Equus_caballus Locus PTCD3
snOPY snoRNA Orthological Gene Database
Equus_caballus PTCD3
Equus_caballus
PTCD3
15
SNORD94
29680..29816
32212
AGTACTTGTCACAGAAATAGAAGAGCCCTCTTGATTTAGTAACTAGGCAGGGAATACAG
AGGAGTCCTAGCATAGAGTTGTCCCCTGAACTGAGTCTTAAAGGATGGTCACTTTACAGA
GAAGAGGAGACTAATTACGTGCTTAATTGACCGCGTCAGAGACATTACAGTAACTCCACA
AACGCTGGTTAATTAACGAGGCGACTGGAGGACGATAACGCGGCAATACGGGAACCCCCG
CCTCCCCAGCGCAAACGCTTTCGCAGCCCCTTCGGGTTCTAGGCAATGCACGCGAACGCA
AGACGTTCCTCCCGGAACTACGGGTCCCAGCAGGCCGCGCGCCGCACAACCAGAGACTCA
GAGGATAAACCGGGCCCAAGACCTTTCGGGAACAGTAGTTTATGGCGCAGACCTCAGGAG
ACAAACTGCACGCTCCCCACCAACTCCTTACTTGAGCTCTTCAGCCGAATACATCCCAAA
TGAAATGCCCTGCAGCCGCCGCCAGGGCATGTTCTTTGAGCCCAACATCCTCCGTTAGTC
TTGAGTTCAGAGACCCAAAGAGAAGCGCCAGTCAGCACTAGTAAAGCCTTAACACAACCT
CATCCTCGCAACCACCATGTGATTTTAAATTGCGCTTGCGCGCGAGAAATGCTCGCGGGA
ATGAGATTTACGTGGATGAGATCACCTCTCCTCTGGGGGGGGAGGAAAATAATTTCACGA
CTCTCACTCGCCCTTTTATTTTGAAAACAACCGAAGATATATAATACATTATACTAATCG
TTTTACAAAATTTATTCGAGGCAAATGAGGTGTATGGAGCCTTTAACTTCCGTAACAAAG
TCTTTCAAACCATGAGCTTCTTACCTCCTACTTTATTGCTTTTATCATGTTCCGTCTCAG
CCAATAGCGGGAGCTATTCCCCGCCCACCTCCCCCCCCTTCCCTTGGCGACCCGGAAGGT
CGAGTCGTGCTTTCCCAACGTGCTGTGCGAAGAGAGCAAAGATGGCAGCGGCAGCGTCGG
CTCGTTGGCTGAGGATCCGCTGCAGGCTTTGCTTGCCGCTGAAGAGTCGGAGGGCAGATC
CATGTGAACAGGCCCCCCAGTTGCAGGTAATAGAAGCTTGGGGAATCGACGCTGGGAAAG
AAGACCCAGGGTCAACTTAGTTCTATGTATCCCTTTCTCTCGAGAGCTGTGCAGCTAGGT
ACGGACGGAGTGGAATGCGCATGTGCGCTCTCGCGGCCCTCGTGTTCAGAAAACCGGGCG
CGCGAAACCCGCGTCCTTGAAAAAGGGACCCAAAGGCGTTTATTGGGAAGATATTTATTG
GTTGGCTCGCGTATCCAGGAGTTAGAACTGGTGGCAAGACTAGAATCCTGCTCTCGTGGA
GCCAGCATTCTAGTTAGTGTGACTATTAGCAATTTCATCCCAGATTTTTAAAGAAGAAAA
TTATTTGCCCTCGCTTGTTTTCACTCAGCCGGGAGGAGCGTAGAGAACTCAGAACATTTT
CCCAAACTGAAGGCAGTTTATGAGCGCCACTGTGTGCTGGATATTGTGGGGATGTTTGGC
CTGAGATATTATCCAGGTGTTCATAAAACCGGCAAGTTTAAAAGATCTGAACACGCCTTA
TGGATTGCTGTGATTGTTACAGCTTGGAAACGTATCATTTGTGTAGTTACTTTCACTCTG
TGCGAACACTGGTGTTGTGGGAACATGAGAGGCAGTAATTTGTAGTTAAAAGTTGAGAAA
AACCTAATTTTAGATTCGATGTTTGCCATTTCCTTAGTCGGATGATAGCAAACAAAATTT
CCTCATTTGTAGACTGGAGTTAGTAATAACCGTCTGAAAAACTGAGGAATAAGTGAGATG
CTTAACTTACAGTATACATTTTATATGTAATACTCTCAGGTCTCCTCAAAAAAGAAAAAC
GCTCCACCTGGTACTGCAGAAGCCTCAATGCTGCTGTTCAATCCCGTCCTTTTCCCAGTA
GTGCCCAGTGTTGACATTTTTCTGCCCATTTCTTTTGCCTGTCAGCAGCACCTCCCTCAC
CATTCACCCACAAGACGAAAGTGGTCTGTCCCCCCTAACGTCGTGAGAAGGAAATAGCGT
GATTTGAAAGAATTGATCCCTTCCTGAAGTTGATCCCTAGCAGAGAAATAGTATTTTGAA
ATGGTGCCTGAGACCAGATACCAGTAGAGGAAGTAATTTTCTCCCTAATCATATCCTGAC
AATTTTGTGAATGGTACCAATGCCGCTTAGGAAAGAAATACACAACCTAATGATACATAT
TATCTGTATGGTATGTGGACTGTGTTTTTAGTATGATCAGAACATTTTAAGACTCAGTCA
TGGATCAGTGATTTTATATTTTGGGAAAAAACAGTAGTAGTTCCAAGTTTAAATTAGGAC
GTATGTACCTGGCACATTCCTGATTGTTGATGGAAGTGTGATAAAAGCCCTTAGCTTCAT
AATTTGTCATAAATGGGTTAGTCTTTTATTGTCATTAGAGCATTTTCCACATGAAATCGA
GAACTTGTTAAATTGTCCCTCTTAATCTCTATGTTTTAGGTTCCCAAAGTTGAAAGTCCC
TTTTATTACAAATCAGCTGCTCAAATTGTTCAAGTGCTATTAAAATTTTCCTTTTTTTCC
CTTAATTTTGTTTAGGAAGATTGCCTGATTTAAAAGTTTTTGACCATGTTGTGTCAGTAT
CATGTATCTATTTTATAATGGTTTTGAATTTGTTCTTGAGGCCATGAATTCTTAGTGTAC
ATTGAGATGAATTGTCCAGTCAGTTCGGTCCTAGATAATTGGAAAATTTGGGCTCAGGAT
GCACATAGGTGGAGGTGAGGTGGGAGCTTCACTAAGAATATTAGCTTTAGGGCTTTTATT
TTTTGCAGATTTTATTCTGAAAGTGCAGCCCTCCCAAACGTTGAAGGAGCTGATGTAACA
GGTATGTAAAAATACGTTGAATATAATTCCATTTTTGTATTAACACATTGTGCTTTTTTG
TAGTAGTAGTATTGGGAAACTGATTCACTTTGTTTTATTTTTCACATTAAGGGATTGAAG
AAGTGATCATTCCAAAAAGGAAAACTTGGTGAGTAATCAATCAGTGTTCAATCAGTAAGT
GGTTGAGCACTGATTATGAGTGAAACATTGCTAGGTAAGGAGCCAGTGATAGATAGAGCA
ATGGGAGAGCCTTCTTGGGGAGGGAACAGCTGAGGGGAGAAAAGCTTGGGAGTTTAAAAG
AACATAAAAGAGGAAGGTAGAGAGTAATGAGTGAACAGGGCCGTGAGATTTACTGACGAG
TTGAAAGATCTGCACTAAGTTTTAGTTGATAGTTAGATAACAATGGTTAATCGTGAGCAT
CATAATTAGAATAATTTCTTTTTTTAAAAAGTTCTTACATGGTCGGGAGACTGATTATCT
TTATGGTTTAATGAGGTAAAATAAAATAGTGTGGACTGCAAAATTTAGTTTGGTGTGTGG
TTGTTTTTGGCTGAGGAAGATTAGCTCTGAGCTAACATCTGTGACAGTCTTCCTGCATTT
TATATGTGGGTTACGGCCATAGCATGGCTGACGAGTGGTGTAGGTCTGGGCCTGGGATCC
GAACATGCAAACCTAGGCTGCCGAAGCAGAGCATGCCAGACTTAACCGTCACACCATGGG
GCTGGCCCCTGGAATTTCGTTTTTTAACTCACTGGATAGATCCTTGAACAAATTGCCTTA
TTTATTCAACATTTGTTGACTATATAAGAAGTAAAACTTCACAAAATTTGTTACAGTGCT
ATTATTGAATACATTTGAAGGCCCCTCAAACAGCCAAGTCTTTTCTAAGTATGCCCTGAA
GGCTCAAGTTGATTTTTTTTTAAAAAAACTTTCTTAAATTACAAAAGTAATTACTAGTTA
TTGCCAAAAGGAGGGTGAGCTAAATTGAACACGCAAAAAGGAAACAAATTATCAGCAATC
ACACTACTCAAGCAGGTTACTTACTTTGTCTGTGCCATAGTAAAATGTGGATAATGATAG
TACCTACCTCAAAGGATTAAATGAACATTTGAACAGTGCCTACCACGCACTCAGATCTCA
GTAGATGATAGTATCTTAAAGTTCTGGGGAATAATTTTTTGTACAAATTATACATTTGGT
TTAATAGAATTGATTTGTCAGATGTATAGCTGTATGCTCTACTTTTAGTTTTTAGTGACT
ACGTAGTATTTTGTTATATATGGATATATTCAGGTTCATTTCTGTCTTCCCTGACCTAAC
AGAGAATCAGAACCAAGATAAGAGTAGGAATATGCATATCCATGAATGAGGCATTTTCCT
GAATGGCATTCAAGTCCAGAGCACTTTACCAACCCATTGTGCCTCTATCCCTGAGGAAGG
TGCTACAGGGAATACAAAAGAAGCAGCATTTGGAGGGTGTGCTTAGATGGCTTAAGATCT
AGCTGAGTCGTCTGCTTGTTTTATACTTTGTATTTTATACTTTATACCTAATATTGCATA
TGCACCTAACCTTGTACAAATGACTGGAAGCAGCACAGGATGTGATGTAATCAAGAGCAG
TTGTATTTCGCTGATCAAGTTGAGTTCTATGGAGAAGGTAGGAATTTACTGGTACCTTAA
TTGGGTAAGATGATTCTATTGGCATCAGAATCACCTGGGAATTTTGTTTAAACTGCGTAT
TCCTGCAGGTAATTCTTGTGAACCCTAAAGTGTGAGACCTAGAGATAAAGAGAACACTAA
GGGAGAGTGGGACATGATCGTGATATATCTGGTGGTACGAGGAGGCCAAGCAGGCAGGCC
TATGAAAAGTGCTCTGTGAGAACAGGAGAAATAAGGTAGTTGATAAAGAGCATTGGTCAG
CAAACTGAGACCTATTTATTTATAGCCCATGAGCAAAGAATGGTTTTTAGATTTTTTATA
GCTGAAAAAAGTCAAAAGATTTATTTTATGACACATGAAAATTATATGAATAATTCAGAT
TTCAGTGTCAGCCAAAATTTTATTGGAACACAGCCTCACACATTTGTTAACTATTGTCTG
TGGCTACTTTTGTGCTACATTGGTAGAACTGAGTAGTTGCAACAGCATCCTATGGCGCAT
AAAGCCCAAAATATTTACTATCTGTTTCTTTACAGGAAAAGTGATGATTTCTAGCCTCAG
GAATTTATGTTTTTAGACCAGGAAGAAGCCATAGGCAGAGCAGGGAGCCCAATTATAACC
AATACATATATGGATAGATATATAATCAACACATAGATAACTGGGCTCATAAAATAAATG
GATATTAAAACTTATCACATTGTCAGGGAGAGGATGTGGAGAAATGAGTGCCCAAATGCA
TTCATTGATAGGGCAGTCACTTGGAGCAACACTTTGCGTGGAGATTTGACAGAATCACTG
TTTAAAATGTGCGTACCTTACTGGTTAGCCATTCTGGAGTAACATTTGCATATATACCCA
AAGAGACATGGTTAAGAATGTTCTTTATAATTTGAGAATAACAAGTTTGAAACAGCCTAA
ATGCCCATAGATAAATTAGTGGATAGTAAGCAATGGTTATGATGCAGTACAACGTTTAAA
GGAATTAATTAGGTGTGGATATAGTAACATGGATAATACCAACTTAGATGAGCACATATA
CAGAATGACAGTATATGTTTTTTATGGCCGGTACGTGTATGTGAAAGTACCTTAAAAAGT
TGTGGATGGGGCCAGCCCCGTGGCCCAGTGGTTAAGTTCACACACTCCACTTTGACGGCC
CAGGGTTTCACTGGTTCAAATCCTGGGTGTGGACATGACACCGCTTGTCAGGCCGTGCTG
GGGCGGCATCCCACATGCCACAACTACAAGGACCCACAACTAAAAATATACAACTGTGTA
CCCAGGGAGCTTTGGGGATAAAAAAGAAAAATAAAATCTTTTAAAAAAAAAAAAAGTTGT
GGCAGTATAAACAAACTCACAGTGGAGTAGGAGGGGGTCACAAGATGACACCAGACACTT
TAGTATAACCTCTAGTATTCTAATTTATCCTTAAAAAAATAATGTATTCGTTGAAATTGG
TTTTAAAAATAACCCTTAGAAAAAGAGAGCTGGTGAGTAATCTGTCATAGTTTCTTCACT
GATGTTTGTTCAGTTTGTTATGAAGATGTGCTCACTTGATAAGACTTAAGTATGCTAACG
TAAGGTGTAGTTAGGGAATGCTGAGATGAATTTCTTTGTTTCTCTTGCTGAAATTACATA
AATGTGACTTTAAAAAATGATAGAAGGGGCCGGCCCTGTGGCCAGGTGGTTAAGTTCACA
CACTCCACTTTGGCAGCCCAGGGTTTCACCAGTTTGGATTCTGGGCACGGAGCTGGCACC
GCTTGTCAAGCCATGCGGGGCCGCATCACACAAAACAGAGCCAGAAGGACCTACAACTAG
AATATACAACTGTGTACTGGGGGCCTTTGGGGCGAAGAAGGAAAAAAAAGAAGATTGGCA
ACAGATGTTCAGTCAGGTGCCAATCTTTTAAAAAAATGATAGAAAGTCCAGGGGATATTA
TATATATCAGGGAGTTACTCAGTCTTGGTATAATACAAAATTTCCTGTATGTTCTTTTGT
CTTTTTCAGATGGTGTGTATTCTTCTAGATGTTATGTTAAACTTTGTTTAGAAAAATACT
TTGGGTTTATTAAATTTTCTCTTATTTCCCTTTTCACAATGAAACACCTAAAGTCTAACA
CAGGAATAAAAAATATATTTGAGACCAAATCATCCTGTTTGTCAATTATTCCAAAGAAAC
TCCCTTTTCCAGTAGTTCAGTAAAGGTCTCTACCCATAGGCACAGTGGACAGCTGGCCTG
AAATTCTTAGAAAGGTTATAAGATTGAGAGGTTCTAAACCAGGAAGGTGTGTCAGAATCC
TCTGGGAATTTAGTAAAATTGCATGTGACAGTTCTGCCTGGAACTCGGAGGTTCTGATTC
AATAAGTTCAGAGTGCAGCTTGTCATTTATTCTCATATATAGCTGAATTAAGAGCCACTA
ATTTAGATAATAAAGGCAAGACTGGTCCAGAAACTGCAGTAAGAATGGGTAGGAAAATAG
GAGGAGGTAAGATTCAGGACAGATAGAGTTTAAGAGATGAGCGTGGAAACTGCTAGCTCT
GGGTGATGGTGTTAGGGACCAGGCCAGAGGAGGTAGGCAAAGCGTAGCAGGAACACGTGC
TAACGACCTTTAGGCAAGAGAACTAGACGGTTTTCTCATTCTCTAACTTGTTATTCTGGT
GATCTTGAGACATAAGAACTGGCTTTAGTTGAGACTTGGACTTTTTATCGGCCAGTCCAT
TCTGAGAGTAGAATCACGTGTTCACTTTTTGGGAATGAAAAGCCCTGATGAGGGTTAACT
TGTGATTCTCCTTCTTAGGGATAAAGTGGCTGTTCTTCAGGCACTTGCATCCACAGTAAA
CAGGGTAAGTAGGAATTTTAGGCTTTTTAATCTAACTCAGCTAATAATACGTTTAATGTT
CATAGCTCTTCATCATTCATAAGTTAACTGTTGTGGATCCAGAAACTTTCTTAGAAGTTA
TCTAATCCAGTCCCTTCTTGTGACAAATGAAGAAACTAAAGCTTTTAAAGTAACCAGTTT
GGGGCTGGTTAAGATGTTAAAGCCTTAGTTGTCTTTTGTCTCCAAGTTCAGTGTTTTGAG
ACTGTATCAGTGATTTTTAAGCTTAGTCACCTGAAGAGCTTGTTGAAATGCATGTTCCTG
GGGATGGTTTGGGTGTGATACTATAATGCAAATGATCCATAAACCAGTGTTGAAAAATAG
TATACCTACCATGCTTTAAATAATGCAGTGGTTAAGAGTGTGGGTCCTGGAGCCAGAAGT
TTTGTATCATAGTGAGCAACTAGCTTTGTGATCCTTATCACAAAGGTGCTTTATCTCCTG
ATGTTTGTGTTACCTTATATATAAAATGGGGATTAATTACAAAACCAAACCTCAAGATTT
GATGAGAATTACATATTTAGTACGTGTGAAAGAATTTAGGACAGTGCCTAGCACAAAGGA
AACGCTCAGTAAATGCTAGTAGCTATTTTACTGCTACAACTAGGTTAGTGATTTATTTGT
CAATAATTTGTTCTGTTGGCAATTCAAGAATAGAGTTTGTAGCCTGATAGGTAAACTGAA
ACCTTGGTAAATGGTAAATCCCTCAGAAATGGAACTTTCTGGTTGATTGTATTTTTCATT
AGCTGGAAACTATACTATACCTTTAATTTCAACTGTGGGGAAAATGTCTAAAAAAGTGCT
TGCTTTTGCCACAACGTCTGTGTGGATCCTGATTCTCTTTAAGGCCATTATCACAGATTT
CCAGAATTATTCTTCTGTTGTAAATGTTAAACTTGAGTCGTCTTGGGCCAAATATTAATA
TACCCTAGCAGTTTCTGAGGAAAGGTTTTAAAATACTGCATCTCCACACTACCAAGACAT
TGAGATTTTCAGCAGGTCAGTTATCCATAAATAGGCACCTGAAATGTAAACTAGAGAAAT
GGGCTTCTGAGATTGTTCTCAGTTTTTCAATGAGAATGGCCCAGGGTTCACCTTGTTGTA
GAATTCTGTGTACAATTGTCTGACTTGTCTGGGTTTGGGCCCTTAAAATCCAAGGGATAG
TCATTTATTCATTCAGTAACCACATATTCTACACTGAGGATGCGTACCAGGGACTGCGCT
GCATGTAGAATAAAGACACAGTTGTTGCATAGTTCCTAGAGAGGGAGACTGAAGAAGCGC
TGAGAAGAGGGTACATAACCTGGACTGAGAAAGGACTTCCAGAAGAGCTTGTAATTGGAT
TGATGCTTGTAAGGTGAGAAGCAAGGATACTATAGTGGAGAAGAACTTTCCTGGGAGAAG
CACACAGGCACAGAATGAGTAGTTTGTTTGGTAGGAATCAAGGATTTGAGGGGTAGAGAA
ATGAAAGATGGGGCAATATCATAAATGCTATGCCAGGGACTTGCTTCTTGTCCAAGTTCC
TTGAAGAATTCTAAGCAGTGGTGTGACCTAATCAGACAAGTTTTAGAAAAGACAGCAATA
TGGAAGTGGGAAACCTTTCTGCTTGGATGTATGATAAAGATCTTAAAATTAACATGTCCA
AAAGCAAACCCCCTTCCCTCTAAACCTCCTCATGTATTTCTTTGCTATCCTTCTAGTTGC
TCAGGCCAAAATCCTGGGAGTCATCTTTGACTCCTCTTTCTCTCATGCTGCACATTAATA
AATTCTTTGTTTTCTTCCATCAAAATATATGTGCATGGAGTCTCCAGGACCACTCCCAGG
TCCAGCGATTTGCTAGGACAACTCACAGGACTCAGCATATAGTCATACAGCTATGGTTTA
TTACAGAGAAAGGACACAAAACAAAGTCAGCAAAGGGAAAAGGCACATCGGGCAGAGTCT
GGAGGAAACCGGGAAAAAGCTTCCAGCAGTCTTTTTCCCAGTCAGTCACACAGGACATGC
TTAACTCCTCCAGCAGAGTTGTGACAACATGTCTGAAATGTCTGCAGAGAAAGCTCATTA
GAGACTCAGTGCCCAGAGATTTTTATTGGAGTCTGGTCACATAGGCACCCTCTGCCTGGC
ACATACCAAACTTCCAGACTCCTAGCAAGAAAGCAGATAATCAGCATAAACCACCTTGTA
TAAATAGTTTAGGCACAGGGAGCCATTCTTATCAGTACTGGGAATGGTGGGAACCCTCCT
GAAAGCCAAGTTCCCAGATGCCAGCCAAGGGTCAGCCTTGCAAACAAGCCTTTCTAAGGA
TAGCAGTTTCAGGCCTGGTAACTCTTTTCTACACAATCTCCAGAGTCTGAACACTTGTCG
TCATCACCATGATCACCTTGGTCATCTAGGCCACCACCGTCTCTTACTTCCTCGATTAAT
CACAGTAGTCTCTGTCCCCTCTACTTCTTCAGCACCCTACAGACTGGTCTCCAGTAAGCA
GCTCTAGTGACCCTGCTAGAACGTTGGATCACATCACTCTTCTGCTCAGAACTCAAGACT
GCTTCTCATTTGTTGTAATTGGAGTAAAAACTGAAGTCCATCTGTGGGCCCGTAAGGCCC
CAGGTGATCCACCCCCCTCCCCCCATTACTTCTCTGACTGCCCCTCCTGCTGTCTTCCTT
GCTCACCCTGCTCTAGCCGCGTGCCTCCCGGCTGATGCTCAGTTTCTCAGCAGGCTCGCA
TCTGCCTCAGGGCTTTCGTGTTTGCTCTTCCTTCTGTCTGGAATAGTTTCTGTGAGATGT
CCACGTAACTTGCTCCCTCCGCGTTTTAGGTCTCTAATTAAATACCACCTTTTCTTTGAG
GCCTTCCCTGACCACCTGATTTAGAACTGTATATATCTTTTTCTGATGTTTTCTTCTTAT
CCTCTCTCTAGTTCATTTTCCTGCATAGCAGTTATCTCCTTTTAATTTACTATATACATA
ATTTTGTTTGTTTTGTGGAGTTCTTTTTTTCCCTACTAGATTGTAAGCTAAGGGTGGGAT
TTTGTTGTCTCCCTGGTAGCTAGAATAATGGTTGGTACATATGAGGTACTCATTAAATAC
TGAATGAATGAATAAGGAACATACTAACTAAGGCAGTGGCAATTGGGGTAAGGGACAGTG
GAGTAGGTAGGGAATGTTAAGCTGGACCTGATGACAGATTAGTTAAGTGGAAGTGATGGG
AGAGGATCTTTGGGTTGGACTGCTGAGTGGTCAGTACCGTTCACTGCGTTAGAGAAGATA
GGAGAGAGAGTAGCTATCAGGGAAGTTCAGTTTGGGTGTAAATTTGGTTTGAGGTGTCTG
AGCTACAGGGCCAGAGTGGAGTTGTTTCTCAGACCATAAAGGATTTGGAAGTCGCTGAGG
GAGGAAAATTGGGAGACAAATAGGAAGAATAAGTCTAGTAAGTTAAAACAAGTCCAGCAT
GCACCACGCTAGAGGCCCTAAACAGGTATGTGTTTATAATAAGGTGGTGCAGAGCATCAG
CCCTGGAGCCAGGCCACAGTTTGAGTGTAATCGGAGCGTAGTGCAGGGCAGCTAACCTAG
AACTGCTCCCCCTGGTGCCTCGTCTTGGTAGAGAGGTGTGAACAGATGAAGTGAGCCTCA
GATGAGGAAGGTGAAGGGACGTGGGATTTGAAAGTGGCAGTAGGAAGTCAGGCCCCCCAC
CCCCACCCCCCCAAATACTGCCTCTGGGTCCTAGGTTTGAGCGACCTTCCCTCAGAGCCA
CAGGGAAGTCTCTACCCTGGTCAATAAGATGAGGCGTCAAGGGAGAGTCAGAAGAGATTC
AGGATATAGGGGGAGTTTTTCCTATGGAACAGAGGTCTGAGGAAGCCCAGGAAAGGGGGC
TCCAAGGTAGAGGAGAGGAGTAGAGGAAGTAATTTGGGGACAGTTTTGAGTGAGTCTCCG
GTGGTGCTGGAGAGTTGATTTTGCTTAGGGTTCTACCTAGAAAGTTTAAAGAAGTGTAGA
ACCTTGGACAACAGGACACAAGAAGCTGCTGCTCTTCCCACCTCCTGAGAGGGCCCAGTA
GTATGCTCCGTTTGGGGGAGGGGCTCTTGGGTAGCANNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNAACAGCAATCAGTCCCTGGTGATAGCAGGCTTAAATCTTAAGAA
GCAGTCATGGGAGCTTGAGCGTTTGTTTGCTTTAAGTTGTGCATAGTTATACCCTAGTCT
TACAGAGCCGAGAGTATAGTACAGGTATCAGTGTCTGTCTGTCTGTCTCTACACACACAC
ACACACACACAAATGTACGTATGTACATATTTCTGCATATGTGTTACATGTGTAATTAAA
ACTTATTTAACAGAATTTTGGGTCATCACCAAAACTCACAAGGTCCTCTTATTAAAAATC
TGGCTAAAGATGGGGCCGGCCCAGTAGTGTAGTGGTTAAGTTCATGTGTTCTGCCTCAGC
AGCCGTGGGTTCATGGGTTTAGATCCAGGATGCGGACCTACACACCTCTCATCAAGCCAT
GCAGTGGAGGCATCCCAGATAGAAAATAGAGGAAGATGGACACAGATGTTAGCTCAGGGC
CAATCTTCCTCACCAAAAAAACCCCAAAAAAACAAAAAATCTAGCTAAAGAGACTTCTGT
GTCTTTACAGGATACCACAGCTGCCCCTTACGCATTTCAAGATGATCCTTATCTCATACC
AGCATCTTCTCTGGAATCTGTGAGTATTTTCATGTAACTTTTCTAATATTATGTTTTTTC
TTCCTGGTTTGGGTACAAGAGTGCGTATATAATTTAACTTAGTTGTAAAAATCTTTGGAA
AGTTTACAGATGCTGATAGATAAATTGGTGGATTTCCTGAATCTTTTATTACTTTTATTA
AAAAGTTTTATAGATTGGCTATGGAAAGGTTTTGGTGTTTAATACTTAGGGCACATTCAC
ACTGGAGCAGTCCACTCAATTTAAATGTATTGTTTTTGTATACCTCAAGCTGTATACAAG
ATGTGACCTGAAATATGACACACACAGTAGCAGAGATGGATATATAATATTATGTAATTT
AATTTCTAGTTGGATTTCTGTGTATTGTTGCATTCTTTTTTTTAGGGGAAAGAATGCTAA
TTCTTGCTGAGGGTGTAACTGCTCTCTGGAGTCTAAATTACATGTAAATACCAATTTATG
TATAAATCTTTTTCTTTGTATAGCGTTCATTTTTGTTGGCAAAGAAGTCTGGGGAGAATG
CAGCCAAGTTTATTATTAATTCACATCCCAAATATTTTCAGAAGGACATAGCTGAACCTC
ATATACCGGTAAGGAGAGGTAATCGTGATTTTTAGATAATGCTGTATACAAATATAAACT
AAACCAAGCTTTCATGGCTAACATTTGAATGCCCTCAATATTTGGGTGAAAAGTCTTTTG
ATGTATGTAGTTATCTTTGCTCACAACGCAAACCTTTTTTTTTTTTAAACTCATGGTTTT
GCTCTTTATCTTATTTTTCCCATTTCGCTTCTGTGGCACCAGACTCTTGGATCTTTACCT
CTGACTATTCCTTTTCAGTAGCTTTTCTCTCAACTCCTTAAGTGTTGGTGTCTTTCTTAG
GTTTCCATGCTCAGTCGTTCTCTCTTTTTTCCTGTCTACACTCCTGCTTCCACGACCCTA
TCCTGCTTTTGGCAGTCTGGGATATCTGGCCTAGAGCCCTCTACTTTGAACACTAGTACT
CTGGTTTCTCTTTAGATTGTGTAAATCTTTCACCTTAACTTTGAACTCCAAATTGGATTT
CCACCTGCCTCTCTGTTCCACAGTCATGAAGAGGATTTGTGCAGTGCCTGCTGTGTGTTA
GGCATTGTGCTTAGTGCTGTCAGTACCGTGGTAAACAATAGAGACGTGCCTCTGCCCTCC
TGAGTTCATTAGTGGAAATAGTAACCTCAGACTTGCCATGTCCAAGATTACTCCCTCTCA
TATCTTCTTCCTTCCCAAAACACAGCCTTCCTGCTTCTCAAGTGGCAAATCAGGAATCCA
GTGCAATTGTGTAGGTAAAAATATTGAAATCCTGAACTCAGCCAGTGGCAGTGATGGAAT
GTCATTTGCTAGCCCCCTGTTTCCCCTTCATGTTTTTGACTAACAGTGACTCTTCTGGGC
TTAGTTCACTTTTGCTTGAAGCCTTCCATGGGTCCCCTGCCTCCATGGCGGCAGCAGTCT
CACACCTCTGAGATCTCCTACGTCATTTACCATTCACACTGTGTCATAATTGTTTCCCTC
CTTTATTAGACTGTAAGCACCTTGAAGGTAGAAAGTGACTTTCATCCCTACATGCCCAAT
GCCTCGCTTCGTGCCTGGCGTACAGTAATAAGTGTTCAATGAGTATATGAATTAGTGAGT
GAGGTAAAATGTACATACCTTGGTGGTAGTAAATGTTTAGAGTAAAAGCAGCATCAAAGA
TGAAAGGTTTCTGCCTTTGGAAACCAGTTGTATGCTGACACTTTTAACCAAGATTGGGAG
GAAAAGAGCGAGGGTGGTTTTATGAGGGGAAAATATAGTAAGTTCAACTAGAAATTGGGA
GGGTTAGTTGGAAATAGGATTCTTCAGATATGGATTAAATATTTACATTTGGGTGCTTTT
AAATTCTTCTCTCCAAGCTGAGATAGCTAAACGATCTTGTCTTGTAGACTCTCGAGGTTT
TTTGGTAGATATTTTTTAAGTTGTATTTCCTACAAAGAAATTCATGTTAAAATGATAAAT
AGTATCTGGTGCATGAAACATGGAATGGAACGGTGAAGTTTTATTTTGGTTTATTGGTGA
TAAAAGTTTTGTCCTGCCAGTTAGCATTTTGCCGTTACCTGTTTGTAGTAACTTTAACCA
TCTTGTTTTCCTAGTGTTTAATGCCTGAGTACTTTGAACCTCAGATTGAAGATATAAGCG
AAGCTGCTCTAAAGGAACGAATTAAGCTCAGAAAAGTCAAAGCTTCGGTGGACATGTTTG
ATCAACTCTTGCAAGCAGGTGACTAAGTTCATTTAAAGCACCCCAGGGACGGAGGCCCGG
AAGTGGGCCACAGTTAGATGGTCCCACTAGTCATGAGTAAAAGTTAACAGGCATTACTGC
ACTTACTCTGCTTGATAGCTGCATTTATATTTCTAACAGCTTAATAAATAATATTTCAAT
TTCTGCTTTGGCTTCATTTTAAAATTATAGGGGAGATAGAGTTGCACCTTTGTTAAGATA
TTGTCCTCTTGTGCTGCATCACAGGTAGAGAACTTACATAGCCATTCTTCCTTAGCTTCC
ATTTTTAACATTAGGTGTGTACCTATTGTATTCAGATTTCCTGTGCTCCTTAAGTATGTT
TGGAAGGTGTAAAACAGGAAAGAAGAAATCTTTAAAAAGGAAAGAGCATTAAATGTGGGA
TCAAAGGCTTGGATACTGGTTCTAGTTCTGGCACTAATTAGCTCTGTGGCCTTGAAAAAG
GCACCTAATTCCTCAGAGCTTCTGTCTCTAAAATCCTGTAGCTGTCCAAATTTGATCTGG
GTAAACCTCCGGGGTATAGATCTAGATTGCATGACTTGTAAGCTACCATGAGAATGTACC
TATAGTAACATGAAGGGCAGCGGCATTATTTAAGTTTGTGGGATCTGGAGTGCTGCTCAG
TGACTTAGGATAAAAATCAACCAAACATACAAGAGATAGAAACTGGACTCAATCACTCAA
TACAGTGTTGAACACAAGAAGAAACCATTGCAGGAACCTGGTTTTGATGTGAAAATTTTG
GTGTGTAGCCTGTTATAGCATTGGATGTACAAATGAATTGCTGACAGATTATAATTTAGG
AAGGCTTTTCCCTCTGCTTGTTGAATTTGATAAAATCTGGTGTAAGTTTTCATTAAAGTT
CTTAGTGCTAAGACTTGTTTTCCTCTGTTTTACACACTGTGTGGTGTAGGTGCATGCAGA
CATTCAGGAAATATTTTTAAAGACAGCATGTCAGACCCATAGCTCGGAGTAGCAGAATGA
GCCAGCGCTCCAGAGGAGGGATCATAGGAAATTTTACTATCAAGCCCCTAATAAGTGCCA
AACACTTTGCTAGGCATTTAATCTACAATACCTTTTGAGTTGTTGTGTTTACAGTCATTT
TATAAAGGAAACTAATAAGTAATTTTTCAGGGTCACACAGTTCTGGGATGGGAAGACCCA
ATCAAATTATACTCTTATCGCCTGTGTCCTCTCCACTCTGCCCTGCTCTTTTCTGGGCTT
TTAAATTTCCTGATGAGTATTTTTATTATTGGTATATTTTCTTTAGAAAAATGCCGTTAC
TTTAAAACAGTAAATAATGTCTCATACTTCTTCCTGTTCCCTTTTAATAGGTATCAAGAT
GGGAGCATAATGTTTTGAGCAACAATTTTTATAAAAGGGTACTCTAATTAGACGTTATGC
TAGTATTTCTAGGCAAGTATTTCAGTGAGGGCCTGGATCCAAGTGGAATGATTCTGCTTG
CATTTGTAAAAATGGAACTGGGCCAGGGAAAGTAAGTGGCAATAATTTGCAGTCTTCGGT
TTGGAGATGATAGTTAACACCATGAGACAGTTTTTCTGGGGATACGAATACATAAAATAT
TATTGTAAGCACACAGTCAAGCTTTGACGTGCTGTTTTAATTTTCTATGTCAGACAAACA
CGGTTAGTAGGGATTGTGTCCAGATCTGCATAACTCTAGGTGTTTAAGTTGATGCGGCAT
GCGTGCTCATCCATTGATAAAGTGGTGGACAATAGTAAATATGTAGCCAAGCAAGCCACA
GCTCGTAGAAAAACAAGAATTTTAACCAATGGGCTGTAGTGTAGTTCTTTGATATTTCAA
GGTTACTTTCCCTTTTTTTCTCCTACCCACAGGAACTACTGTTTCTCTGGAAACAACTAA
TAGTCTCTTGGATTTATTGTGCTACTATGGTGACCAAGAGCCCTCAGCTGATTATCATTT
TCAACAACGTGAACAATCAGAAGAGTCGGTAATGGCTTTGGGCAATGATTTTTAAGGTTT
TTTTTTTTTTATAGTAATACCTTCTCAAAATAAGGCGAGTTCGTGTGCCATGAGTTAGGA
TAGTAGAGATTTGTGCTGAGATGTGGGGTGGTACAGTAGCCTGATGAACAGTGTGCAGAG
GAAGAGAGGGATTTAAACAATTATTTTAACACTAGTTCCCTTCTTAAAAGTATTTGGACC
TTGCCTACCACATGCAGGCAAAGCTTTGGCCAGAAATCTTTGGGCAGGCCCCTCTGTCGT
TGCTTACAGTGACAGTATGATGTGTAATAGACAGGGAAGGATCCCCTTCTGCCCACTCCC
TCAAAACTTCATACATATGTAGGCGGGGAGGAGTGAGCACACGCTACTGGAGGTATAGGA
CAGTATTGTGCCAAGGGTTGGCCTGTTGAGACTCGCTCGTAGCCTCTCTCTCAACCCAGG
AGTTTCATTTCTAGAACTAGATCCCAAGGAAACTTTTGGATCAAGTGCACAAAGATGTAT
AGATGTGGGGCCGGCCTTGTGGCCGAGTGCTTAAGTTCACTTGCTCCACTTTGGCAGCCC
AGAGTTTTGCCGGTTTGGATCCTGGGCGCGGACATGGCACTGCTCGTCAGACCATGCTGA
GGCGCCGTCTCCCATAGCACAACCACAGGCACTCACAACTAGAATATACAACTATGTACT
TGGGGGCTTTGGGGAGAAGGAGAAGGAAAAAACAAAAAAGATTAGCAACAGTTGTTAACT
CAGGTGCCAATCTTTAAAAAAAAAAATGTATATATAACAGTTTTTGTAATATGATATTCA
TACCTATAATTGGAAAATAGTGAAAACAAATTAGGTGTCCAATAGTGAGTGATTGGATTA
TGGTAATAGTGTTGTGCAGTGACTGAGAGTACTAGTGTAGGTCTGTTTGGGTATGGACAG
ATTCATCACCCTTGATAAGAGGGAAAATAGGCTAAACAAGGTATGTTCCATTTTTATAAA
AAATTTTTCATATGCATAAGGGAAAAGTCATTTTAAAAATTCAGTGTTTCTCTCTGGGTT
ATGGAATTATGGGTGTTTTTCTTCCAGTTTGTCTTCTCTAATTTTTTTCCCACTAAAGGT
GGATTATTTGTGTACAGAGTAAGATTTTAAAGTACAAAGATACTGGTTGTAGTCACACCC
TGCCTTCCAGATTATCTTCTAGATTTCCTGGCGTGGCTTGCCTTCTGCCCCTCCAGCCCC
AGCTACAGAGCCAGCACGGTCATATGTAAAGCCAGCCATGCTTGTCTCGCTCTGCATCAG
CCTATTCCAAAAATTGGTTTATAAATAAAGGACAAGGTGTTGTCTTTTAAAAAAAATTTT
AGCTTGTGTTCTGTCAGTGTTAGACATTAACTATATATTCCATACCCGGCAATGTTTTCT
CTTGCTTTCACTCTAATAATAAACAATATCTCTGTATGGATCGAGGCCAACGTAGCCTCT
GAGGAAACAAGCTGGATGGTTTGGATTTCCGGTTTTTCACTCTAGGCCAGGCCATAGAGG
GCAGTGGCTTTATCTCCTCTCTAGGCTGTCAGTTGTTGCTTTAAGGGCCAACTTTTTTTC
ATCTGTAAATGAGCTGATTTCCCCTTAAGAAATTAGCATTTCTTAATAAACGTTTGCTGG
GTTTCCTCTTTGCCTTCTGCTGGATTCTATTTCCTTTGATAGTTTGATTTTGAGGAATCT
AACTAGGAGAATGCATTCCATTGTCGTATTTTACTTTATTTCTGTTGATGGTTCATTTCA
GGAAGAGGCCACAGAGGAAAATAATGAGAAATCTAGGAAGAAGGCTGGTCCTCAGTTGGG
AGTTACTTGGAGGTATGTGTTACGTAGTTGGAGCCTTGTATTAATGGTTCCTCATGGTAC
ATGGAATGTTCCCCTTCACCCCTTGAAGAAGACACCCTATAATTTTCAAAAATACAGTTG
GTTTTCAGTATGTGATAGAAATATCCCAATTGGTGTTCATACGTGTTTGGACCTTTTTTC
ATAAGATCTTTATCTCCAGTCAGCAGCACAAGGTTGACACTTGACTTTTTCTTTTCTTTT
TTTTCCGTTTAACTCCACGTAGCCTTCCATAGTATGGTTCCTTTGGTAGTTTCATCAGTA
GTCCTATGTTGCAGTATATACCTCTAATTCTGAAAGAGTCAGTATTTTGATTACATAAGA
ATACACGTACACTAGACTGTAGTTCTAAATTAAGACTACTGACCAGCGAGCAGAAATATT
CAGTACTTCTGAGCAAAAGGTGAATAACATTAAACTAACATTTGAGAATTTAAATTAGCT
GAGTAGAAGTGTCTAAATAAAAGGTATTTCACACAGATGTCTGGAGAAGGAAAGCTGCCA
CTAATATCTAGTCTTTTTTGAAGTAATAAATTGAATCAAAAATTAAATTTCTTCAGTAGA
TTTTAATGATTTAAAATAGTAGTTAAGAGCGTGGACTTTAGGGTACCATCTTGGGTCAAA
TCCTGGCTTTATCACATTTCAAAGACATTGGTAAGAGAGAATCAAGGTACAGCATAGTTT
GTATAATGTGATACCTTTGTGGGTTTTCTGTTGTTGTTTGTATTGAGGTCATAATAGTTT
ATAACATTGTGAAGTTTCAGTTGTACATGACTAGTTGTCAGTCACCATATATATGTGCCC
CTTCACCCCTCATTGCCCACCTCATAACCCCCTTCCCCTCTGGTAACCACTAATCTGTTC
TCATTGTCCATGTGTGAGTATATCTTCCATGTATGAATGAAATCATATGGTGTTTCTCTT
TCTCTGGCTGGCTTATTTCACTTAGCATGATACCCTCAGGGTCCATCCATGTTGTTGCAA
ATGGGACAATTTTGTCCTTTTTTATGGCTGAGTAGTATTCCGTTGTATGTATATACCACA
TCTTCTTTATCCATTCGTTAGTCCATGGACACTCAGGCCAAGTTGTTGCGCCCGGGGCCA
GGGGTTTGCTTTTTTCCTGTGAGCGATTCTGCACTCACTGCCTGGACTGGTAGGCACGCC
CCTGCGATTGCTTACCTGCCTCAGTGTGGGGCGTTCCCACAGGCTGGGAGGTAACTGAAG
TGCAAGCTTTCCTGCACAGGCCTTCCTTCTCTCCCTTCTCATCTCAGGGTCGCGTGCCAG
CCAATGTGTGGTCCTGCCCCTAGGTTGCTGCCGGGCGGAGGGAGAGGCCATCCCCTTTAC
CATCTTCCACTGCCTCCTGGGGTATCCAGCACCTTCACCTTCAGACATATGGCTGTGGAT
GTCCTCTTGGTTTATGACTGTCCTTTTCGTTGTATCTTAGTGGGGAAAGACTTAAGGGAA
GAGCTCACTCTGCCGTGATGCTGACGTCACAGGTTTTTTGGGGATTTTTTTTCCTAAGAG
AGGGAAAATAGATATGCTAGAATATGATGTATGTATGTGTGCTAGAATATGACAGAGGGA
TTCAGGAGAAACCACTTCTCTGTGGTTGCCTCTGGGGAACTGTGATTGGAGGAGGTTGGG
AAAACTTCGCCCTATTGTACCGTTTGCTGTTGGTTTAATACCTTGAGTGTATACTGTCTT
TTCAGAAATCTTTCCGTTTCGTTCCTGATTCTGCTACTTAACTGCAAGGCCTTGGACAAC
TTAAGGTCTTTGAGCCTCAGTTTTTCCCATTTTCAAAATGATAACCATCTCTCTGTGGGT
GGCAAGAGTTGTTTGAAATTATATGCATAAAGTGTTTAGCACAGTGCCTAGAACACTGTA
AACCCTCAGTAAATTGTGGTGCTGTTGTTTTTTTCTGTTTCCCCTGGTTCATATTTACTC
TCTTTTATGCAGAGCAAAAAACAATGCTGAGAGAATCTTTGCTCTAATGCCTGAGAAAAA
TGCACATTCCTACTGCACAATGATCCGAGGAATGGTGAAGGTAGCGTTTGTTTTATATGT
TTTTATCCTTAATTTCTACTGACTCATGGTTTCTCACCTCAGAATTACTGATGTTTCGAG
CCAGATAATTTGTTGTGGCGGGGGCCGCCCAGTGTGTTGTAGGATGTTTCATAGCTCCCT
GGCCTCTGCCCTGGCATGCCAGGAGTACATCCTCAGTACCCCCAGCTGTGACAACTAAAC
TTGTCTACAGGCATCACCACATGTCACTTGAGAAGCACAGTTGCCCTTGGTAAAGAACCA
CTGCACTAGAGCATACGCTTTATGAGAAGTGGGACCTTGTCTGTTTCTTTACTGCCTTAC
TCCTGAACCCTAGAAGAGTAGATATGCAAATATTTCTTAAGTGAACAAATTGGATGATGC
TTAGTTTTTATCCTCTCCTTCTTCAGCACCGAGCTCCTGTGCAGGCATTAAACTTGTACA
CTGAATTATTGAACAACAGACTTCGTGGTAAGTGTGTTTGGAGAATTCCCCTCACTCCTC
CTTTTTCTTTCCTTAAGAATCTGAAATCTTTGGATCTTGCCTCAATCATTAGCTCAGTTT
TTAGTCTTTTCCTGTGGTATTGGTGATTAAAGCAGGAATACATCCAGAGAAGAAAGTGGT
TTTCCAGTTTCGTGGACCACGTGGTAATGAGCCAGGAGCCACATGTGTATGCCTTAAACT
GAGCCATTTAGGAGTTAATCTTCAACCCCAAATTTTGTTAAAGTACTTTTCTTCTTTTAC
AGCTGATGTATACACCTTCAATGCAGTGATTGAAGCAAAAGCATTGATGGTAAATGAGAA
ATTTGAGGAAAAATGGAATAACATACTGGTAAGGAAACCTCATTTTGTCTTCTGATAGGC
CTGAAATACATGGGATAGAGACAGCATTCGCAGAGCAGCTACATGGCACTCACCGTGCTG
GGCACTCAGATAGCAGCTACTTGTTTACTGCCTTTCCTGCAACCCTCTCATTTAAGTAGC
TGTGTCTGACATGAGAAGAAAGTTAGTTGACCTGGAGCATACAGCTAGAATTTGGGAAGA
CCTGGGTTGCATTGTTCATTTATTTCTCATGATAGTTTATTACAAAAATAATGCATATTT
ATTCAAAATTTTTATCAGGTAGGTTTAAAGAAACTGAAATCACTTGATTGAAGTAATTTA
GGAATAGGAAATGTTTTTATACCATACTGCTCATTTATAAAGGAAAAACACAATCTCTTC
TAGTCTATTCTTTTGCTTGAGTCTCAGCAGACTCCCTTGGCAAGGACTGAAGACAGTTGA
ATACGTTGATCCAGTTGGTGTGGGGTGTCTGAATCGAGGGGCTTCTCTAAAAGGCAAAGT
CACTTGTCTTGCTAATAGGTAATTCTTAAATTAGGGATATGTTTATTAACCTGCTTTAGA
CATAGCCAGAGAGCCAAGTTCTTTTTCAGTATGTAGTATTAGTTTATTGGACAAATTATC
TACCCAGGCATAAAAAAATACTTCGGCTTTTGATTCGCTTAGGAGCTGCTGAAGCAAATG
GTTGCACAGAAGGTGAAACCAAATCTACAAACTTTTAATACAATTCTGAAGTGTCTCCGA
AGATTTTATGCATTTGGAAGATTGCCAGCCTTACAGACCTTACGTGAGATGAAAGCCATT
GGAATAGGTAAGGATGTGTCCTAGAGTCCCTCACTGACGCCCGAGACAGTGCTGACCAGA
CGTTTCAGGTCTAAACAAGCCAAAAAGAGACCGCCAACTCTTTTTTTTGCTGTTTACGTA
ATATGTTGGGAGTTTCCTTTCTACCACTTGGCACACTTAATTATATGTGTTTACTACGGT
GGGAGCTCCTGTGTCATCTTTGTCTTCTTTATAGCAAATTACAACGTTCTCCTAGTATTT
TAGGTACTTTTTTATGGATCTCTTGATTCTGGGGAAACTTGTTCACTTAGAGTTAGCTAG
CTTTAAATCCCTTTACATTTTCTATCATAATGAGGTGTTTGAATCCCAGTGTGTGCTAGT
GTACTGTATATTTTTCAGTACTTTATTGAAGGTTGTTTGGGAAATCACTTCAGTTTACTT
TAGTGTTCTTAACTGAACAATCATAGTACAGAGCATTAGCTGTAACATTTTAGTACTAAG
TGTCTGGACTTTCTAAAAGCGATTCAGTCTTTATGACACCTTTCACCTTAACATTAATCA
GATAAGTTAGGAAATGTCTTTGTTCAAAGGAGTAGAAGTGCATCATCTTGTACTTAAATA
CCAGCATCAGTATGTTTTTAGTTCAGTATGCCTTAGCAAACCATATTTTGGATAGCTGTG
TTTGACTTATTTATTTTTTTCTATCCACCTGGTAATTTGAGAACCCTCGCTTGCAACGTA
TCACTATATTATTCAGCTGTTTTATCAACAAGGTATGTATGACATTATGTTATGTTAATT
TCTGTAGAAAGTTGGCCCAGCTCCCTTAATTTCGTTGATTAATTGTTGTGCGTTACCTTC
TCTGTATATAAATTAAGAATAGAGAATTCACAAACTAACATCATCCACAGCCTGAGCAAA
AAGTTATTTTTGTGGGTGGTCACCTTGTTTGTGATACGAACCTTGAGCTGGAGGGGAGAG
GGATCATTTAGTGTACTAACAGTGTTGGTGTGCGGTTAGAACTGGTCAGAAGGTACTTGA
GTTGGGAGTTCCTTTTGCTCTCCAGAGCTGTGCTGTCCAGTACAATAGCCGCCAGCTATA
TTTAATTAAAAATTTTGAACTGCCTTAGTGCTTAGCCACATGTGGCTGGTGGCTGCTGTG
TTTGGTGGTGCATATTTGGAACATTTCCATCTTTGCAGGCAGTTCTTGAATATTGCTGCT
CCACAGTCACCTTAACCTTAATTTGAAGCCTTGTGGGAGAACCGTGAGGCTCCCTTTGTC
ACCTGCTTTTAGTTCAGCCAGTCCCTATTGGAGCTGTGCTCTGTTGAATGGACTTTGGAG
AGGCACACCTGAGTTGAAATTTCACCTCCACCATTTACCAGCTGTGTCAAAAGGGACTGG
CAACCTTACCTGAGGAATAATGCCGTCAGAGTGTAATGGTTAAGTGAATTACACAGTGTC
TGATCCCATGCTTGGAAGGCACACAGGAGACGCTCATAATCTCTTGCTTTTTGTCTGTTT
GCCCCAACCAGAGAAAGAACCCCTGGGTTCAGAAATGACAGCTCTAGTCCTTCTCTCCTG
TGATAGACTTTATATGCAACAGAAAAACTTGATAATCACTCTCTTTTGGAGGGCTGAGTT
TACAAAATCCATATTCTCGTGTACAGGGAGGTGTTTGATCTTTTAGGGTGGGGGACAGGT
TAGCTTGGAAGCGGGTAAGCAGTTTACACAATTGTATCTTCTAAAATTTTCCTCAACCTT
GGTGAGGTAGTGAAGCTAGTCTTTCTGGCCCCAAAGCTTGTTCCATTCCTCTACTGTCAC
ATATCACATTGATTCCGTTGCTAACCAAGCCAGTGGGACTTAGGCTTCCTAAGCGACACC
CATGCCGGTGGGGGCAGAGTGGGATGAGGTGTATCAGTTTGTCTTATGTATGTAATTTAC
CTGCCTGCAATAGTAATTTCTGGGAATTTACCCAAAAGAGAAAGCCTAAAATACTGGAGA
AACACTACATATGAATTAGAATATGTACCTAATAATAAAGTTAGGAATGGTAGCAAATGG
AAACCTGCTTGAGGAAATTATCAGAATACATCTCTGCTGTCATTAAAATGCTATGATCAC
TCGTGTGTGGATAAGGTAGGGAAGAGAATGTGGGTGAATAATGTGATATGCTTGGGAATA
TTGTAGGAGCATTTTCTTACCTAGTGATACTCAGTTCATGTGATTTTAGAGGACTGTCCG
TGTCCATTAATTCTACAGTTTTCTTTTTCTTGGCCTTCTCATCCTGATTATTCTTTAAAG
GAATAGTAGTGATTACTAGCAAAAACTATGTTTGTTTTCCTAAGAATACAGGTTTGGCGA
GGGGGGCTGTGTGTCTGTCTCCCAGTTCAGTGAAAGTCAGGCATGTGAAGAGACTAAGAA
GGAAGGGAAGAGTCTCTGTTGGGAGCACATAGCCAAAGATCAGTAACTGTCCCAGAACTT
AGGGAGAGCTGCCCTCTGTAGGTGCCTTTGTTCCTTTAGCAAGCTGGTGCCCTGACCAGC
TGTGCCAGGCCTTACACTGCAGGTGGAGGAAGGAGAAATGTGGCTGCCTGTACTAGGTGC
TGTGTGCTTGGTGGTGGCAGAGGAAGTGGACTCACGATAAACCATTTGCTTCCTTATTCT
GTAGAAAGCTCTGCAAAAGGATCACCCCTCATAATCTATGACATCATGAATGAAGTAATG
GGAAAGAAATTTTCCCCAAAGGACCCAGATGATGGTATGTACAGAAATTGCTTGTGTAAC
ACAGAGCCTGTTTTCCGGGTACTGGTTAGTAGAGGCTTCTGAGGACAAGGTGTAAGTTAG
CTTAGTGATCTTTCGGGTTATTATTCTGAGAAAGCCAAAATGTCTGTGGCACTTTGCTGT
ATCCCTCCGCTCCTCTTGAGTTTTCATTCCTTTAGGTTTGTCTTACGCATTGAAAGTTTT
GTTGCCAGGATTTTAATTAACGTTACTGACTTGAAAATATGTTTTATCCATGGTAACCAA
GGCTCTTGGGAACTTTCTTTTTCAGATGCGTTTTTTCAGTCAGCCATGAGAGTTGTAAGT
ACCATTTCTTGCTTAACTTGTTTTCCCTTTTCCTTTTATCCATTTCCTAAATTTTTCTGT
AACTGGTTGGTGGGAGGATGTCTTCTTGATTCTTTGACTTTCTCTTACTTCTTTTCATGT
CTTTTGGTTCTGTTTTTCTTATTGGTTTCTCTAAAATCTGTGTTAAATCACATAACATCC
CTTCCCTGTGTTTATTGTATACATTGTCTTTTTTCATACTTTTGTTCAAATAAGTTTTCA
GAGTATTTCATATTTGGCTGTTGGTAACTTTTTAAATTGAAGATGATTCTTTTTAATTTT
GGTTTTTCATTTTATCATGCTAATTATAGGAAAAAATTCAAGCAGTTTCAGAATAAATTA
GCATATCTTTTTTTCTAAGGATAATTGCTTTACAGTTTAGTGTGTATCTTTCTAGGGTTT
TTCCTCTGTGTATTCAGACATGCACACCCAGATGCATTTCCATGGTGTTTGGTTTGTTGA
CAGCAATAAAGTATTCCATAGATGAGAAAGACTGCAATTTAACTTAGAACTCTTCTCCTA
TGGATGGATTTTGGAGTTACTTCATGGGGTTTTTTTGCTAGTACAGTGATGCTGGAGTGG
GCATTCCATCTCTCTTTTGTGCATGTGATCAAGTATTTTTGTAGGATTGATTTCTGAAGG
TATAATTTCTAGGTCAAAATCATTTTGTTTTAAATTTCGCGGAACTTGGGAGTTTGTTGT
GATTTCCCACCCCTACCCACCGCCTTTCTTGTAACTCATTTGCTGTCCACCAGTAATACA
CTGAATCAGCATATGAGTATTTCCACAAGAAACTTGTGCTTTTTTTCTTTATGTAACGAG
CCACTGTTTGGCTGATAAGGATCTTGGAGTGATGCCTTCTACTTGTAAATTTTCAGTGCT
CATCTCTCAGAGATCTAGAACTTGCTTACCAAGTACATGGGCTTTTAAACACTGGAGACA
ACTGGAAATTCATTGGACCTGATAATCGACGTAATTTCTATTAGTAAGTGTGTTGGAAAT
GTATCCTTTTGCATTAATGGCGCACCTTTAAGCAACCATTAGTGAATTTTGCAAGTGGGA
GGCTGTTGGTGGCCCTCCTATCTCACCTCTGATTTCAGGTAGCACACCTCACTTAACAGT
ACGTGTTAATTGAGTGCTTGGAAATTCAAACAGTGCTAAAACTGATCTGCCAGAATGAGA
TGTCTTGCTGTATATCTTTTCAGCTGTTTTTCTTTGTAGCACTTTAAATGCACATATCTT
CTACACCCTTCTATTTTATATTTTTGAATTTTTAGTAGGGTGAGTCCCTCAAGATTTCAT
CACAGCTTCTTGTTTTTAAAGATGAACAACATACTAGAGTCCAAAGAGACTCCTTAAGTG
GATTTGCTTTTAAGCGGATGAAAACAAGAACTAAAGGAGGCAGCCTGTTAATGAGGGTGT
GATGAATCCTTGCTTCACATGAAATGCTTAGGAAATGAATATGATGTTCACTGTCTGCTC
CCCATGAGCTGAGAGTATACTGAGGAGGCAGTCCTGAATGACCAGTTCATAAGAAGGTAT
TAATTAGGAAGTCCAGAAAGCAGTTAGCACCTCCTGGGTCAAGCATTGGCCCATGTAACT
TGAAATTGTTTATAACATGTAAATTGTTGTAAAATTGTATGTAATGTGTCATTATATAAA
CATACTTTTTCTCCCCATTGCAGTTCCAGGTTTTTCAGTTTGCTTTGCCTAATGGAACAA
ATTGATGTCACTTTGAAGTGGTATAAGGACCTGATACCTTCAGTAAGATGATTCGTTACT
AATCATTTATTATTGTAGACATGTTTGTTGGGTATCTTTTCTGATTTATACTTCAAAAAT
ATATTTGTATTTCTCTTAATCAGGTCTTCTTTCCCCATTCTCAAACATTGATAGATCTTC
TCCAAGCATTGGATGTGGCCAACCGACTAGAATTGATCCCTCAGATTTGGAAAGGTTGGT
TTCAGCTTATGTGTGCACACCTGTCTCACTTCATTGTCCCACATTTTGATTAACAGACAT
GTTAACGTTGTTAAGAGATGAAAACTTGCATGTTTGACTAAATCGAATAGATTAGTTGAG
GTCTACTTCAGGTTCGCGTGCTCATGTTACATATTGGATTACTTGAGTGAAAATGACCTA
AATTAGTGCCTTCGTGACAAGAAAAGGCTAGATTTTGTGTACCTGTTGCGTGACATGACA
AAGGGAGACTCAGTGCTAATTACATGGTACACCCTAAATCTAAATGCAGGTCTCTAACCC
CAAGGCCTATGTCTTTCCTCTGTGCCATGTTGTATCACTGTGGTTCAGTTGCTAACCAAT
CAGTGATGCTTCGTGTTTCTAAGAAATAGCCATGACTGTTGGTTTGTGTGTGTGTTTGTG
TCTTATGTGCATAAATTGGCTGCGGAAGGTGCTGTATCTCTTCCACCAGGTGACTGAGAT
CTTAAAGTCAGTTTCTCTCTGCCTCAAGTTTCCATGTCTGAAACCCTGAGACCACAGTCC
TCCCCTACTACTGCACAAGACTGTTCTAGTGATTGTATGTACAAGACCGTTGACGATACC
CAGCTGCTGTGAAACAGCGTCTTACCACACGGAGCTGGTGGCTTCTCAAGTGTAGTGCGT
GTGCTGTGTTTAACACTTGACCAGCACAGGTTACTGGCATTGGCTTTCACTGCTCTTATG
TCTCTGCTTACCGTGACTCATCCTGCTGGTTTTCTGCAATCCTCGGAGTAAACCTGGTAT
AGGTAATGTCAGCAGCTTACTTTCACCCATCAAATATGGGTGACAGCTGACAGTGGACAA
AGGTCAGCCAGAGAGTGTTGGTTTTACGTGATGGTGATCACTTCTCACTTTTTTGTTCCT
TTTTTGTTTCAAGATAGTAAAGAATATGGTCATACTTATCGCAGTGACCTGAAAGAAGAG
ATTCTGATGCTCATGGCAAGGGATCAGCACCCACCAGAGGTAGGATGTATTGCTCCTCAG
GTTTGGTTATTGTTACAGTACGCTAACGAGTATATTCTCTAGTACTAAGGGCCCTGTAAG
AGCACTTTCCCCGGTTTCATCTGTCATTGTGGAGAACTCTGCCATCTAAACCCATGTTGC
CACCTACACATATCCACCCATTAGCAGATTACCATTTCTAAAGTCACTCATTTCTCTAGA
CCAAAGCAAAGAATATGAAAATAACGTCACTCTGTCCTGATAATTAATAGCAGTTTGTAC
TGTTTTTTTTTTTATTGCTATCTGAAAAGAGACCTATAATTGGATTTGAAAGATGTGGCT
AGTCGCATTTTTACCCCGGGGCAGTGGGGGGTTTTTTGTTTTTACTTGTGTGCAATATGT
GTGATGTAGTGACTTGCTAAAAAATTTTAATGGTCTCATGGAGTCTCCAGAACTTGAATT
CTTATAAAACCAGTTAGGCAGTTCTGCTGACTCTTAGAGCCTCTCAGCTTCAGGTGGCGT
TTGCTGACTGTGCTGCAGATATCAAATCTACGTATGAAAACCAAGATGCCAGACAGACTG
TTCCTGATTGGCCAGCCAACCCTCTGAACTATATAGCTGTCCTTTTTTTAAGGGCTGGGA
GAACCCAGGAAGCCTGGTGAGTACAATCCCCCAGGTGTGAATTAGCAGCGTTGGTACTTG
GGTCTCAGGGAACCTTCACCCTGGTCAGGAGAGGTTCTCTTAATTTGGCTCTATGATGTG
TAGTTTATCAGGAGACAAATGAGTTTTCTCCATAATGCGTTTTCAGTGGAACTTCCAAAT
ATCAACTGAAAAGCAAACTTTTGGAAGAAGGCCAGTATATGGGGTGTATTTAAGAGAGGA
TGTGGTTCCGTGGGCTAATTCTTTCCATTTCTGACCTGTTTTCTGTATCCGTGGGCAAGT
AAGTCACTTATCTGTCTGCTTAAATAAAGAGCAAAGTGATCGAAGAATCTTATTTTTGAA
AATGTTTTGGGCATTAGGTTTCTTCAAGTATTTCATTTGTGGGTGCTCCCCCCACTTCCC
AGCTTACAGTGTGGGTTGTATACTTGGACTTCAGGAAACTGGCATTCACTAATATTGAAA
CGTGGCCTTGAGTAGAATCCGTCTGGTTTGTGCCACTGTATTCTAGTTATGTGTTTTGTC
AGCGTTTCATTCCCATACTAATTTTGTGAATGGACACCTTATGCATATTCATTTTTCCAA
AAGCAGAGAAGTCAGCAAAGGAATACTTTGTAGGAGTAGTCACAGTTAAGTGTTTCTGCT
GTATTTTGTTTTGGCTGTAAATGTGTGTTAGTTCTAAAAGTCAGTAAGTGGGGGGTACTT
GTGCATGGCTTCTTCAGCCCAAGAAAGTAACTTACTTTGAACATGTGATTGTCAGTCCAG
AATATGGCTGTTCACTATCTCCAGGAAAAGCTGATGAAGGCTTTGCTGCCTCAGCTGGTC
TTAGGAGTGTGAATCACACGTGGCCTGCTGCACTTCTAGTGACGGAAGCGCCCGATGCTT
GAATGTAACTCAGGCGGGTTGACACACACTTGTTATGAATCAGGCTGTGATGATTGGCGC
AGGGGTACGGACCTCAGCTGAGTCATGGGAGCTGAGTGTATGTGTTTCTCCTTTGTCCTG
CATGTGGCAGGATAACGGCGAGCACTTACATGAGACTGATGCCTTAATCTGAGCCTGCTC
TTCATGACGTAGCTTTAGGACACACTGAACTCATATTGGATTGTGAGAGAGTAAGGAGAT
CACACTCAGTTGCATCCCTCTCTTCCAGCTGCCCACGGGATGTACTCCCTCCCTCGGAGG
ACTGAGGCGGTGCTCTACAGGGGATATACCCCAGCAGCTCCCCACACTGGCGGCAGAGCG
GGATCGCCTGTGACACTTGCAGTGTCCACATAGGAGGTTTGGGAGGAGAGGGTTGACGCA
CCTGAGGTGATTGTGATGTAAACACAGGAGTGGGAGCCAGTGGAGCTCACAGATGTGCGT
CTTCAGGAGCTTCCCCTGTAGTGAGGAAGGACGCTTAGTCTCTGAGTCCAGGAGAGCAGC
TACGGTCGTTTGATTGCCTTCTCTTCTATGAATAGTCATAATCTTCCTCCTATCTCATCT
TGAACAGGAAAATGTTGGAGCTTTTCAGGAAGCATAATAAGATCCCGAGGTACGTTGGAG
ATAACAGACCTGCCAGAATATATCCGGGAATTAGCTGCATGGGCTAAACTCTTACGGTGG
GGTGATTGGAATTTCTTCACATACCCTAGCCATAGTGTATTGGGCGTTCGTCTGACAGGC
GAGCAGATGCACAGTTTGTCCCACCATCTAGGGCATCCTGAGGCAAGCGGTTTTTCATCT
GTCCTCAGGGATCGCAGCACACGGGAATAGATCCTCAGTGAGGGCATATTCAACCAATGT
CCATTCTCTCTGGCCCAGTTAGACTTCGTGTAACATTGCCTCCAGAGCTACTGTTGAGGA
TTTTATGACTGAACTTTATAAAATGCTCGATTTTGCATGTAAATCTTTGACTGAAGAGGT
TGAGGGGTTTAGTTGGGGACTGTTGACATGTTGCCTTTCTTTTACAGGAATGAGTTGCTG
AATGAGTTTATGGACAGTGCAAAAGCATCCAGTAGCCCTGACCAGGCCATGGAGGTAGTG
AAGCTGGCGAGTGCCTTCAGCTTACCTATTTGTGAGAGCCTCACCCGGAGAGTGATGGCT
GACTTCGCAGTCAGCCAGGAGCAGAAGTAAGTGGGTCCTGTAATGTCACCATGAAAGAAA
GTTAGAAAAATGGAGCAGACCTTTCGTCCGTCTTCTTTCTAACCTCTCAATTTTCTTCTT
TCTTTGCAAAAAGTCAAGATGTATTGATTTAACAATTTCATTTGTCATCCAAGTCGAGGA
GGCCTGTAGATTTGGCCATTGGAACCTTCTCCTTTGTAAATAGTTTGTGCAGCTGCAGTC
TCCCCTCCCCCAGAACGAGTTGCAGTGTAACACTCCTGTTCATTTTCCTTACAGGGAAGC
CCTGGGAAACCTAACTGCATTGACCAGTGACAGTGACAGCGACAGTGACAGTGACATCAG
CGAAGGCAAATAGAAGTGGTGGATCAGGAGCAGCTGTGGCCTAGCATAGCTGCTGTAATT
ACACTTGAGAACTGAGACGTTCATATTTAACCATGATACGAAGAAAACATGACAGTAATA
CAGATTTGGTGAACTTTGAAGTACAGTTGAATACAGCACTGACTTATTTAGGTTAAATTC
CTAATTTGATACTTTGTAAACCATCCATTCAGGGTTTATTGTTGAAAACAGAAGCAGCAC
TACTGTTTTCATTTCCTTAGACACACGTTGTGAGGTACATAGCTCCCGATTTCGGCATAA
GCTCTGCACACCTGCAGTGTTCGTCAGCCGACGTCACGCTCTGTGGTCACTGGTTTGCCC
TCCCCTTGTGGAGCTCAGCCTTCATTGGGTGATGCTGTGATGCGGGTACTTCTTGATCTT
AGAGAAGGCATCTAAAGGAAGTTGTCATACAATTACATCACAGTTGATAATGGGTCAGTA
GTACCCCAATTTCAGGGATATTTAGATGTAAAAAATTGTGCATCTTAGAATTGATTAAAT
GACAACGGCAGAAGTTTAGGCTGCACAGCTGGGAAAATGAAGACTGTCAATAAACATGTA
ATTACTGTACATGTGTAGGTATTTATGTTGTCTTTATATAGCCTTTGCCGTAGTCCTCCC
ACTAGACGTGGGGCTTGCACAAGAGCGTTTCGTCTCCTCCTTTCTCTCCCCCTATTTTGT
GTGTGCTGGCACCTTCTTTAGTTGTGCTGTACTTAGTGTGGTCTCACGGAGGGCTTGTGG
TGACGTAATGATTGAAATGTCTTGTTACAATTGTGCATTGCTGGTAATCAAGTTGGTCAA
GAACCTGTACTTCTAGCATTTCTCTCTTAACCACTATGGCTTTCAGATAATATTGGAAGC
TAACAGGAATTTGAGAGGTTTGCAGAAGCGTTTTGACCTTCACAAGGGCTTCTCCCACAG
GCTGTTTTGCTCGTATCTGATTCCCAGATTTACTGAGGCACCCCATGAGTCCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1098, 2870..2940, 3051..3087, 7398..7443, 12190..12258, 12743..12847, 14414..14537, 16412..16527, 18307..18371, 20352..20439, 20846..20906, 21182..21267, 21942..22086, 22781..22835, 24728..24813, 25105..25133, 26036..26142, 26843..26921, 27023..27113, 28033..28118, 28607..28755, 30247..30288, 30707..30865, 31134..31212
1001..1098, 2870..2940, 3051..3087, 7398..7443, 12190..12258, 12743..12847, 14414..14537, 16412..16527, 18307..18371, 20352..20439, 20846..20906, 21182..21267, 21942..22086, 22781..22835, 24728..24813, 25105..25133, 26036..26142, 26843..26921, 27023..27113, 28033..28118, 28607..28755, 30247..30288, 30707..30865, 31134..31209
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved