGCTGGTGTCTCTGAAGGGAGGTGATGAA
ACTGATTCTCCAAGTGTTGGGAAAAATTGCATAGTGAGTTCAGCTGCTGCCAAAAGGATT
TCCACTGCTAGGGTGAAGAAATGGTTGGGTTGGTGCAAACTGGGAGACAGGGAGGAACAA
GTCCCTGTTCCTTCTCCGGCCTTGTCTCCTTCTACCACCCCTTATTGGNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNTTGCAGACATGATGCTGATGAGCCTAGAACTTCTTTTAGATCATTC
AATACCTCACAGGATTGTACTACCTAATCTTTACAGAGAGTGACTTTATTAAAAAGGACC
AAGAGGATCAGGGTAAGGAGACTTGGGATCATGTGGCGAAGTGGAAGAGGACTCAGCATT
GGAACTTGTCTGCTCGGAGGTTGAATCTTTCTAGTTACGGCATCATGGATGAGTAATTTA
ACTTCTTACCTCTTAAGTGGATATTGTATAACCTACCTTGCATGACTTTATTGAGATTTA
GACATAATGATACAATTGAAAGTGCTGAGTGTAGTGCCTGGCATGTAATTGGTATTGAGT
AAATGTTTGTTGAACAAATAAATGAATGAATGAGTGGACAGTTGCTAGATTGCTTTCCAA
AAGGATGTACTAGGCCCTAGCAATATATGATAGTGCCATGTTTATTATATAACCTTACCA
GCATGGGTTTTAAAATGCTGAACAGGGGCCGGCCCTGTGGCTGAATGGTTAAGTTCCCGT
GCTCCACTACGGCGGCCCAGGGTTTCTCTGGTTCGGATCCTGGGCGCGGACATGGCACCA
CTCATCAGGCCTCGTTGACGCGGCGTCCCACATGCCACAACTGGAAGGACCCACAACTAA
AATGTACAACTGTATACTGGGGGCTTTGGGGAGAAAAAGCAAAAAAAAGGAAAAAAAAAG
AAGATTGGTAACAGTTGTTAGCTCAGCTGCCAATCTTTAAAAAAAGAAAAGCTAAACAAA
TTGCCAGATGAATGGACTGAAAATGTTACTTTTTAAAAAATTTGTATCTCTTGGATTACT
GACTTTGAAAATTTTTATTTATTTTCTTACGGAATTCTTCCTGTGGAATTTATTTTTGTT
CAATTCTTTGTGTGTCTGTAAAAAAGGACTTAGTTCTTTGAATAGATGAATGATAAGGGA
GAAGGGAAATAACTGAACTAAACATTTAAAAATATTTTTCTTTTAAGATGGGAGCATTCT
ATATGATGGAAGTACTGATTTTGAGTTTTAACTTTTATCCTTAGCTTAGATACATGTATA
GTGCTGTTTCATTGTATATTTAATTTATGTGAATTCAGGTAGAAAGAGTGAACGTGATAA
TTGCATGCAGTGTAGGTGATTTAGCACTTTATTCTACTGAATCAAGTTTGTCCTGGAATG
TGTGAGAGATGGGAGGCTTGATTTGCCCTTCCACAGTTGATGTCTCCATTCCTATGTGCC
TCTGAGTGAGCAAGCATCTTGCTATGCCGAATGTGTTTAAAGTATCATTCGTATGGTATG
ATCTGTAACACAAGGAAACGTTTAGTGTTTACCTGAAGAAACAGTGATTTCTTTATTGAG
AGATAGTTTGGGCACTTTTTAAAAAAAAGGAATTTTCAAGGATAGTTTTGACTAGACATA
ATTTTCACCTTAAGTGTTGGCTTTAAACTCTTTACAATTTGACTTTACTAGTTCTCTCGT
GTCTCAAACTTTGTGCCACTATACATGAAGTATTTTATTATGCTTAGTGCTGGTGTTCAT
GTCAAAAGCAAGTGGCATTTAGGACTAGTATCCTTTCACTTAAAGATGTGAAAGTATGTT
TTTCCAGCAGAGGAGAAGGCAAGGTTAACATTTGATGGCGTTATAGCTGATTTATCATAT
TTTTGATGTTAGAAATGGATAGATGTAGGTGAAGGCTCTTTTAGATTAAGGCCTAACATT
TTAGTTAACTGTTCAGTAACTAAATTTCAGGGTGCATATTATCATATTATACCAGATGAG
TTTTATTGTTTTCTTTAATTTTTTTTAATCTGCAGAGTGGTGGACATGACAACAAAGTTA
ATTGCATACAGTGGCATCAAGACAATGGCTATTTGTATAGTTGTTCAGATGATAAGCATA
TTGTGGAATGGAATACGCAGACGTGTAAAGTAAAGTGGTGAGTAACATTGATGGTTCTAT
GGTGTTGGATGGATAACCTGGTTACTGTTTGGAAATGCCTTAGCGTTTGACAAATCAGGA
CTATATTCTTGCTATAAGTAAAATTTGATATTGGACATGGGGGGAATGTAGACAATAATA
AAATTATAGGCTATTCTCAAGGAATTTTTAATCAAAAATAGGGCATGTAAGATTTTAATA
CATAAAGGTTAAATAATGGTACAAGAGTGAAATAACTGCACAGGAGAGTCATAAGGTAGC
ATGTGATTACTGGTCAAATGAATAGGGTAGTGTTGGGAAGGCCTGGTGGAAGGGAGGAGA
TTTCACTTGGGCTTGCTAGGATAGGGTAAGATTTGGATGGAAGAGGATGGGAGGATCCTT
TCAAGGGCGGGGAAGGAAGGTGGAGAGGTGGCAAGAGCAAGGCTAGGAGAAAGGGAAGTG
AAAGATGTACTTGCAAATGAGTAGAGTAATTTAGATGAGGTGCATACTAGGGGATAATGG
CTGGTGGAGGATATGGGCCAAAGTATCTCAAGACTCTGGCCTTAAGGGTCATAGATAAAA
ATCTCAGACAGGGGCCAGCCTGGTGACATAGTGATTAAGTGTGTGTGCTCCACTTTAGCA
GCCCAGGGTTCACAGGTTTGGATCCTGGGCGTGGACCTATACACCACTCATTGAGCCATC
TGTTGTGGCATCCCACATAGAAAGTGGAGGAAGATTGGCACGGATGTTAGCTCAGTGACA
ATCTTCCTCAAGGAAAAAGAGGAAGATTGGCAACGGATGTTAGCTCAGGGCCAATCTTCC
TCAGACACACACAAAAAAATCTCAGACTGCTTTTCTAATTCAAGCCCCTACTTCTGTGAT
TGTCTATATAGTAGATGTTCAATAAATGTGGACTGTTGAATGAAGTTCAGTTTACTGTGA
ACTTGTGTAGATGAGGATAATGATGCCCACGGTCCTACAGCTAACAAGTAGCAGAGGAGT
TTGAATTCTGGTAGTGTTTTTCTCCCATACTTAAACTGCTTTCTTGGATTCTATTCAAAC
CATTTCTTTAGATTCTGTCTGGTAAGCAGGAGAGAGCCATTAAAGGTCAGTGTCTTGAGA
ATAAGCAAAATAATGCTTTGGGAAAAAGTAACCTGTCAGCAATGTGTAGACTATGTGGGA
ATGGGCTAGTTCAAAGACAGAGAAGCCAGATCCCAGGTGGTGGTTGTAATAGTCCAGGTG
TAGGATGGTAAGAGTGGGAAGTAAGAATGGACAAGATACCAACCAAGAAGAATCAGCAAC
ACTTGGGAAGGATGGAGGGGAGTATTGAGTGACAGAAAGGAGTTAAATTGAAGGTAACTA
CTAAGTTTTCAGCTTTATGAACTTATTGGGTGAGTAGTGGTGCAGTTAATAGAATTATGG
TCAAAAGAGGGAAATAGTTTTGGAGTATTTAGACAAGTTGAATTTGAAATGCATGTGAAA
GGCAAGACCCAGCAGACAGATTGGTGATAGAGCCTTAGAACTTAAAGGAGGGCTTGGGAC
TGGAGGTGCAGATGAGTAAGTCATCTGCCTAGAGGTTCTCAGTAAGGGTTTGTACTCCAT
TTACCTGGAGCAGTAGTTTCCATACTGGTGACTGTCAGAAACCTGTATGGAGATTGTCAT
TCACTGGGTCTGGGGAGGGACCCATGCAACTGTATTTTTTTTTTTTAATTGAGTTAATGA
TAGGTTACAATCTTGTGAAATTTCAGTTGTACATTAATGTTTGTCAGTCATGTTGTAGGT
GCACCACTTCACCCTTTGTGCCCACCCCCCACCCCACCTTTCCCCCGGTATCCACTAAAC
TGTTCTTAGTCCATAATTTTAAATTCCTCATATGAGTGGAGTCATACACAGATTATCCTC
CTCTCGCTGGCTTGTTTCACTTAACATAATTCCCTCAAGGTCCATCCATGTTATTATGCA
ACTGTATTTTTAAAATGCTATCTGGATGAGAGTTCACAAAGTCAGGTCCTTCACAGAGGC
ACTAGTAATGTTCAAGGCACTGTTCCGTTGTACACAGTATCGTATTTAGTCATAACACTG
TGAGCTGGGCTCCTATTTTACAGTTGAGAAATAGGTTAAATCAGAGCCTGAGCTCTCATC
TAAACTGTGCTGTCTCATAATATTGAGTTCTAGTTGCATTCTTGGCATTCTTATGCTGGT
GTTAATTGATTTTGTTTTCTGGTTTAGGTACTATCTCTTTATTTCCTTCTGGAAGGTGAA
GATTTAGCTCTCATAACCTCTGCCCCCACGTAACCCTCCCCATTTCCCAATAATGTCACA
GTTTTTGATTAAGCAAGTATTCAGTGTTTACATTCTGACTACTTAAATATTGTAATAGAT
GAGCCTTGGACTGTACTAGGTTTATATTTTTGGCACGTAACGTAACTTTGCTTTTCTTGG
GGTTTATAATTGCCTTATTCTTCATTTGCTTAGTTTTGTATATACCTATCACTAGTTCAT
TCTCCTACAGTAATGTAAATCTTCTCAGTTATTTTTGGACATCAGTTAATCAGTTTTATT
TGTTTCTTGGAGGTGTTCCTCCAGTTTCATTTATTTCTTGGAGGACTTCTCTGCCGTCTT
CCAGGGTCTGCTGAACAGTGATTGTCCTGGGATTTCCTTTCACCATCATCTTGAAAATTC
TCTTGTCAGATGGAGCCTCTATTTCTTGGATCTCATTTTTCTCTTTGTTGGTTTACTCTT
TCCTTTTGGTGAAGTACAAGAACTGGTAGCTTCCTGAGAAAGGGTGTGTGGATGGTACAT
TTATTTATTGCTTGTCTGCCAGTGTCTTTATTCTACCTTCACAATTGATTGGTAGTTTGA
GGTTATAGAATTTTAGGTTGGAAATAATTTTCCCTCAGGATTTTGAAGCGTTGGTTCGTT
GGTTTTTTAGCTTTTGGTGTTAATTATCCTTAGTATTCTAAAAATATTATGAGTTTTGTT
CTTTAATCAATGAACTACATTGGCGTTTGAGGGACCGTTTAGGCTGGAAATTCCTGTTGA
TTTTTCTTGCACTTTGCGTTTGATAATTTCATCCCCTCTGTTTTCTTTGATCTTTCTCTA
GTATTCCTTACTGTTATTTAGATGTTGCATCTCCTGGACTAATCCTTTATGTTTTTTTCT
TTTTTCTCTCTTACTTTTCCCTTTTGTCTTTTTCTACTGTTACCTGGGAGATTTCTTCAA
TTTCATCTTCCAAATCTTCTATTGAATTTTAAAATTTCTCTCAGCATATTTTTAACTCAC
AGGAAGTGTTTTTTGTTCTCAATATTTTTTTTGTTGCATCATATTCCTTTTATGCATAGA
ATATTTTCTAATCCTCTGAAGATATTAATTATGGGATTTAAAGTTTTTTTTCATTTGTTC
CTTACATCATCTCCCTCTTGAGGATGTGTTTTGATTTTTGTTTGCTTTTAGTCTCTATCT
TCCGTCTTAAAGGCATGCTTCAGATGACTGGAGATCCTTGGCTGCCTGTTGCTTTTTGAA
AATGAAACACTACAAAGCTGATTAGAAGGCCTGTGTAGGTGTGTGGCTCAACTGTTAGAC
TTCATCTGTAGAGTGATTGGGAAATGTCAGTATGTGTGGGTCATTTCTCTGGAACCAGTC
AGGTTTTCCAGAGAGGGGTCTTCTTATCTAGTGCTTTCAGTGAGCTCTAATGTGGGTGTA
CGTTACTTGTGCATACAGATAGGATTTAGTAGGTCTAGGCTGGTGCTTGGGAGTCTTTAC
GTCTAACAAGTTTTCAGGTGATGCTGATGTAGGAGGATTATACTTTGATTCTCAAAGCTC
TTTTAGAGGGGGAGGGGCGGGGACCGTGGTGTTATTAGCTTCTGTGCTTACATTTTNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNTCTATGAATTACCTGTTTATAGCCTTTGTCTATTTTTGAGTTTTTTCTTGAA
CTCAAGAAGCTATTTCTTGGATATAATGAGCTATTTATGTATTCCAAGTATTAATCCTTC
ATCTGTAGTATATATCTTTGGTATTTTCTCCTAGCCTTTTGCTTTTATTTTAATTTTATG
ACTTATTTTATGGTACAGAGTTTTATTTAATTAAATCAGGTCATTTTTTCCTTTATGATT
TCTGGTTTGTAATTGCTTTGAAAGGCCTTTCCTGTCCCCAGGATTATAAAAACATTCTGC
TATATATTTTTTAATGCTTATTTTTATATCAGTAAGTTTTGTGTGTGTATAGTGTAAAGT
AGAAACTTAATTTTGTTTTTCCAAATGAGTAATTTGACATTCCCATGTGACTGGCAGAAC
AATATATTTTCTTCCACTTGAGAGTTAACCTCTTTTAGTAATAAGATTGCTCCTGTCATT
TCTTGATTTTATAAATGAATAGCCAAGCTTCTTGTGGCTCTAATAGCCTTAACATGTGCA
ACCAACTGCGAGGTCTCATTTGCTAATCATATTTGAGGTGTTAGAAAGGGATCATCTATA
ACTGATTTATTTTACCCTATCAGATGAGGGCTCATCTGTGTGGATTTGGGATACAAATCA
CCTTTCTGGACTGTGCTAAGTAAATTAAAGATAGATGGAGAGGATGGAATGGACACTCAG
AATTCCAGCCAACATGGAAGTTTCCTGAGCATTAACAAAATCCATCTCATGGATCACAGG
ATATACAACTACTCATTTTACATTCTTGTAACTCTTACTCACCCATTTTCTGGTACCTCT
TAAGAATCTCTCTTAGGGGCCGGCTCTGTGGCCAAGTGGTTAAGTTTGCGCGCTCTGCTG
CGGCAGCCCAGGGTTCGGATCCTGGGCTCGGACATGGCACGGCTCGTTAGGCCACGTTGA
GGCGGCGTCCCACATCCCACAGCTAGAAGGACCTGCAACTAATGATACACAACTGTGTAC
AGGGGGGGTTTGGGGAGATAAAGCAGGAAGAAAAAAAAAAAAGATTGGCAACAGTTGTTA
GCCCAGGTGCCAATCTTTAAAAAACAAAAAAGAATCTCTCTTACCGTCCCATCAGGGAGG
CTTTATCTTAGTGATATGTCCAAGGTTAGTTTACCTGACACAAATTTTTAGGGAATGTAA
TTTGCCTTAGAACCTTAGGTGGTATTTTTAATGCCTGATTTGTTTTTGTTATTCTTTTGC
TCTGAATTAAGGTTTCTCCCTATTCATTCAGCTATTTTTGTTTCTCTTCACAATACAGCA
AATGGAAAGGTGACAATAGCAGCGTCAGTTCTCTGTGTATCAGCCCAGATGGAAAAATGT
TGCTTTCAGCTGGTCGAACAATCAAACTATGGGTTTTGGAGACCAAAGAAATCTACAGAG
TGAGTGAATCAAATTAGTTATAAGCGTAGCAGTCATCTAGAGTAAGTCTGAAGAAGGCAG
AAGTCTGAGCCGTAGAATATTGGTTTAAGAATACAGTCTGTATTTTCAAGCTTACCAAAG
GTAAACTTAATAGACAAAAGTTAGCCTCCAAATCTGCTTGATGTTATATAGGTTAGACAT
GTCTGCTTAACATGCATTGGAAAAACGAATACAATGAGAGGAATTTGAATTAGAAATCTT
TTACTCTGCTATGCAGTGATTATGGTAATTTTGATCTCTATTTTGCATCCAGCATTTGGT
GCACAGATAGTATTTAACTATGGAGATTGAGTATCACATTTTGAGTACACTCAAGGGTTA
CTGAACACTTGGTGCTGTGATGATGCCTTAAAATTGTGGTTTCGACTCACTGAGAGTAAA
ATGAAGACCTACAATTCCTTGGCTGTGTCTGAGCACCCAAGCACCCCTTTTACAATGGAT
AGAATTAAGTGATTCTTGAACTCAAAAATTGAAGAAATAGATTGTGGGCGGGGTCATGGG
AGTTGAAAGGGACATCTTGATTTTCACTGTTTTCAGATAGAGTTTTTAAGAAGTGAGAAG
AATTTAGCAAATAATCTTAGTTACATAGAATTAAATTTAACTGTTACCTTTAGTCTAGAG
CTCTAATTTCAGTTATGTATCATATATATCTTGCTTGTGATACATTTGGACTCTTAGTTT
TTGTTACTGATCTGTATCCGTCCTCTGCTAAATGAGATTTAACTTTCTCTAGCACTTCAC
AGGACATGCGACACCGGTTTCGTCACTTCTGTTCACTACTATCAGACCTCCTAATGAGAG
CCAACCCTTTGATGGAATTACAGGTCTTTATTTCTTATCTGGAGCAGTGCATGACCGGTT
ACTTAATGTCTGGTATGTAGTCTTTTGGATTTGGAAGGTAGCTTTGCTTTGAAAAGACAG
AATCTGTCACAGCTTACATGGTTAATATAAATGATGAGTATGAGACTTGCTTTATTGTAT
TTAATGTTAAATTCACACTGACTTGTAATGAAGAATTGAGCCTGCCTAAAAACAGATCTT
TATGAGAAAAAGTTAAGAGCATTCATTATATAATAGAGCCTCCTCCTTGCTTGTTGGGAG
GTTCAGGAGCCTGGATGTTTTTGTGACTGGGCAATTTAAAAATAACCTTTTTTTTTTTTT
TTTAAATTTTAGGAAAATCTATGATTTTGTTGAAGTAGATGGCTCCACTGGGTTAATCTA
GTGCAGTAGTGTCTATTTACTGATGATTTGCTGAGGACGTTAAATTCCTTGGCTGTCTCT
GAAAATTTGCAGTAGTTGCTGTTACTCATTCCCTTTGAAACTACTTTTAAAAGTGAATAA
TTTGATGTTAAAGGGCTGTCAAAAAGTTTTTAAATTTAAGAAATATAGGAAATTCCTTGG
ATTTTATGACATCGTCTGTTGGTGAAGTTAACTTTTTTCAAACCAACTATTCATGGACAA
AATAAGTAGAGATTTTAAAAATAGAATAGTTTCTCATCTTAGTAATCAATTAGTTGAGCA
TGTTCTTGGCTATATAAAGTTACTCTGAATTTACACGGAATAATACTCAGAAGTGGGACT
CATCAAATGTGTATTCCTTAAAGTAGTTTTGTTGGGAAAGGTTCATGAGGCCTAATGTGG
ACCTCTGTTCACCTTCAAAACCATCAGCTAAGGCCTGGTTTCTAATTATGCCTCTTGTAT
CAAATTGAGTTGGTTTTCTGTTCTGTATCTGATTTTTAAGGAGCTCTTGTTGGGATAATT
TCTTTCAGTTTTAGAGGATTTAACACTTACTTAAGATATTAGTAATGTCAAGAAGTTAAA
ATCTGCCACCAAAGGCTCTTGACATTACTGAGGTGCTTCAGTTCTAAATGCTTCACCTTT
TTGGCTCCTTAGACCTAGCGGTCTCCAGCTACAAAATTTCTTCTACGAAAGAAAAGTTGA
TTTCTCTTGTAAGATCCTGAAAATAATATCTGTATGCCTGGGGGCTTCCTAGTAATCGGG
GAGTAAACTTAAAAAACAAACAAATTAAAAAGCTGTATTGAAAGGCTGCCTGAAAAGGCC
ATTTTTGAAGCTGCGGAAGTTTTGTTTTGGTAGGTAGAACAAAGGTAGCAAACACCGTAA
GGTCCCATAATTACCTTTGAAAGACAGTTTCTATAAGGAAATAACATTTGAGAGTTTGCC
ACTGAATGAAAATTAAAAAAGAAAAACAAACCTTTCATATTACTGTAAGGAGACTGCTAT
CTCCTATTGATGGGCTAAGATAGTTTCTTCTGTATATGGGGGTCTGATGGCAGAGATTTT
GAACATGTACGAGTGACTTCATGTTAGACTGAATTTTGTTTTCTTAACACTTTATTGTGC
CTGAAATCTTTAGAATTTATCAAATCAACTCTTAATTTTGGTCTCGACACAAAAATATTG
GAAGATTGTTCACTGGTAAATGTATAGAGTCTCACAAAAATAAACTGATTTTTCTTTTTT
ATTGAGATTATGATAGTTTACAACTTTGTGAAATTTCAGTTGTATGTTATTACTTGTCAG
TCATACTGTAGGTGCACCACTTCACCCTTTGTGCCCACCCCCCACACCCCCTTTCCCCTG
TTAACCACTAATCTGTTCTCTTTGTCCACATGTTTGTTTATCTTCCACATATGAGTGGAG
TCATACAAAGATTGTCTTTCTCTATCTGGCTTATTTCACTTAACATAATACCCTCAAGGT
CCATCTGTGTTGTTGTGAAATGGGACGATTTTTATCCTTTTTTATGACTGAGTAGTATTC
CATTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTACACAC
CATATCTTCTTTATCCAGTCCTCAGTAGATGGACACTTAGGTTGCTCCAAGTCTTGGCTA
TTGTGAATAATGCTGCAATGAACGTAGGGGTACATGCGTCTCTTTGAATTGCTGACTTCA
AGTTCTTTGGATAGATACCCAGTAGTGGGATGGCTGAGTCATATGGTATTTCTATTTTTA
ATTTTTTGAGAAATCTCCATACTGTTTGCCATAGTGGCTGCACCAGTTTGCATTCTCACT
GGCAGTGTATGAGGGTTCCCTTTTCTCGACAACCTCTCCAACATTTGTTATTTTTTGTTT
TGGTTATTTTCGCCATTCTAACAGGTGTAAGGTGGTATCTTAGTGTAGTTTTGATTTGCA
TTTCCCTGATGATCAGTGATGATGAGCATCTTTTCATGTGACTATTGGCCATCTGTATAT
CTTCTTTGGAGAAATCATATCCCCTGCCCATTTTTTGATCAGGTTGTTTGATTTTTTGTT
GTTGAGTTGTGTGAGTTCTTTATATGTTATGGAGATTAACCCTTTGTCAGATATAATTTG
CAGATATTTTTTCCCAGTTGGTGGTTTGTGTTTTTGTTTCAATCCTGTTTTCCCTTGCCT
TGTAGAAGCTAAAAAGAAACTGATTTTGAATCGTGTTTGTAAATTGTTTGTTGCTGTTAC
TCATTGTTTATTTTTTTGTGCCTAGATTTTTTTAGCATCCTTATTGAGGTATAATTGATG
TATCATAAACTGCACATCTTTAAAGCATACAATGTGATAAGTTTTGACATATGCGTTCAT
CCATGAAATCGTTATCACAGTCAAGACAATGACCATGTTTATTGCTCCCAAGAGTTTCCT
CATATCTTTGTAATCCCCTTCTCCACCCCCATCTCCAGGCTTGTTGACATGTTTGGGACA
TTACAAATAAAGTTGTTATGGAAATTTGTGTACAGATCTTTGTACAGGCATATGATTAAT
TTCTCTGGTAAATACCTAGGAGTGCAATGGCTGGATCATATGATAGGTGTATATTTACTT
TTTAAGAAATTGCCCATTTTTTTCCAAAGTGATTGTACCATTTTACATTCCCACTAGCTA
TAAGAGTGCTAATTTCTTCACATCCTCACCAGCACTTGATATGGTCATTTAATTTTAGCT
ATTCTAATAGGCATATGGTAGTATCTCAGTGTGGTTTTAATTTGCTTTTCCCTGTTGGCC
ATTGATGTTGAGAATCTTTCATCTGCTTATTTGCTGTTTGGCCTATTTTTTATTGAGTTG
TTTGTTTTCTTATTGTGTTTTGAGAGTTCTGTGTATATTCTGAATACAAGTCCATTATCA
GTTTTAGGCTTTGCAAGTATTTTCTCCTAGTCTATGGCTTGTCTTTTTGAAGAAAAGAAG
TTATTAATTTTGATGAAGTCTTGATTATGTTTAGAAATCTTTGCTTAACCCAAGATCATG
AAGGTTTTCTCCTGGAAGTTTTATGGTTTTAGGTCTTGCATTTGGTTCTGTGATCTGTCT
TTTTTTTCCTGAGGAAGATTTGCCCAGCACCCCTTGCCAGTCTTCTCTTTTTGTATGTGA
GCCCCCACCACAGCATGGCCACTGACAGATGAGTGGTGTCTGTGCATACCCAGAAGCGAA
CCCGGGCTGCCGAAGCAGAGTGTGCTGAACTTAACCACTAGGCCACCAAGGCTGGCCCTG
TGATCTGTTTTGAGTTAATTTTGTGAATGTGGCACGAGGAATGCATTTAAGTTCATATTT
TTGCATTGTGGCTATCCAGTGGTCCCAGTACCATTTGTTGAAAAGACTGTCTCTAGTGTA
TTGGTTTTGTATATATACCTGTGTATAGACATACAGTCAATTCTCATTATTTGTAGCAGG
AATGTTGTATAAAGTCCTCATGAGCACTGACTTAGTGATACTATTACTCTTGTGGGAAAA
CACAGGGTTAAGTTTCTGCAAGCCTCTCTTGTCACAACATTTTTGTCATCTAATCAATAT
ATAACCTTGTTTTATGTGTGTTTGTATTTAAAGATACCTTATATATATTTATATATGTAT
ATACACATGCACATATGGTTAACTCATGTCAGAACAATGTTTATCTAAAAGAAATATTTT
CTTCATAAGGCACGTCACAGCTTTTTTTTTTGTTAGAACGCTAAACAGCACTTCAGCACT
ACTCTTCGGGGCCGTTTTAAACAGTGAGATCACCAACAAAAAACACAAAAGCAAAAAACA
TGGCACAAAATAGAGTGCGGAAAGAATACTTGCTCATAGTATGAGAGTTGAAATAAGAAG
ACAGAGCACAGCCTTGTTTGACCTCGTGCCTGTGGGGTAACCCATACTTTTACTGCTCTG
TGCATGCCTGGTAAAGACCATGAAAGCGCCACAAATATTGATTGTGGGGGTTGCAAATAA
ATTTTGGCAAGTAGATGAATTCTCAAATAAGGAATCAGTGAATAATGAGAATCATTTGTG
TATGTGTGTGTATATATATATATATTTGTGTCTATTTCTGGACTCTATTTTCTCAGTATT
ATTGTGATGTTCTCCTCAAATTAATCTATAGATTCAATGCAAACCCAGTCAAAATTCCAG
CAGATTTTTTTTTTTTTGGTAGAAATTGACAATTTGATTTTAAAATTCAAATGGAAGTGC
AGAAAACATAGAATAGCCAAAACGACTGTGAAAACAAGAAAACAGTTGGAGGACCAACAT
TGTCTGATTTGAGGACTTGTTGTCAGGCTACAGTAATCATGATAGTGTGGTATTGGCATC
TAGATAGACAAGTCGATTAATGGAAAAGAACAGAAAATGTTAACTCATTGTTTAAATCTT
CCATAAACATATCAGTGCTTACTTTTTTCCCATACAACCATGTTATATGGTAGTGACACG
AATGCTTTCCTTATTTTGATCTCTAGTCACCTTATTTAGCTTTTAAAAGATGAAAAAGCT
TTTCATAATCTAATAATCTAATCTAACAACCTGTAGGTGTTTGCTTTTTTTTTCTTTTTA
AATCTGTCTTATTATCTAATCATTGGTTTTGTTATCTAGGCAAGTCCGGTCAGAAAACAA
AGAAAAGAATGCAGTGATGTCTTTTACAGTTACGGATGAACCTGTCTATATTGACTTGAC
TTTGTCAGAAAACAAAGAAGAGGTAAATGGCTCGATTTTTGAGAATTTGTTTTTGGATTT
CATAAATATTACTTTTAAAAGCATGGTTTTGATGATTTAATGACTCGGGGAAGAGGGGAT
GTGGGAGGAAGAATGAAACATAAAATTCTTCCTAGACTGTTTGAAGTAACCATTAAATCA
CTGTGGTGAGCTCTTAGGAGGGGAAAGGATGGTCACAGTGGCATTTTCAGCAGCCCTGAC
TGCTCTGACCCGTGGGGCATGCCAGCTCCCTGTCGTCAGCCTCTGCACTTGGTAGTGACT
TCGCTCCCTTAACTTCTAGGCTGCATTTAATTTTGATGTTAACAACATAAATTGTTATTT
TCATGGCAGTAATTATTTCTAAATGCAAGAGTTGAGCATCATTGCTGTTCTTTTTCTCTG
ATTATTTAAAGGAGCAGGGAGGAGAGTTGAATTTTCCTAAGTATATCATGCAAGTAATTA
TCTATTACAGTAGAGTATGTTACCTATTAGAGTAATCAGATAAATGCTTTTTTTTAGCCT
GTCAAGTTAGCTGTTGTTTGCAAAGATGGTCAAGTTCATCTTTTTGAACACATATTAAAT
GGGTAAGTAAGAAATTTTCAAGTCCCTGACTTATTTCTTCATACTTCCACTTTTTCTTTG
CATTATATTACTTTTCAGTTAGATTATTTTGAAAGCATTCTTAATTCTTTCTTCATATGA
CTATATACATTCTCAGGGAGAACTCAAGCTGTTGGAATTGTGGGCCATTTCTTCACTTCA
TATTTGTGGTTAAGAGGGTGGCTTTTTATGATGTATGCTTAGTAAATGTTGGTAGTTCCA
GTGATAAATTTTAAAAGAAAGTGGTCCAGTCGGAGGGCTTTGCTTATGAACTTTGGTGAC
TTCATTCCTGTTTTTGATAGTGCTTCCCTTTGGCACACAGATGGGGATCAGTGAGGCCGG
CCGTGCTAGTGTTTGGGTGGACAGAGGGGAGCAGTGCTGTTGGTAGGTTGTGTAGGAGGC
ATAGAGCAGGGCCAGCAAAGTGTGGCCTGCAGGCCACATCTAACAGAGAACATGTGTGCC
CCTCCTCCAGCATAATGAAATGTTTGCTATCTAGCCCCTTACAGAAAGTTTGCTGGTCCT
TGCCATACTTTATAAACATGGTCTGAGACTCAGTTAGGTGCACAGTTATGTTAAACTTTA
AAATGGTTTCAACCTTTTATTGTCAATTGCTGTCCTTTCTTTTAAAATCCTAGTATAGGG
ATTTATTTAAATATAAATTAATTCTGAAAACAGTATACATTTATTTTAAAACATTCAGGA
TGCATAGACAATTGATTATAAAATCCAAGTCTCCTTCCATTGAGTTCTCTCTAGAGCTGT
TAATATTTTAGCGTAAGACAATTGAGCCCTTTATTTACCCAGTTGTATTTGTGGTAATCT
GGTGGTTAAGATTCGACACTCTCGCCACCACAGCCCATGTTTGTTTGCTGGTTGGGGAAC
CACATCACCTGTCTGTCGGTTGTTAAACTGTGGTGGCTGCGTTTTGTTGTGATGCTGAAA
GTTATGCCACCGGTATTTCAAATACCAGCAGGGTCACCCGTGGTGAACAGGTTTCAGTGG
AGCTTCCAGCCTCAGACAGACTAGGAAGAAGGACCAGGCCACCCATTGCTAAAAAAATTG
GCCTTGAAAACCCTATGAAGAGCAGTGGAGCATTGTGTGATATAGTGCTGGAAGAGGAGA
GGATGGAGCAAAAGACTGGGCAGGGTTCCGCTCTGCAGTGTACAGGGTCGTTAGGAGCCA
GAATTGACTCAATGGCACTAACAACAAAAATGTGTACATGGAATGTATAATTGAAGGTCC
AGAAGTAGTGGGCCTTGCTGAGGACTTGACCAGTAGTAAGCCCTTAAAGGATTTTAAGCA
GAGAATTGATGGCCTTGACTTAAGTTATTCTTTCTGATGTGTCGAGAATAGCCTACAGAG
GGGCAAAGACCAGAGCAGAGAGCAGAAATCCTGGATAGAGATGGTTGTGGAGTCAGGGTA
CAAGGAGGAGTGTGTTGGAAAGATAGAGGTAGTGGGGTGCTTAGAATGGAGATTATGGGT
GTGCACTAACTGGTGATAAGATGTCTGTGGTGTGAGGAGTGAGCGGCTGAGATACAGTGG
AAGACAGTGTTGTTGGAGGTAGAAAAGTTAAGGAATTGGGAGGCCAGAATGTCAGAAGGA
TCATCAGACGCTAAGGAAGGAAGTTCTGGGCCAGCTCTGGTGGCCTAGTGGTTAAGTTCC
ACGTGCTCTGCTTTGGTGGCCCAGGTTTGGTTCCTGAGTGTGGACCTGCACTACTGTTAG
TGGCCATGCTGTGATGGTGGCCTACATACTAAAAAACAGAGGAGGATTGGCACAGATGTT
AGCTTAGGGCAAATCTTCCTCAACAAAAAAACACACATAGACATATATATATATAAAAGA
AGAAGAAAGGAAGTCCTCAGGAGTAGTGTTGGACAGAATGACAGTGAGCCACTAAAATCT
TTAAAAAATGTGGGAGAGTGACCCAGAGATCATTGGATGATGGCAGGAGGGGAACGTAGC
TGGTACCTGGTGACAACAATTTCAAAAGTTGTAGAGGTGAAGGAGAGACTGTTTGTCTTG
AAGTGTCAGTGAAGAGCAAAGGAAGGGCACAATTAAATCATGTCCAAGGCCCTGGCACAA
AGGGTGTTGGAGAGAAAACAACTATAACTTGGGAGGGCTGAGGGATGAGTCGACATAGAG
CAAGAAGGTGATGAGATCCCTTAGGGAAGAAACTGAGAGTATAATTTTGCTGGTTATATT
TTGTTGATAATTTTGTTCCTGGAACTATGTGGTAGGGTCGTGGTGAGGCTCTTGAGGGTT
GGGAGTGATTGGAGGTGGGGCTTGTTGGAATGGGAAAGTACAGAGCCATTGGGACTGAAG
CTCAGGATGGTGAGAGAACACTTGGGAGCTTGAGGCCTCATGTCGGGGTTGACAGTGGGA
AATGGATCTCAAGGCAGATTTTGGTGGTGAGTACTTCATGTTGCGGGTGTTGGGGATAGA
TGAAGTCTTGACAGGAACACTAGTGCTCTGGGGCTCCGATCTCTTCTGATAGTAGTGTGG
AGGCGAGAGGAGGGTCACATTTCATCACTTGATGCCAACTTTGGAGAATCAGTATGAAAT
GTTCTTATTTCAAATTTTCTAATCTAATTTTCTCCCCATTTGTAGATACTGCAAAAAGCC
CTTGACTTCAAACTGCACAATTCAGATAGCAACACCTGGGAAAGGCAAGAAATCAACACC
AAAACCCATCCCTATTCTAGCAGCTGGTTTTTGCTCAGACAAAATGTCATTGTTGCTTGT
ATATGGCAATTGGTTTCAGCCCACCATTGAGCGAGTGGTACGTAGATGCTAATTTAGAGT
AAAACAATAGAGCATCAACATGTCCAATGGGAAAGAATGATTTTAAAATGATACGTTGGT
CTGCTTATAGGAATACTTACAAAAGTCATATTTTCCCTTAACTGAAGGACCTTTCATTGA
GTGGTTTATTTTAATTTGTGACAACTTTCTTTGTATAAATTTTACTTAACTCAGTACATC
CAAAATATCTTTTTAATGCTTAGTCAATATAAAACATTATTTAAGATATTTTATTCCCTC
TCCTCCTTTTTTTGGCATTTTGTCTTTGAAATCTGGTGTATGTTTTACAAGCACATCTCA
ATTTGGACTAGCCGCATTTCAAGTGCTCAATAGTCACACATTCCTAGTGGCTACCATTTT
GGTCAGCATAGGTATGGGTGAATTTTGCCTAATTATGCAAAAGATAAATCTTCAAAAAAG
AGCCCTTAGAAATAGCACCCATTGAATTGTCTAAGCAGAGATATAATGGGCAGTGCAATG
GGTTAGCGTTTCTGATTACAGAAGTTTCTTTGGAGACTGTCGGTGAGTTATGAACATGTC
CAATAGGCGATTTCTTAAACTTGCATTTATAATAGTTTTATTCAGTAAGGCCCTCAGGGG
GACTGTGAGTGGAATATTGCATGCCCAAGAAAGCTCTTGTTGAGTTTATTTAAATGCTTT
TTACTTTTTAAAAATTTAACACATGGGGGCTGGCCCTGTGGCCGGTGGGTTAAGTTGGCG
CGCTCTGCTTTGGTGGCCCAGGGTTTCACAGATTCAGATCCTGGGCACGGACATGGCACC
ACTCATCAGGCCATATTGAAGTACGTCCCACATGCCACAACTAGAAGCACATGCCACAAC
TAGAAGGACCCACAACTAAAAATATACAACTATGTACCGGAGGGCTTTGGGGAGAAAAAG
GAAAAATAAAATCTTTAAAAAAAAAATATTTAACACATGGATATGGTTTAATAAAAGAAA
AGTTTTGAGCTGTAAACGTAAGTCTCCTTGCCACATGGGAACCCCTTAACCTCTTTCTGC
AGGTGCAGCCATTGATTCCTGTTTATTTTGTGTCCAGGTATTGATTGATTGTATGGGCAT
GGAGAATTACATAAAACCTTAAAGCTTTATGGGTACATAGGTACTTTGCTGCAACTGACT
TCCCTCCCCTGTTGAATACCATGTCAGAACATGGAGATGCGCCTTGGAGCACTTTGTTTT
AATCAGCGGTGCTGTCTTTGACTTGCTTGTACAAGGATAGCAGTAGAAAATTTTAGGGTA
GGACTTTTTTTCTTTTAAAGCACAGATTATTCTTTACAAGGGTGATGAACTGATATGTTT
TCTTTAAAATCTGTTACATTTTTTAAAAAATCTGTTGATCTTTTGAAACTATATATGTGA
AAAATTTGAGTAGTATGTAATTTAAGAAGAAAGTAAACGTTATGCCCAGTATCTTCAGTT
TATCCGTTTTCCTCAGCCACTATCAGTCTGAATGGTTATCACTCTGAATGGCTTAACATT
TTTGTGTGGAAGCTGTCCATACTTTTTGTATTTTTATAAAAATGTACAACTGGACATGTA
GTTTTTCATTTTATTCTTATTCCCGATTGCTTTGTTTGATATTGTCTCTCTCTTTTTTCC
CCTTCTCACCCCACTCCCCCTTTAAAATTATATTTCCAGGCATTAAATTCCAAAGAATCT
CATGTGTGTTTAGTAAGAGATATTTCAAACTGCTGGGCTCCAAAAGTAGAAACAGCTATA
ACAAAGGTGAGTGCATTATGTATTAGAAGTTGAGAAAAAAGATTTGGGTGAATTTAATTG
TTATGTAATACTGTGTTTAAACTCTTTAATATCCTCTACGATCTTGACTTAAAGTTTGTG
GGATTAGGTTTGACGTATTAAGATTGTAAAACTTTCTTCATTTCTTTGCTCTTGATTTGT
TGAATGAATGAATGAGTTTCAGGTGACTAGAAGTTGAAAACCTTAGATTTAGTTCTTCCT
GACCCCTATGCATGATCATTTGTGCAAGGAAGTATGTAGGAATAAATATCAATATCAAAT
TTATCAATAAATTATTTTGTCAATCTCAATACTTAAAGGAGCATAACTTCGTTGAGAGGA
ATGCTGTATTTCAGGGTGGAATAAAACCTAAAATCATAATGGGGCTGGAATTTGATACCA
TATATAAGAGCATCATCGTGATGCTTTATTTTGTATATAACATTGCGTCTACATGTAGAT
ATCTCATGTTTGGCAGTTACGAGAAAAGGAAAGCCAAGACATGCTGTGATGACATCCCAT
ATGGTTTCGCTTCTGGCTGAGTTTCAGAGATGACACCTTTCTCTTGGCTGTCTGAGCATT
TCTGGCAAAGATCGATTATTGGAGATGGTTGTAAAATAGACAGCGTCACTCTTCAACATT
TTTAAGTCACTGTGTCCTTGTGTGGTAGATTTTGTTTTTCCTGGTTTTTACTCGTAGGTG
GTATTAAAAGCTTTAAACCGTGAACTTTCTCGTTATCCTTTAAAAACTTATTTGCCAACA
TTTCATTAAAATTTATCTTTGTATGACCTCAGTAAAAAAATTTGTCTTTAATTCGTATTA
CATTGTTTCCAACAGGAAAACCTTTTAAAAGGTGTTAGTGTTCTCATTGGGGATAAATCT
TGCAAGGACTAAGGTGTAATTTCCTTGGTCACGCCTCTGGTATTCCTGTTTAACAGGTGA
GAACACCAGTGATGAATTCTGAAGCGAAAGTTCTGGTGCCTGGGATACCTGGTCATCAGG
CAGCTATCAAGCCTGCTCTTCCACAAACTGAGGAAATAGAGAACAAGAGGAAATTAGGGG
AAAATGAGGTAAATACAATCACTCTGACCATTTTTGAGTTTGAAATTTAGGATTGCTTGG
GAGATTCTAACAACTATATAGGATAGAGCCAAAGTTGAAACTTCAGAAACTTACTGAGAT
TGCTGCTGTTTTCCTCTCTCTCATCCCCAGCAATGTTGGTTCCAAAATTCCAGATTGTGA
CCTTTGTGAGACTTATTTGGCCACTGTTAATGGAGAAGACAGAACTCTTATGAACTCAGG
AGGGTGCTGTTTTGGCCATTTGTTGATAGCTCAGTAACTTGATTGAATAGATTAAGCCAG
GACTTGCTGTGATGATTTTCATTGGGTTTCGCATGTTGCTGACTTCCGATGATGCCTCTT
CTCTTGGCTGTCTGAGCAATCCTGGCTGGTTCAGTGCTAGTTGGACTTTAAAAGTGATTG
TCATTATAAGCTCTTAAAGTGCCTATAAACGTCGTTTTTTCTCAACTCCCAGAACCCTTC
TATGGTTACTGTACTTCCCCATGTAGCATTCTTTTTCATCTTCCATTTACATTTGTCACT
CTTGTCTAAGTGATCGAGAATTTTAACTGTTTTATCGTTAGAGAAAGATCATATTTCTTA
CCTGATTCTAAATGTCTTACTTTATTGAGTGGGGAGTTGGGAATAATATTGCTGTTCATA
AAAATTATTCCTCAATAGTATGATAGCTGTATTTAAAAATAGTGAACCAGCTTTCTTTAG
CTTGGCCTAGATCCAACCCTTTAATGTCCTCCTGCCTTTTTTATGTTTTTCCTAAGTTAA
GGTAGCCCAAACAAGAGGCTTTACCAAGGTATATCTGTTTGCTTTGGTAGTCATAGAACA
TCTGTATTTTGATTTAGTTACCAAGGGGCTGGCAGAACATGGTTGTTAGACATGCTTTAG
TAAGCGGTCAGTTCTGTACAGTTGAGTTTTTGTGTAGCAAATTGCATCATGTTTATTTAC
ACTTAAATTTTTGGTATTAAAGAAACTTGGTTGTAGGATAGCATCTACTAGAAAATAACT
CATCATTTGGAACTTATAAAGAGGAAAATAGGAAGAAATTTCATAAATCTTTTGGGAACA
TAACTGTCCTTATGCTCTTTTGCTAATATTTGTTTCCTTTTGCAAATCTGAGGTTGATGG
CAAGGGATAGTTATAGAGGGTGAAGCTTCTGTGGTAATAGGTCTTGTCTTGTGCTTTAGT
AATCAGATGCCAGATTCTTGCTTTCTTTGAATCTTCATGTAAAGGAATTTTTATGAATTA
CATTTTCAAATCATGGCTTCTTAGGTAGTTGTTTTTTTCACTAGAATCTGGAAACTTGCA
TAGCAAATGTTTCACTTGTCTCCAACACTGGCTTTATGATAATGAGATTTTTTTGGAATG
AGAAAGAGCGTTTTCATGGTTTTTAGGATTGAGGTGTGAATCACTCAGTGCTTGTTGTCT
CCTAAGACACAAGCACAAAGTGATTTGACCAAACTACTTTAGACCTTGTCTGGTTTAACA
TTAACAGGTCATTTCTATTCTGTAGGTTAGCATTGAAGAGCGCCTGGGAGCACTGGATAT
AGATACAAGAAAAGAAAAGGATGACCTTCCACAGACAAATAGCTTTCCAGTTCTTCTTGC
ACAGGGTTTAGAGAGTAATGATTTTGAAATGCTAAATGTAAGTATTACAGCAGTTTTTAA
GTGAATTTAAGATGGTTAATTTTTCTTAGAAAGTGACTGACATAGCACATTCACAGAGTG
AATAGTCATGTAGCCATTTTGAATTTAATATTTTGTGTTGAGTAAAATATATATCACTTG
GTGGCACTATACGGACAGTCACCAACCTACAAAGGGATTGTATTGAATTATTTTGAACCT
GGAATGCATTTTCTCATAGAAATATTGTTCTGAATTGTTATTAGGTCCTTAGGCTTTAGT
TCACAAAAGCCTTTATAAACATAGTGTAGCTGAATTATAACACTCAGCATTCTAGATCAC
AATTTATATTTTTTTCTGTAGGAAAATGCGTTCCTGAGTTTTTACTCTGGATTCCAGAAA
CTTATTTCCCCCTGGCCGTGAGAGGGGGCAGTGAGGTGGAACCTTGGCAATGGGTAGGAG
GTTTGGGGTAAAAATTCAAGAGGGTTGGGGGTTATGTTGTAAAGTATTTAGAGGTAAAAG
TACTAGAAATTTTGTATAAAGGGAGGGATTTATGATTTCTTTGTTTGTAAGTTGGTGACT
GTTTGTATGAAGTTTCTTAATTCTGTCCTCTTAATTCCAAAATTTGATAGTAGTCTGTAG
AGAAAATTTAAGTGCAAAAAATTGTATTTAAGCACTCCCTGATCAGATTATAGCAATTTA
CGTTTGTTAAGTGCATTTATTCTTAGTGACTCAGTGATATGGTGCCACTTAGTATAGATG
TGACTTTAATATGTAACCTATGAGTTGTGTCTCACTGATTTATATTTTGATCTAAATAGG
AGTATCTTGTATTTGTGTCTGAGATGATTTTGCAAAACGAGGGGAAACCAGCATGTCTAA
AAACCTAAAATTACTTTTAAAACAGTTTGTGAGTGTATGTATTTTGAAAGGTAGATTTTA
GTTTAATATGGCGTGGAAGCTAGGTGAAGATTTGGTGAAAAATAAGAAGCTGTAGAGAAC
AATTGGCAGTGTTTTTAAAGTGAAATATAACTTATCTGCCATCATTGCCTTACTTAACTA
TGGTTTGAAACCTTCCTCAGTAACAAGTGAATCAGCTACCAAGTTTTTTTTCTTAAAAAT
TTTTGAAGAAACATTCCAAAACATGTGAAAATAGTACAGTGGACCACCATGAACCCATTA
CCCGGATTCAAAAATTATCAACACTATTAGCCAGTCTATCCTTGTTTCATCTGTCTGCCC
ATATGCCTTCCCAGGTGATAGTGAAGCAAATCTCAGATGTACCATTTTATCCATAAATAT
ATCCCTGTTCAACTCTGATGATGACAACTCCTTTTAAAAATACAACCACATTCCATTATC
ACACCTATAAAAGTAATAGCAATTCCTTAAAATCATCAAGTATCCAGTTGGTGTATACAA
TTCCATGATTGTCTCATAAACTTTTTATTTTTCTTTTTACTTTGTTCAAAATAGGATCCC
AGTCATGTCCACACTGTATTTAGTGGATCTGCCTCTTTTGTCTCTTGGAATTTGTCTTTT
GGAGAAGCTAGGTTATTTGCCCTATAGAGATTCTCACATTCTGGATTTTGCCTCCTGCAA
AAATCCATTTTACTGGATCATTTAACCCAATAAATAGTAGCATTTAAAATGTTCCTCTTT
CTATCATATTTCCCTTACAGTGGTAGCTGGATCTAGAAGCTTGAAGAGATTCAGATTAGA
ATCTTTTGGCACTTCAAAGGTGACAGTGTATACTTTTATCAGGTATCATAGAATTGTTGG
GAGGACAAATGAAATGATGTTTATGAAAAGCACCTCTTAAATTGTAAAGGGTTGTACATG
TAAAGCTCTTTCATTATTAAGGACTTTGAGCTGATATGTTATATTACTTAAGTGGAAATT
AGTTGAGTCCTGAAAAACTGTGTGCTGGAAAAGACCTGTGAAAGTTATAGTGAAGGGCTT
AAAATAACCCTTAAAAAAAAAGTAAAAGTATGCAAATATTCCCATACTATTACCTGGGAG
ATTATGCATTTATGTATTCTGTATGCCACTCTAAGAAGAAAGAGGCAAGTTAAAAAAGAA
TCAAATATTTTTTCCCCCTAAAAATAGTCTTCCCCATTCCTAAAAGGTACTTTTTGAAGA
TAGATGAAATACAGTGGGAGGACGTTAAAGAAAGGAATGAAAGAAGAAAGTGAGCAGTGG
CAGGCATGCAACATGGGTCCAGAAGTGAGGTTAAGAGAACTTCACATTAAAATTTATACC
TTTAGGAAGGTGGAAGTTTGACCTAAAGAAATAGTCTATAGCTTATGCAGAAAGAGAAGC
CTAGTCGTTTAGGTAATTCATGGCTCCCATAGGAGATAGATATTTTTAAAAATTTATTTA
AATTAAATGTTTTTTAAAAGTTCCATTTATGGTAGTACCAAAAAATACCTAGGATAAATC
TACAAAAGATGCCTCTACCTCTACATTGAAAATAACAAAAATTGAGAGAAATTAACAAAG
ATCTAAGTCATTGATGATGACGGTTTGGAAGATTCAACAACATTGTTAAGATCAGTAGTT
CTCCCCAAACTAATCTGTATCTTCAGTGCAATCCCAATTAAATTCCAGCAGCTACCTTTC
AGAAAGTCAGAGGGCATGTAATAACCAAAGTAATTATAAGATAAAAAGCCAAATTGGAGG
ACTTACCCTACCTGATTTCATAGTAAAGCTATAGTAGTCAAGATAGTTTGATATTGATGA
AAAAATAAGTACAGATTAAGGAAGCAAAATAGAGTCCAGTAATAGATCACACACAGTTGG
TTTTCAGTAAAGGTACTAAGTTGAGTCAATGGGGAAAGCAAAGTCTTTTCAACAAGTGGT
GCTGAACCAACTGAATATCCATATGGACGAAAATGGATCTCAACTCTTAGATCGCTTACA
CAAAAGTGATCATAGACGTAAATGTAAAACCGAAACCTACAGAACTTCTAGAAGAAAACA
GGAGAAAATCTGTGCAAACTTGAGTGGAGAATGGCTTCATCACAAAAAGCATGAAACTCT
AAAGGAAAGATTGGTCATTTGGACTTCATGGAAATTAAAAACTTTTGCTCTTGAAATGAC
GCTTAAGAGAATGAAAAGGAATCCTGCAGGCTGGAAAAAATATTCACAACTCATATATCC
AGAATATGAAGAAGTCTTAACTCAATAATGAGACTCAACTCAAAAAACAATTGGTAAATG
TGTGAACAGATACTTCACAAAAGAAATCAAATGGCCAATAAGTACATGTAAAGGTATTAT
ATAGTCATTAATCATCACAGATGCAGATTAAAATCACAGTGAGATAAGGCTACATACCCT
TATAGATTGATTAAAATTAAAAAGACGGTACCATCTGTTGGTGATGATGTAGAACAGCTG
GAGCTCTCAGATCGTGCTGGTGGGAATGTAAAAGAATACAACTACTTTGGAAAACAGTTT
GGCAGTTTCTTAAAAATTAAGGGTACACCTACCGTATGACCCAGCCATTCTACTCCTAAG
TATTTTTACCAAGAGAATCAAAAACAAATGTTCATGCAAAGACTTGTATGTGAATAACCA
TAGCAACTTTATTTGATTAATAGCAACTTTATTTGTAATAACCAAAAATTGGAAAGAACC
TATATGGCCCTCAACGTAACAATGGATAAACAAATTGTTTATCTAGCTCTATAAGGAATG
TGTTGATATATCAACAGCATGGATGAATTTCAAACTTTTGCATTGAGAAAGGATCCAGAC
AAAAAAAAGTACATAGTGTATGATTCCACTTATATAAAAATTCTAGAAAATTCAGACCAA
TATATAGTTCAGTGGTTGCTTGGGGATGGGCGGAAGGAGGGATAGAATGTAAAGGGGCCC
AAGGAGAGTTGAGGGTGATAGAAAAGTTTATCGTAGTCTTTGTTTCATGGCTATTCATTT
ATATCATATTGATCAAATAGTACACATTAAATGTGCACTATTTATTATGCTTCAGTCATA
AAGCAGTAAAACTATAAAAGAAAGATCCTTCAGTATCATTTTGCTAGTTGTAGCTGTGGT
TTTATAGGGTTATTTCTTTAAATACATTCTTGGCAAAAGTTTCACTCAACTATCCATTAT
CATTTTGCTTGATTTGGGATAACTTATTTGCTTATTTTAAATTTGAGAATTGTTATCATA
GAGCCTCTGTCTTTAGTGAGCATAAGAATTACCTGAGAGCTTGTTGAAAATTCTTCTGCC
CTGCAATTTGGAGTAACTTCTAAATAGCTAGGCCACATCTACTCTTACTTGCCTGTAACA
GTTCTGGTTTACACTTCTTGATGTAGTTAATAGTGACTCTTTTTATTCTCAGAAGTGTCC
CAGTTTGGAGAAGAAATTAGATGATTACTTTACCTTTAGCACACTAGATTTCACAAACGT
ATGTGTTTTTCAAAGCTTCAGTTCTACATTATGTTTCTTAACCAAGCTTTTGGTATAAAA
AATGTGCAGCAACAAGGTCAAGAGTGTATTGCTTGACCTGAAGTGCTGCTGCTCTATTTG
GCCATTTAAGACAGTGAAGCCTGGTGGTTTAGTGAGCATCCTTGAAAGCTGAGGACCTTA
ACAAGAGCATATCATCTCTCAAAGAGGAATTTGTAGACTAGTTTATATCACTGAAACTTT
GTGGTAACTGATATTTATAGTAAAGAGGTGATTTGAGGGATGTTTAGTATCAAGCAGCTT
GTGAATTATCGTTAAAGTTCTGATCATATTTTGCTTGAAATCTTGTATTTCGATTATTTG
AAAATGAAAATATTATCTTAATTGGGACTACTAAATCAGGACAGTCCATCCCTCAGTTCT
CCAGTGATTGTGTCTAAAAAGTTTATTTCTTTTGCGTAAGAAACTATATAATTATTGTCA
GTGATAGTTTTTAAGTAGTACTTGATGGATTTGGAAGGGCTTGGTGTAAAAATACTTTTA
AAAGCAAATAAAATCCATAGAGAATTCTGAGAGGATATGTTAGGGCTGTTAAAATAGGTT
GAAAACTAACTTTCTATATTTTGCCCTTGGGTACTTCTGCTGTTTATATCCTGAGTATGA
CCTTTGTAGGAACAACTACCACCAAAACGTAGCGTGTGCCAACCATTAGGGAAGTTCCTC
TAGGAGTAAACCCTTTTGAAAGGATAAATATTTAAAAGTTTTCAAGAAGAAGGGGGCAAT
CAGGATTTTGAGACCTGAAAGGATTCTTATTTCCCACCCCCTCCTATAGATGAAGCATCT
GGGGTTTGGAGAAGTTGAAAGGCCGCTAGGATTGGGACTAATCTGCTCTGTGTCCTTTTC
TACACCCTCGGTGCAGACTGAGTTTTGCCCAGTGATGCGCCCTTGAAGGGTTTTGACTGA
GCACGCATGTGATCTTTTGGTTGTCTTAAAATTTTATCAAGAAGTTGACATTTAATATTA
AAACGTTTGTTGCTTTCTAAATGTGATTTTAGTATGGTTTGTTTACTTTATGTGGCTACA
TTGCTAATTTCATAAAATGAAGGTTTGGGAACTTCTTTAAAGTATATGTCTGTATTCAAA
TGTCTCTAGAGGTGTTCCTTTCTGTTTTATATACAAAAGTTCATAAAAGTTTAGAATTTT
TAGAGAAGGAACTGTTTATTGAAGTAAATGTCCTGATACCTGAAGCCTACTTGTCTGCTA
AGACACAATATGATGTTCTTCGGTCAGTCCCTCTGACCTTTATTTGCTGAAATTGAGTTG
GTAGTTGATTGCCTTGGTTTTTAAAATATTTTTACAGACAGTTTTTCCTGTAGTGTTCTT
AGCTACTGAGTATATTTATCTTTATATTTATTTTTTTACAGAAAGTACTTCAAACTAGGA
ATTTAAACCTAATAAAGAGGACTGTGTTAAGGATGCCCCTGCATGCTGTTATTCCATTGT
TGCAAGAGGTAACTGAGTCCGCTTTTCATTTTAAAGTCCTAATGCTGTGGGTTAAAGATA
AAATCCAGTATTTAGAGAGATGGATTTGCAGTACGTAAGCAAGCAGGGTATCAGGGTGTT
TAGAGTGGATGATAGATGACTCGGGGGATCTCTTAACGTACTTGAGAAAGAAAAGTGAAA
TTGGTGAATTCCTGAGGCAATGAAAGGAGATGTCATTGGCGTTTTTACTTTTATTCCACT
AAGGGTGAGTGTGTTTCTGTGTGTCTGAAGGGCACTGGGAACTTTTAAAGTGAACCATTG
AAGGCTGTATCTGCATGATGTCATCCGCATGGGACGATTGCTGTAGAAATCCCAAGACAG
AGCCACCATATTCTCATTTTGGTTTTTCTCTCTGTGACCTGTTAGATACCCTAACCTAAC
GTTGAAACCGCTTTTGTACGTTTTGATTTTCTTTATTGTAGAATAGCTGTTAATCGCTAG
GCCTGGCAGTGTGGAATTTGAGAGGGCTTTAATTGTCTAGTAGTTGTTCAGCCTTTGGCT
TGTACAAGAGTAACTTTCACTGTTTCTGACAAGTGGTCACCCTGGTTTTGCTTTAGTAAT
TCTGTTGCAGGATTTTAAGAAAGGGATAGGTAGCAGCTAGACAAGAAAAAGCTAATAGGA
GTTCTGGGGACAGAAAGCATATGTGCGATCGATGACAGCCTGTTAGTGGCACCAGGGGAT
AACTCCAACTCAGTGAAACCCCAGGGTCTGGAGCCGTTTGGTGGCCAGTGAAGGTAGTTT
ACCGAGGTGTGTCATACATGCAATTCAAATAATTTGTAATGATTAGTTATCTAAAGGAAA
ATCTTTTTTGTCTCTTAAAAGTATACATAGTTTGACTGAAGATTGTCCTAAAAATATGGG
TACAAATTGTAAAATAGGCCTAAAGTTAGATTCTTTGTAATTAGAGATTATACTTGGATT
ACATTTGTTTGACATGCTGAAGTATTTTGAGAGTGTAGTTCTGATGTTAATGTGGGCTGG
TTTACCATTATTGATAGGGGAAACCCCTGTATTTAGAAAAGCAGTGTTGTATATTAGAAA
AGCTGGTCATATGGCTTTAGAATCTTATCTACTCAAACAAAATTTGCCTGACCTAGATTT
TTTTCTGTGTATTTTTTTATTGAGATATGATTCCCATACCGTAAGGTTTACCCTTTTAAA
GTGTACAGTTCAGTGCTTTTTAGTGTATTCACAGGTTGTGCAGTTGTCACACGGAAAAGA
AACCTCATACCTGTTAGTCACACCCCATTCTCCCTTATCTCCAGTTTCTGGCATCCAATA
ATCTATTTGCTATTTCTGTGGATTACCTATTCTGGTCATTCATTCATATAAATCCTAGCC
TAGATTTTTATCAGATAGTTACTTGTATATTCCTAGATTATGTTATGTTGGTTAAACGTT
CAGAGATTGGAAAATGTAGGAATAATGATTTCCTAATACAGTCGTTAGTTTCCTTTGTTC
TCATGGATGTGTGTTCCTGGGAGTTGATGGGGATTGCCTCTGAAGTGCTTTTGTTAATGC
TGTTTTTCTCCCCCTCAGCTTACAAAGAGATTGCAAGGACATCCTAATAGGTAAGATTTT
TAGATGACTTAAATTGTTTGATTTTATGAATATTTTAGAGGTAATTGTTAAAAACAGCAA
TGTCTTGACAGCATGAGATCACATGGTAGATAGCCCCAGATTCTAACTAATAAAACTCTT
TGTGTCAAATATTACTCTACCCATTTATTTGAAGTAAAATGATGCTTATTTCTAAGATTT
TTATCGTAGTTTTTTTCTTTCTTTTAGAAAACTCCTGTGTAGTTTTTTCAGCTTTATTAT
CAGGTCATTTAATGAATTAGTCTTATATAATGATTTGGTGCTAATCGTGATATGTAAAAT
TGCCATTTGTAGAACTTCCCTAACCTCTGGTAGCTACTAAGACACTGTAAAGAACTATTT
TGTAAAAAACTAAATTTTGTGGGTCTTTTTCTTAATGATTTTATGATTAAGTATTTAAAT
AGGGAGTTATCTTAAAGAACCTAAGCTTCTAGTATAGTGTTATCGGTGTCTACAATTTAC
AGACTCTTTTCTTTTTCTTTTCTTTTTTTTTATTTTTTGTGGAAGACTGGCCCTGAGCTC
ACATCTGTGTCCATCCTCCTCTATTTTTATATGTGGGATGCCTACCACAGCATGGCTTGC
TGAACGGTGCCACGTCTGCACCCGGGATCTGAACTGGCCAACCCCGGGCCGCCAAAGTGG
AACGTGCGCACTTAACCGCTGCGCCACCAGGCAGGCCCCATCAGTCTTTCTTTTCTAAGT
TATTATTTCTTGATGGCCTCCATTAACTTTTGGAGCTCACAGAGGAAAGCTAAAGAATCA
TTAATTAGGGGCCAGCCCCGTGGCTGAGTGGTTATGTTCATGCACTCTGCTGCGACGGCC
CAGGGTTTTACCGGTTCAAATCCTGGGCTGGGACACGGCACCATTCATCAGGCTACGCTG
AGGCAGCATCCCACATGCCACAACTAGAAGGACCCAAAACTAAAAATACACAGCTGTGTA
CCGGGGGGCTTTGGGAAAAAGAGGAAAAATAAAATCTTAAAAAAAAAAAGAATCATTTAT
TAGGCTCAGCTTACACACTTTTGGTCTATATGTGTCTTTTAATGTTGGTGTGGAAATCTT
ATGCTGTTTGTGCCTGATGATGAGTAGATGATGACCTCAAATAGTCTGAGCATAAAAATG
CAAAGTCAGTTGAGCCCAGTTTACTGTCCTGGTATCAGTTAATTATGAACTAAAGCATGA
GTTTTATCCTTGAATTGTTTTAGAAGAAGGAATTTTTGTCTTGTTTTCCAGTCCATCCTA
CTTCCCCTTGCCTCCCCAGAGATTACTATATTACATAGATCTGAAATAAACTCAGTAAAA
GAATGAAAGGACTATTACATTCACAGGATTTTTTTTTATTATAGTCATTTTCACAGAGCA
CAATTTATAGATGTTCACTTTGCCTTTCTGGGTTTTTCTAATTTTATAACTCAGTTGTAT
TTAATTTTGAATTTGTGTACGTTAGTTTACGTGGATTTTTTCCCCCTTTTTTCAGTGCTG
TTTTAATGGTTCAGTGGCTAAAATGTGTGTTAACAGTCCATGCATCATATCTATCCACAG
TAAGTCTTTTCATCTACAGTTGCTGAATAATTTGACTTTGATGAGGATTATAAACTGATG
GCTTAACAAAACCATCCTCTCTCCATCTTTCCTTTAGCTGTCAGCTGTTGCTTTTAGAGG
TTTTGTGTTTCTACAGATACAAGGTCATAATGTCACTGTTATTGCCTTTTATAAATAGGT
CTTTTGTCCCCTGGATAAAAGTGACATATGGTATGAGAACTTGGAGAAAAGTTATGTATT
GACGTGCTGGCCTTCATGTTTTTTCTTTATATGAACCTGTTCAGCAAAATTATCTTTAAA
TTGTATGTATCTCACCCCCTCCCCTCTTAAAAACTTAGCAGATTTTTAAAGTTTTGTGTG
TATGCTAACATGTTTGTTCTGCCTTCTCCCAGGAGGATAAAAGGTAGCTTGTGATGAAAA
TGATATAAATTAAAGCTTTACTGCCTGACATTTTGCTCGGGCTATTGTCAGCTCTTGATT
TACGTGAACAGAAGGGAGGGAGCATAAGATCTTAAAGGAGTACCAGAAAAAAACAATTTT
ATATGTCACAACATGAATTAGATTCTTTGCCACATCATTAAGTGAGTTAAATTTTAGGTT
AGAAATAAAATTATACAGTTTAATTTTTCTTTTGTTTCATTATCTAGCACCTTACAGTAG
ATTTTCTTGAAAAGTTATAGTGGATAGTTGAAAAAGTTCTTAATTGCTCTTTAAACTATA
GCTCTTCCTTACCTAACACTGTTTCACCCAGCTCCTGCCTTGTCACTGCACCTTGTTCTC
TGTCTCAGGCTTCTTTTGCCTTCAGTAGTTTGAAATAGGGAAAACTATTGGATAACTTGC
GTTGAAGTCAGCAGTTTGTTCTTTGTATGTCTGTGGAGAACTCTGCCAGCCTATTAGACT
GGGGGAAGAGACAAACAGTAAGAATGGATATGGGTTTCCCAGCTTGAAGGAGTCGTGGGA
AGTGAGTTGGGGGCAGTGGTGAGTGGAGTGGCCGAGTGGCATGATGATGGGCGTGGAAAG
ACACCATAAGCCTCAGCTGTTGGGACTGTGTCTGGTAAACAGCACAACACTCATTTTGTG
ACCTGAGTTACTTGTTTAAATGTGGAAAGAGCCCTAGGAGGCCTTGTTGTAGTGAAATCC
CTTCTGGAATCAACTCCTAAGGTGTAAGTACTGGAGTAGTAGTGTAACATTCAAAGTCAC
GGCAAACAGACTTTCAAGTTTGGGATAGGAAGGACTCCACAGCCCACAGCAATTCTCTCT
CCTCAGAAAACAGTGCTTTTCCTCTTGCCTTTCCTTTGTACCTTCCTTCCTTATCAGATA
TCTTTAAGTACCTTCTCTAGGCTAAGGACTGTGCTAGGCATGGGGCTTTGGTAATGTTCA
AGATGCTCTGATCCCCCTCCTCCTGGCACTTGTAGTCTGAATAGGGAGAAATACAAAGGA
GATGATGGGAATTGAAGTGCAATCACATTAAACTTTGTTTTATTCATTTTTGTGTCTGTT
TACTATTTAAAGTTTAACATTTGAATGAAACACTGTTATTTATGCCAAAGTGTTGGAGAT
AGAAGGGCAGGTAAAAGCTAATTAAAGGGCAAAAGAGTGAGGGTCCCTTTTTCTGTAGCT
CTGAAGGAACAAGTAAAAATTTCCTGCTTTAATTTCCTAAGCATGCTTCAGAGAATTCAT
TAACAGAATGTATGTTCAAAATACTGTAAGGTCAGCTTTATAACTGTCACTGTCCTGTTG
GTCTCTAAAAGCTGTGAAAAGCTTCCTCTAGCTTGCTGGGCTTTATAAGGTAGAGATAAT
GTGATATCATCAGAGAGTAAGTTTTGGAAGAAAAGCTCCCTTTAGCCTAGAGATATGTGG
TGGGGTTATCTTTTATTTAGTGTCTCCTGTATATTGACCTTCTCTGAAATACTGCGATCG
ATACGAAGTGCCACCCTGCAGTTTTTTCTGCCTTGCAATTTCTCCTTCTGACCTTGTATC
TTTTTTAAATGTATTGTTTTTTGCTTTGAAAGCCTCTGAAAGTTTGAGTATTGCTAGGCT
GTGTCACAACCAGCCACTGCCACTGGAAATGCAAGCAGATGCTTGTGGTGCACTGCCTAA
ATACTCAGACATAGCTGAGCATGATTTCTGTGTGTTATCTATATTGTGTCATAATGATAT
CAAATGGTCTTTTTTTCCCCTAGTTGCCTGACTTGGTACCCCAGCTGGGGACACTGTATC
AGTTAATGGAAAGCAGAGTAAAAACTTTTCAGAAACTCTCCCACCTTCATGGAAAGCTTA
TCCTTCTAATCACACAAGTAAGTAAATTGTTTTGTCCTGAAACGTTTGGATGTTATAGGA
ATGGGGGGAGGAGTGAGGATCATTTCCCTGAACTTTGAAAGCTCCCTATTACAGTAAGAA
ATTGGTAAATCAGGATCTAGTCTTTAACTTGGAAATCTTATGTATTTGACAGTAAGTAAA
CTTAGTTTGCCTATTTCAACTTTTATTCAAAGGCTCTCACCATTATATCTCAATTGTTAA
TATAGTTAGGATGGTTGTGGTACTGTGAACAAAAGTTACAGGATATTTATACAGGTAAAA
AATTTGGGCACAGAAGGAAATTCTGATTGCCTTGAAAGGTTTTTTCAACTTTTACAGAGT
AATTCTTTTCCTCTTGTATTTGACGAATATGTTTTTTGCCCTGAATTTGATCTACATTGT
ATTAACGTCATCCATTATAGTGATCGAGGGTGAGTTTTCTCTTGGGAAGAATTGGCTGTG
GTGGTGGTTGTGATGCTTGAGATTAACTTATGTTCCACTTCATAATAGCACTTTATTGTC
TTTCAGGTTACAGCATCAGAAAAAACAAAGGGAACGACTTGTCCTGCACAGAAGGCAAAA
TTGGTGTATGAAGAAGGTAAAGCTGGGGGTAGGGTAGAGTCTAGAGTTGAAACATTTAGT
TTTTCACATTGATTCTGTTCTGTTATCTTATTTGGTAAAAACATCACTGTGAAGAAGATG
ATGCTTTGGCACACCTCTAAAAAAATGGGCGAGCTTGTGCCAAAAATATGATCAAATAAG
AAAAGAGAAGTTAACAGATATAATACAATAACAAAAAAGGGCATTAGGTATGGAAGAGAT
ATAAATAGAAAAACACCGAACAAACTTTTTGCCCGTACGTTAGAAAGCCTAGATGATATA
GGTGATTTCTTAGGAAATATCAATGACGAAAATTGACTTGAAAGTAAAAAGAAGTAGAGG
AAGCCTTGAGCAAGTCAATAACTTTAAAATTGACTTAATCAACATTTTTCTTCACGAGAT
TACAGGCAGGTTCTACAGGTGAATTTTATCAGTCTTTCAAGGAAAAAGTCATTTTTGTCA
TATACAAACCATTTAGGCATTTTATGAATCAAAACCAGAGAAGGACAGTCAATAACATTT
TCAGCCATCCTCAAATATCCTGAGTATCAGCAGATTAATTATAGACATGCTTAAGGAAAA
TAATACGTCATTACCAAGTAGAATTTATTTGAAGATTGAAAGGTGATTTAGCATCAAGAA
ACCTATCAGTGTAGTCACCATATTAACAGATTAATGGGAAACACTATATATTGTCTTAAT
AGATATAGAAAAAGAATTTATAAAATTCAGTCTTCACATATCTCATTATTTTATAGTCTA
AGCAACCTAGGAATTTAAGGGAATTTCCTCAATAAATTTATATCAAACAAAGTTTAGAAG
CATTCCCATAAAGTCAGGAACAGGACAGTAATGTACTTTTCATTGCTTCTGGATATCTTG
CCTAGTACTGTATGAAAGAAATGAATTCTAAAACATTGGACTTCTAGAGTCACACCATTA
TTAATGAGATAATGCAAATAAGCAAGTTGACTGGATACCAAGATCAGCAAAAAGGAATTA
GTAGCATTATTATGTCCCAATAATGTGTTTTATGTCAACTAGTTTATATCCCAGTCAGAA
AACGTATTAGGAAAAAGATCTCATTTATAGCAGCAATCAAAACTATGAAGTACCTAGATT
ACCTAGAAATACATCTGAAAAATGAAACAAAATCTTTATAGAGAAAGTTATAAAACATAA
CTGAAGGACATAAAAGCATACCTGAATTAATTAATTAAACTTCTCGTGAAGTTTTTTCCA
GTTTGAATGAGATATAATTGACATATAACACTATATTCATTTTAGATGTACAACACAATG
ATTTGATATGTGTGTATATTTCAAAATGACCATCAAGATGTATTTCATTAACATTCATCA
CCACACATAGGTTTACATTTTTTTTTCTTGCAATGAGAACTTCTAAGATCTGCTCTCTTA
GCAGCTTTCTAAGACACTGTACCTTATTGTTAACTATGGTCACCACACTGTATACTATAT
CCCCAGGAGTCATTTATCTTATAATTGAAAGTTTGTACCCTTTGACCTTCACACATTTCC
CCCACTCCCACATCCCCCACCTCTGGCAACCACCAGTCTGTTCTGTGTATCTGTGAGTTT
GGTTTTTTAGATTGCACATGTAAGTGGAGGTCATACAGTATCTATCCTTTTCTGTCTGAC
TTATTTCACTTAGCACAGTGCCCTCAAGGTCCATCCATGTTGTCGCAAATGGTAGGATTT
CCTTTTTTTATGGCCAAGTAATATTCTATTTTGTTTAGATATACACACATTTTCTTCATC
CATTCATGTATTGATGGACACTTAGATTGTTTCCGTCTTGACTATCTTAAATAATGCCAC
GTGAACATGGGCTGCAGATAACTCTTTGAGATCCCGATTTCATTTCCTTCATTGTATATC
CAGAAGTAAAATTGGTAGATCATACAGTAATTCTATTTTTAGTTTTTTTGAGGAACCTCC
ATATTGTTTTCCATAGTGGCTGAACCAGTTTACTTTCCCACCAACAGTGCACAAGGGTTC
TCTTTTCTCCACTCTCAGCTTTGTTTTTTAAGATGAGATTTTGTTAAGAGTTTTTTGTTT
TGTTTTGTTTTTTGTTTGTTTTTTTGAGGAAGATTAGCCCTAAGCTAACATCTGCCGCCA
ATCCTCCTTTTTGCTGAGGAAGAGTGGCCCTGAGCTCACATCCGTGCCCATCTTCCTCTA
CTTTATACATGGGACGCCAACCACAGCATGGCTTGCCAAGCGGTGCCGTGTCTGCACCCG
GGATCCGAACCGGCGAACCCTGGGCCGCTGAAGTGGAACGTGCGAACTTAACCGCTGCAC
CACCAGGCTGGCCCAAGATTTTGTTAGAGTTTTATTACTTCGTCCTGCTCAATGAGATTT
TGATGGAATGATACCATAAATGTGCTTTTATGTGGATAAGAATATTGTAATTTACTTCTT
AGATGGTTGATAGCTGAATATAGTATTTCTAAAGTGAATTCAGGAATCTGATTCTGTTTA
GTTTTCAAGGCTATGCCCTCTACTTTGATCACAAAATTAAGGCTGGGCTTTTTCCAACTC
TTAACAGAATCTTCTGAAGAGGAGTCTGATGATGAAATAGCAGATAAGGATTCTGATGTG
AGTAATTTGTTTCCTGGTACATAGATCTGCCTTTAGATCCTTGTGCTTTGTAAGAATGGG
GCCTTCATGAATGCTTTCCTTGCCTTAATATTTCTACTAGGAGAATTGGGATGAGGAAGA
TGAGGAAGAGAAAGAAAGCATAAAAGATGAGGATGTTGACGAAGAGAATGAAGAGGAAGA
TGAGGATACTGAAGAAAAAGATGAAGAAAATGGTGAGGACCGAGATGTGGCAAGTGAAAA
AGAATTAAATGGAGATTCTGATTTAGATCCTGAAAATGAAAGTGAAGAAGAATGAAGATA
GAAAAACAAGCCAGTTGAACTGTATAAACTCTGGCTCTCCTTACCCAGGGCTACCGAGTT
CTCCTAGGGAGGGTTATCTCTGTGACAGGTTGCCAAGGACCGTTGCACATTTCCAGATTT
CTAATGGTGGCCCCTCGTACCACCTTGCTGTCCTGAGCACCCCAGACTTAACTGTGTAAA
TAAGAGTGTTTCATTCAAATGTTAATAAACTTTACACAGTAAATAGATACATTTTCTGCT
ATGTACTGACATGTGTCCAATATATGGTATATTTTTATAATTCCCTAGTATGATTGGTTA
TACCAAGAATTGACAAAAGTGAAGATAAAGACATTTCCCATTTAGGGATTCAAGAACTGG
ACTTTTGTGAAGGAGTCAGCTTTTATCTCAGGTTGGTATCTTTCATCAAATCTAGATGTA
AAACAGCACTAGTGAAAAAAATTTTTAATTTGGTACATTTGATTTGGTACATTTTCATAA
AATATAAAGGGGTAACTAAAAACTGGAGTAAAATGATTGTGATTAAAAAAATAAAATCAC
CAGTATCCCTAGCTTGTCTGTTAACTGTGGTGGTCTGATTTGAGTCAGATTGAGTATTTG
GAGTGCTTGCCAAAAACAACCACTTATTTTTTAAGCTGTCATTTGAAATATTTTTTTAAA
ACACAAGAAATTATGGTAATTAAAAAACTAAAGAATTAGCCATATTAAGGATTTTTCTTG
ACTTCTGGTTGCCTGTAAAGAATCATCAGTGTATAGATTTAGAAGTGCTCATTACCTACA
ACTTTTAAAAAAATTCAGTTATAGCTGCTTTTGAAGAGGTGTTCATTTTTATTTAAATTA
CTAATGGATCAAAGAACAATTGTTTATTTTTTCTCTTTGGTTTTAGATATTAATGATAAC
CTCGTTGGAGTTTTTTTCCAAAGAAAATATTTTTATAATTCAGTAATTTAATGTGTTCCT
TCTTTGTCATTACCCACCCTTGGCAGTGTTAGGGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1173, 8237..8374, 12335..12456, 17818..17938, 18712..18851, 23859..23961, 24477..24541, 27165..27336, 29019..29105, 30056..30187, 31705..31836, 37661..37747, 39318..39349, 40855..40918, 43103..43216, 43746..43815, 46387..46436, 46540..46734
8267..8374, 12335..12456, 17818..17938, 18712..18851, 23859..23961, 24477..24541, 27165..27336, 29019..29105, 30056..30187, 31705..31836, 37661..37747, 39318..39349, 40855..40918, 43103..43216, 43746..43815, 46387..46436, 46540..46731
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved