Equus_caballus Locus ENSECAG00000013062
snOPY snoRNA Orthological Gene Database
Equus_caballus ENSECAG00000013062
Equus_caballus
ENSECAG00000013062
16
SNORA62, SNORA62
2731..2881, 4910..5063
7350
GTGTTCCTCAGAACATTTACGAACAAATGAGGAAGAAAACCCCATCCAGTTTCTCTCTG
TGTATATCAGTGCTTCTCACCCTTCGCTGCACATTAAAACTATCTAGAGAGCTATTCTTA
AAAATCAGATGTGTTTTGGTTTGGGGTTGGGCAAGTTTAAAAGCTCTCCAAATGATTCTA
AGTGTAGCCAGGGTTGAAACCTACCGTACAAGTAATCATTTGGCTATTGGCTATTTCTTT
ACAATCATTTTTTAACGGATAGGGCTTCAACTTTTTAAAAAATAACCACCCTCATCCTGC
AACTCCGTTTTGTACCATAGATTATATTGTAATTACTTTTTAATGGTTGCATAGTATTGT
ACTGGACGGAATAAGTCTTTATTAACTAATCTCCTATCAATTGATAGGCAATTTTTCTTC
TACCAGAAAAAAAAACCCGCGTGCATACCATCTGTGCATTCTTTTTAATTTTTTCAGGAA
CACTTCCTGTAAGTGAACCTTTTAAAATCTTTCATTATGTGCTGCTAAACTGTCCTCCAA
AAAATGAGAATTTCTCCAGCTTTTGTTTACTAGACACCGGCTTGTGCTCAACACTCTTTC
CCACACAGGAAACCGCAGCTTAGCTGTGGGACCCGCTCAGGCTCATAGATACAAAAGGCT
GGGTAAGAACTCGAATCCCGATTGGCTGGCAGGCCTCAGGCCCGCGTCCTCGACTGGAAT
TGCAGCAGGAGGGGCCGAGACACCCGGAACATCGCTGGGGCGGAGAAAGCCCCCAACTTG
CCAGCTGCCCAGCCCAAACCAACCGGAACCAGCCCCCACCTAGGCACCCTTTCCTGGCTC
CCCGCGCCAGCGCCGCAAGCCCGCCTTCCGGAAAGAGAAGGCCCGCCCCCTCAGACTCCG
CCCTTCCGCTAGGCTCTCGTTGTCATTGGCTGGCGGCGGAGTACATAAGGACGTCATTTC
CCGCCCGCCTGTCCTTTCCGCGCTGCCCGGCGAGGGGTCCATACGGCGTTGTTCTGGGTG
AGCGTTCTGTAGGGTCCCGGTCGTCCCTCCGGGCCACCAGAACAAGCTTCCTTCTCAGCT
GAGGTGTGCGAGGACTGGGGATGAAAGCCGGCAGACGCAGCGTGTCCGTCTCCGGCTCGG
CGCGCTCCCCTCGGGTGCGGCGGCCGCACGTGGACGGGTTCGGGCGCGCGGGTTCCCACA
AGGCCCTGGGGGTGGGGGTGGCGGACCGTGGATGGCGGGGCGCAGAAAGCAGGCCCGGCG
CAGTGCGCTGCGATCGCGCCGGCCCTCGATCCTGAGCCCAGAGGCCCAGGCGCCAGTTTG
TAGCAGCTCTTTGGCCTGGTCGGGTTTTCCCGTTGGCGTTGTTGCACTTGTTGCGTTCAG
GAGTTAAGGTTCTTGGCAGGGTTTTGAGGAGAATTAATGACTGCAGGGAGAAGTAATGCA
GAAGCGCCCACCTACAATCTGCTGGAAAATAAACCTGTTCCCATCTCCGCTATCTCTGCT
CAACCCTTGCGTATTCTCGAGCATGGCTGCTCTTTCACAGCTGGTTGTTAATTTCGGTCA
TCGATAACTTATACTTAACTCCTGGGTAACTTGAGAAGGGTTAAGTCTCAATTTACTGTT
TTTGATTAGTTTCATTATCTGAGTGTTGCACCCACCTCCACACCCACTCTTCGCTCAGCA
AGATTCGCTGTGATGTATGGCATATGTCTGTCAGTGGGTTTCTGCCCACTAAACTGGAAG
CTCAGTGCCCGACACCGTAGGAAGGGTAGTCCACGGTTGCATTTAAATATGAAGTTACTT
GGCTCTCAAGAGTGGTTAGAATGCACCTGTTCCCCTGCCCGACTTAATCACTGGAATGAA
AAGGACAAGATTTGTAACAATCGTTTTCAGGTTCCCGTCGTAACTTAAAAGGGAAGCTTT
CACAATGTCCGGAGCCCTTGACGTCCTGCAAATGAAGGAGGAGGATGTCCTCAAATTCCT
TGCAGCAGGAACCCACTTAGGTGGCACCAACCTTGACTTCCAGATGGAACAGTACATCTA
CAAAAGGAAAAGTGATGGTCAGTCATTGCTGTAATTTTTTTTTTTACATGCCAGCTTTAT
AAGTTTGATCCTGCTATTCTGATGGGTAGTGCTGCATGAAGTAATTTTCTAACATCTGGC
TTGAAGGACTCTACTAAGTAACAAATGAAACCAAATCTCTAGATTGGACACAAGCTTTAA
AACTAAATAAAAGTGTTCTGGTTGTTTTTGGAAGGAGTTTTCTGGGCTCCAGTGGAAGAG
TATGGCAGTTGCTAGGTTGAGTCCTGAAGGAGGTGTGAGATGTGAAGATGATGAGGAAGC
TCATTAGCTGAGTTCTAGTAACTTATCCCCCACAGTGTCTGTCTCATAGGTTCTGATACT
GGTGGTTCAACTGAATTCTGAGAAGAAAGTCTAGAGCAGTAGTGGGAATTCACAGTTTGG
CTGGGGGCGGGGGGTAGGTTGTGACAAGGCACTAGTTGGGTAAGGCAGTTTTTCAGCTTA
GAGATAGAGCTGCTGTGGAGGATTTCAGCCTGGGGGAGGCAAGCTGTAAAGGAGTTTGGG
GGGTGAATCTCATCTCAAAACAGAAGGTAAGAGGAAAGAGCGGTAAGAGACCAGCAAGTG
GGTAAGAAGTTGTAGGAATCCAAATGGGGGCCTGACCAGGGTTAGTACAGGGGGAGAGAA
AGGAGAAAGATGCACTTTGCCTACTGAATCAGCTGCACACTGTTAAAGCTCAGGGTGGAG
GCCAGTCTTGGCCAGTGAACTTCTGAGTGTCGGAAGTGTGCTATATTAAGGGCAGGATTT
TCGCTAACACCAGTAGAGCTTGCCTCTATGACTGGAGTTTGATAGTACTTGCTGCCACAT
ACATTCGACTTTTTAGGTAGTTTTCCATTTGCAAAGCTTGGTCGGGTGATAAAAAGCCTT
GTGCTCTCATCTAGGCATCTACATCATAAATTTGAAGAGAACCTGGGAGAAGCTGCTGCT
GGCAGCTCGTGCCATTGTTGCCATTGAAAACCCAGCTGACGTCAGTGTCATATCCTCCAG
GAATACTGGCCAGGTTTGTGGAACAGTATGCTTGGTTTTTATTTTAAGAACGATAAAGGT
TATAGATGTTTTGGGATGTATATAAAACCATAAGAAAATAAAAACCCATAGTTTTGCTGT
TCAGACATCATTTTAAATTGACCTGAGCTGTAGGAGTTGCCAGTGTTTGACATTTCAACA
TACGTACCACTTGGCATTTGGCAATATGTTAAAGTTTATGTTTTCATGTCATCGTGTATT
TTCTTGTGCCACTAAATATTGAGAGATGACCCTACTAAAGTGGCTCATCACATCTTTCTG
TAGTCAAATTTTGTATGTTTAAAATGATGAAATGGTAAAATAAAAAATTTTGATGTTAAC
TGCAGCATTTTTTAGAAAGCTTTTCTAAGTAGGGTACCAGTGCTTATCTCATAAGCAAGA
GTGAGAATTTTTGCCTGCTTAAAGAAAGGAAAAACAGCTTAATTTTTTTTAATGGCCAAT
GAAGTAAAATTTTAGTAGTGTTTTTACCCTGTTTCTATTTTGATAATTCTTTTCCTTTGT
TCATTTTTCTATTGAGAAAGGAAATAGATTTCTTGCGAGTTGATTTTGTAAGAGCTCTAA
CAATGACTTCACCCCATTTCTAATTTTTAAAAAGATTTGGCTTGGATTTTGACAGATTTT
TAAATTGTGTAGTAAGGTGGTCCTTTTGTATTTTGTTGTTTAGTTGGCAGTTCCCATGAA
CTTAAGATGTGTTTCACAGGGGGTTATTCCCCAGAGGCTGGCTTGTGACCTGACCCCTAG
TGTGGTGCATGGTAGAAGGCGGTTGTAATGCTGTTGTAGAATGAGCTTAGTGACCACTCT
AAATGCTTTCTTCTGTACAAGTTGACTGAGGATCTAGATTGGTCCAGACACCGTTTCTGA
GGGCTTGGGGTATAGTAGAAAAACAGTAAGAGCCTTTTTGAAGGGATGCAGGAAATACTG
AGCTCTATAGAGGAAGAAAGTGGCAGGGTAAAGAAAGCTGGATGTATTCCTGCTTTGTAA
TAGGGTGGCTGTGATGAAATTTGGCCAGAAGCTGGAAGTGCTTCCTGGGTGCCAGGCACT
GTTGAGTGTTCTGTTGATTCATTTAATATTCATAACCTTCTGAGGAACTTGGAGACATGT
AACTTGCCCAAGTCACTCACAAAGTGGCCTAGATGGTACTTGAAACCAGGCAGATTGGCT
CTGGAGCCTCCAGCAGTGAGGAAGCCAGTGAGCCACAACATTTGAGGGGAGTGGGAGTGG
GGAGAGCATTCCACGCAGAGGGCCTGCGGCTTGGGGGCGTGCTTAGCATGTTTCCTAGCC
CTGGTGTTGTAGGTACTTTGCAGGTACCATGAAGGTATTGAAGAATTACTGGATGTTTTA
AGTGTTTGATGTTTTCCTTTCTGAGGAGGGGGGTGTTTGGGCATCCAACTAGATAGGCTG
CCTCGTGAGGTCACAGAACTGGGTGTTGGCACATGTACACTTGGACAGTTCCTATGACTC
TCTGGAGTACTGCTAACTCTTAATGTTAATTCTTCAAGCGAGCTGTGCTGAAGTTTGCTG
CTGCCACTGGAGCCACTCCTATTGCTGGCCGCTTCACTCCTGGAACCTTCACTAACCAGA
TCCAGGCAGCCTTCCGGGAACCGAGACTTCTGGTGGTAACTGATCCCAGGGCTGACCACC
AGCCTCTCACAGAGGCGTCTTATGTTAACCTGCCTACCATTGCTCTGTGTAACACGGACT
CTCCCCTGCGCTATGTGGACATCGCCATCCCATGCAACAATAAGGTAACAACTTTACCAT
TGAATTCTAGAGGTTGAGAATGCGTACTCTAGAAATAAGTGGACACTTCTTCTGCACATT
GTTAGAGCTTGGAGTTGAGGCTGCTGGCTGGCCGATGAACTCACAAGTGTAGGTAGTGTG
CTACATGAGGGGCAAGTTTTTCGCTAACACCACAAGGGTCTCTGGCCCAATGAGTGGAGT
TTGATAGTAATTCTTGCTACAAGTATAATTTTAATGTATAAGAGCTTTAAGGAGAGGGAA
AAACATTTGAAAAATGGCCTGTTTTTTGCTTTTCTCCATAATTGTTCTACTTGGGCCTCT
CGGGCTTTATGCACTTGGACTTTCTGTTTTCAGACCAACTTGACGAATCCTGCTATAAGA
TCCTAAAAAGGTGGGTTGCATGTGGTTCATTTCGGTCTGGTTTATCACTCATCTCAAAAC
CCTGGTTCTCCATAAGAATCGGCCAGAGAGGTTCTTTTTGGGCCAGGCACTGATCCCAGG
GATTTCATTTCGTTGCCTGGATGGAGTCTTGACAGTAGTATTTTGTTAAATCCCCATGAT
TCCAATGTGTAATCAAGACTGAAGACCACTGATTTATGGAATAGTCTGTTATAAACAGTT
TCAAACTAAGAAATGTGTCTATTCTTCCTAGTACCAACAGCTTAGACGATGTAGGGGGAG
GAGCTTGCTACTTGGGGTGGACTATCACTTTTTAATAACCTGGCACTCTTGCAGGGAGCT
CACTCTGTGGGTCTGATGTGGTGGATGCTTGCCCGGGAAGTTCTGCGCATGCGGGGTACC
ATCTCCCGTGAACACCCATGGGAGGTCATGCCTGATCTCTACTTCTACAGAGATCCTGAA
GAGGTAAGCTTCCTCTATGAATGCTTGTCCCATAAACACGTTGGACACCTTGATCTGTGC
TTCTTGGAGGTAAAGTTTGTCCCTATGTATTTTTTCCTTTTTCCTAACCAGATTGAAAAG
GAAGAGCAGGCTGCTGCTGAAAAGGCTGTGACCAAGGAGGAATTTCAGGGTGAATGGACT
GCTCCTGCTCCTGAGTTCACTGCTACTCAGCCTGAGGTTGCAGACTGGTCTGAAGGCGTG
CAGGTGCCCTCTGTGCCTATTCAGCAGTTCCCTACTGGTATGTACCATGATGCTGGTGCA
TCGAGCTGGCGGCTTGGCACTTGGATGTTTCAAATCTAATGTTAATTCTCCATGGCTGTA
TATACTAGCATTAGAAAGTTTCGTCCCAGTGTGCTGTCGCTGTGGTAATAGCTTTTGACA
GGCTGAATTCAGGTGCTGTTGAAATGGTCTGCCCTTTGAAATGTGTGTCTGATGAGTGCA
AGGCAGATTGCTTGTGGGCGTGGGGTGACAAGTACTTTGGGAATGGAGCTGATGGTTTTT
TGTATTTTCTTAACAGAAGACTGGAGTGCTCAGCCTGCCACTGAAGACTGGTCTGCAGCT
CCCACTGCTCAGGCCACTGAGTGGGTAGGAACAACCACTGAGTGGTCTTAAGCTGTTCTT
CTACAAACTCGGAAAATGGAAATAAGGTTGACGGAAAATAAACAAGTTTCTAAAAGTTGT
GTCCATTTATTTCAGTTTTTTAATTCCAGATCAAGATGCCTAAGCTCACTTTAGGTCTTT
TGACATCAGTTTTACTTCTGAAGCCCACTGTGGATAAAGTATATTGCATTTTACTTGGGA
GTTTTCCTGAGCTTTTTGGGGGACTATCTGTGTTTTGAAAATAGATGTAAACAATTGCAC
GTACATAGGGTAACCTTGGAATGTTTTTCCAAGGTCCTGATAATCTTTTATTGTCATCTG
CATTGACAGCGAATTCTATAGAGCCCAGATTTTAAAGTAAATTGGCATTGAGTGACAGTC
CTACTGTTTGCCACTTATGTGGCCAATGCATTGAGTAATATCTGGCATTTGCAGACCCAC
CTTGGGCAAAAGAGGGATGAAGTCTTATTCTGGAACCCCGGAGGGGCCACGGCCTTCTCT
AGCCTTAAGAGACACCTATTGCTCGGTCAGCTTGCCCATAGGTTCTGGGAGCAGGTTGAA
GGAGTGTATAAAAATTTCATGTAAAAGTACATAATGCTGTCCATTCTGCCATTTTCTGTG
CGTTTCAGTTCTATTGAAAATGCTAATGGCTCCCTCCTTAACTGATTGCACAGTAACCTA
ATGCTTTTTTTAATGTAATGCACAGTAATGCTTTTTGGAAAACATTCTTAGATGAATAAG
AGAATGGAGAAATTAAACAGGGTGGATCCAGGTTTTGAGGATCCTGAGTGATTTACATTG
GTTCATGCATTGTCCCTTGGGGAACTGAGAAAATATGTGACCACATTTCCCCCTGCTGTT
GAGGCAGTGAGGGGACCCCACAGCTCAAGCTCACAGTTAAGTCTGCCACTGGCTCTGCAG
GAGCAAGTTTGGGCGAGTCTACCACCCCCTGTGAATCCAGTGTGCAGGAGACCAACCCAC
GGCGTTACCCCGTGCCGCAAGTGGTGACACC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1016, 1890..2056, 2954..3072, 4598..4843, 5574..5702, 5811..5976, 6256..6350
1924..2056, 2954..3072, 4598..4843, 5574..5702, 5811..5976, 6256..6347
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved