Equus_caballus Locus GNL3
snOPY snoRNA Orthological Gene Database
Equus_caballus GNL3
Equus_caballus
GNL3
16
SNORD19, SNORD19, SNORD69
3087..3163, 3986..4060, 5195..5271
7892
TTTACCAAGCCGCTCCGCCGCCTGCAGCCCCTGCCGCGGTCACCGACCGCCGCGCCCCG
CCCCGTGGCCCGCCACGCTTGCTGCTATTGCTCCTCCGGCCGCGGCACGCTGCCGTCGCT
CAGCACCCGCCGCCCTCAACAACCCTCACCCCTCCCGTTGCCGCCGCAAAAAGAGGCCCC
GCGGCCGGCAAAGCAAACCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTCCTACCTTGTGATTCGTGGTGTTTGACA
AGAAGTGGCTGTCGTTATGGGTCTCAGATGGTACAGTCTCAGTCTAGTAGGAGAAGAGTG
GGAGCAGGGGAGTTGGGCTCTACTCCGGATCTATTTAGTCACATTCTCTGGGATTTGAGA
GTAGCATGCGTATTTTTTTTTTTATGAGCCCCATATGATTCTCAAATTTGGTTTGAGAAT
TAGTTAATTAACACAAAAATGGACGTGACCCCAGAGCACAGTCACCAAAAACTAACATGG
ATTATTTGTCTAATTATTTTGTGATGTATTTCTTTGTAGAGTTAAAGAAGGCAAGTAAAC
GCATGACCTGCCATAAGCGGTATAAAATCCAAAAAAAGGTAAGTCTTGTGCTTGGGAGAG
CTATAGCAAATATAATACTAAACTGATTTCTGCCCCACGTCTCTATGAGGATGTCTGAAT
TAATATGATTTTGCCTCAGGAAATGGAGGTTGGATAGACTGACCATGGATACAGACTCTT
AGGGCATCAGGAGTACAGCTGTGGAAAAATGCAGTAATTTGGTGATAAGAAAGTCTGTAA
ACTTTGATCAACACCTTAACTTCTGCAGAGAAAATCTGGTGACATTTTCTTGCCGTTTAT
AAATAAATATGTGTAGTCTCTATGATTACACTCAAAGTTCTATTTTTCTAGATCATTTTA
CAGGTATAAGTAAACAGATGGATTCGTTTCTCACATGAATTCTGTTTAATATTTTTGTAA
ACTGATAAAAACTTTTATTATAATAGATTCGAGAGCACCATCGAAAATTGAGAAAGGAGG
CTAAAAAACGGGGTCACAAGAAGCCTCGGAAAGACCCAGGAGTTCCAAACAGTGCGCCCT
TTAAGGAGGCTCTTCTTCGGGAAGCTGAGCTAAGGAAACAGCGGGTAAGATACATTAGCT
GAAACTTCGAACAAGTGACATATGGGTACGTATATTTTGTCAAAGTAAAGTAGTAACACC
AAGTCACTTTGGCTCGCCCATTTCTCTTATGGCTCGGACACAGCTTGAAGAACTAAAACA
GCAGCAGAAGCTTGACAGGCAGAAGGAGCAGGAGAAGAAAAGAAAACTCGAAACTGACCC
TGGTGTTAAAACATCTAACTTGGAACCTGTGAAGGAGGTATGATTAGGTCTCTTTGTGAA
TGAGAGATGAGTTCTGATGTAGAAGTAAAAGCACATAACTCAGCTAGGGGCTGCTATTCC
ACTTGGGGGAAAAAAGACTGAGTTCAGACTCTGTTTTACCTATTTAAATACCGATTGCAG
CCGTGGAAAATGGAGAAACAGGTTATAATTGCTGAACTTGCAATTTTGTGTCCTTTTTCC
CTTGTCTTTATCCTCTAGGAATATGGACAATGCAAAACTAAGAACAAAGCCAAGTCAGGC
AAACAGCATCCGAAGAAGTTGTACTGTCAGGAACTTAAAAAGGTATCTTATTCTAGGTCA
GTGTCCAAAAATGGTAATGAGGTTTAAAACACTAGAGTCATTCCTTTTTCCTGACGCCAG
CCTTGGTGGAAGGTAGAGTTCATTTGAGCTGGAGGAATCCTTCCGCAGGTTGGCTTATCT
CACTGAGGGCCTTTTTTGTTAGGTTTAGTTGAAGGAAATATTCTTGTGGTTTTAAAATTT
TGCACAGGAACCGTTCCCTGTAAGCATGATTTACACAAGTGTTACTTTGTGTTAAAGTAA
CACGTTGACAGTGGATTTTAAAATAGAGGAAAATACATTAGAGTAAGCAGTGTGAAAATA
AGAATCTGTAAAGTACTCTGTTGAAACTTACGTGAAGAAGGTCAAGGGGGTGTCTTGGTG
TAGTTGCTCCCCGGCACACCCATCCTCAGCACCTATTTTCCCAAGCTTACTCTCCCTCTG
TTAATACAGCCTGATTGTGCTTCTCAGCAGCTGTCGGCAGGACACAAGGGCCCATCAGAC
TACATAATTCACTATGGGAGGATTATATATATTCAGACAGTGGAGCAGTGTCCACTTTTG
AAAGCCACTTTGATCAGAGGCCGCCAAGCAAACCTGTGTTTTACTTTCCTGTGAGAAATG
ATGTACATGTGAACATTATTCATACCAAAGCGAAGACATGAGATCCAACTCTAAACTCTC
CCTGTTGCAAACTGGATAATGCCAGTATACTTTGTAGAGGGTGTTCCCAGAGCAAGGGAT
GCTATCTTGTTCTCATAGTTTCTATCTTGACAGGTGATTGAAACCTCAGATGTTGTGCTG
GAGGTATTGGATGCCAGAGATCCTCTTGGTTGCAGGTGTCCCCAGGTAGAAGAGGCCATT
GTCCAGGGTGGACAGAAAAAGCTGGTACTTGTGTTAAATAAGTCAGGTGAGGAAAAGGGC
TGCCCTTTATGTCCCATATGCACTAGTGAGGTATGAGGAAAACATCTAAACAGTCTGATT
GTCACTGAAGACTGATAAGATCCAACTCTGACCTCAGCAGAGTCAGTGCGTATGCTCTCT
TGTTGCCAAAGACAGCTCTGGCAGTGGGATGGAGTTGTTTCTCCAAGTGATTTGCCTGGT
TTCTATGATTCTTTTGCCATTTAATACTTACCACCTCATCTTATTTAAGAGTGTAAGTTG
CTATATGCAGCTTACTGTGCAATATATTTCACATAGGAAGTGATGGCAGTGTGCCATATT
CCCCATACCTGCACAGTATTTAGAGGAAGTGTATAGTTACGTGTCTGAGTTTGAGCAGCA
GGAACGAGAAAACGCAGAACAGAGACTTGTGAAGCTGGAAGTAAGAATGGGATCTAAAGT
TACTGTTGGGGTCTGCCTACATGGTTGCTACCTGAAAGTGAATTCTGGAAACATAGCCCT
AGGTTTTGTAGGGTAATAATCTAGAGGTTGACATAATCCTGAAAGGGTGAGCACTGCCGA
GAGAAGTGAAGAAATACAGAGATGGAGTCATTGAACTCTGTTAAGATAAAGGCAGTATGG
TAGGGAGCTTATTCTATCCCCATCTTCCAGTTAAACTCTTTTGGAACAAAGCTAGGAAAA
GGCAAACCAGAGTGAAATTCATAGTTAACCAGATTTTGCAAATTCATCTCAACAAAATGA
CCTAATTGGAGCATGTGTCATCCTTCTAATCTCTATCAGATTTGGTACCAAAGCAGAATT
TGGAGAACTGGCTGAATTATTTGAAGAAGGAATTGCCAACAGTGGTGTTCAAAGCCTCGA
CACATCTGAAGGACAAAGGGAAGATCATCAAGGTACCTTTTACTGTTAATGGTGGGAAGT
GCAGTTCTTTCAGATTTTGGATGGCTGAAATATGATGAGTCTACAAAATCTTGATTAAAA
AATGAAAACTTATAAGATCCAACTCTGATTTCATCCAGAGATAATCTGAAAGGCAATAGA
AGGTGATGATTTTAATAGCTGGGCTGTGGAGCCAGATTGCTTGGATTTTATATGGTGGGT
TGTCAGACATAAACTAATTATGTGGGATTTTAACATGTGAAGGTAAGGAAGAAAGCTGCT
TCATTCAAAAGAGAAGTCTGTGTTGGGAAAGAAGGCCTTTGGAAACTTCTTGGAGCTTTT
CAGGAGACTTGTGGCAAAGCGATTCGGGTTGGAGTAGTTGGTGAGTTTTAGTTTAACACA
TTTTATGTCTTAAGAGCTAAGAATTTTTACATGTTAACAGTGTATGGGGTTGTTGCTAAA
TAGTTTGTTTAGACACTAGCTTCTTGCCCACCTTACCAAACACACAGGGTAAAAGACAAA
AATTTTTAAGTAATTATTGCCTAATTCAATTGTTTGACAACTGGCATTGTAGGAAGTTGG
CTTCTGAAAGCTTTTGGTTTATTTGAAGTAATCAACTTTCTCTGCTCTTTTATTATTTGT
GCAAGAAATGAAGATGCTAAGATTGGTCTTAGTGTTGAAGTGAAGACACTCAGATCCAAC
TCTGATCTTGCTCTATACATCAGGCAAGCATAAAATAAAACTGGAAATTTTATAATTATC
AGCACATAATGCCTTTTGTACTTGGATTTCCCATTTGTAGGTTTCCCAAACGTGGGGAAA
AGCAGCATCATTAATAGCTTAAAACAAGAACGGATATGTAATGTTGGTGTATCCATGGGG
CTTACAAGGTAAATTAAGTTGTTCCATGATTGTAATGTTTCATTATAGATGAGTAAAAAT
GATTTTGTTTTGGATAGCTTACGAATTTTCTATTATCTCTTTAGAGGAATCAATGAAAGG
AACAAGATTGAGCCAGTGCTAGGCTTGGGGAAGCATTGCTGGAGTGGTATAGCTAGCTGC
CCACAACCTACTTTGCAAAACAAATAAGCAAATAGGTTCAGAGAGGGGAAGCCTGCCTCA
GAGGAAGTGATGCTTGAACCTCACCTTGAAATGAATTCTTCCAGATAGGAGAGGGGAAAT
ATTTATGGCAGAGAAACAGCACGTTTAGGTCGATGTACAAGCTATACCATGTAGTTGTTT
CTCTTTAGGAGGGTGTGCTGTTAGGGTCTTAGATAAACATGAAGCAAATGATGATAAACT
GGATCTGACGGACTGTGCTGAGTTTGTTCAATCCAACCCTGAGCTTCGTGTTCTCTTGTC
CTTCAGGTAAACCAGTGCCCCCATCAGTCACCATCTCTCTTGTTCCAGGAGTATGCAGGT
TGTCCCCCTGGATAAACAAATCACAATCATAGATAGTCCAAGTTTCATTGTGTCTCCACT
TAACTCTGCCACCGCACTTGCTCTGAGAAGTCCAGCAAGTATTGAAGTAATAAAACCAGT
GGAGGCTGCCAGTGTCATCCTGTCCCAGGCTGATAGTCGACAGGTAAAAGAACCTTCTTC
CCTTGAGGTCCATTTTCTTTTTCATCATTAGCATTTTTAGTAGAAAATTTTCAAGTTTGT
TTTACATCCGCACTGACAGTTCCTGTTTTTCTTTAAGGTAGTACTGAAATTTACTGTCCC
AGACTTTAAGAATTCTCTGGAATTTTTTACTTCACTTGCTCAGAGAAGAGGACTACACCA
GAAAGGTGGAAGCCCAGATGTAGAACGTGCTGCCAAACTGCTGTGGTCTGAGTGGACAGG
GTAAGGCTTCTTTCTGTTGGCAATTTGATGACCACATAGAATAAAGGAACTGATTTTTGA
CAAGTCTTGTTTTTAATACCAGTGCCTCCTTAGGTTATTATTGCCATCCCCCTGCATCCT
GGACTCCTTCTCCACATTTTAATGAGCGCAGCGTCACAGACATGAATTGGGGCTTTAACC
TGGAAGAACTGGAAAAGAACAATGCACACAGCATACAAGGTAAGGAAGGCTTGTGTTTGG
CTGTTGTCTTCATTGGCAAATAGGCCAATCAAAGGTCTCATCTGTTTACATGGGCTGTGT
TCCTTCCCTAGCTATCAAGGGCCCTTGTTTAGCCAGTAGCATCCTTTTCCAGTCTTCGGG
TCTGACAAATGGAATAATAGAGGAAAAGGACATAGCTGAAGAATTGCCAAAACAGCAAAA
GAGAAAGCAGGAGGAGGGGGAAGACTGCGGAGACATTGATAGCGACCCGGAAAACGTTGA
TGAAGAAGCTGTTGTAAGTATGTTGTCCGTGAGTTGTTTAAGCTGAAGTAAGTTTTCTGG
TATTATAATGTACAATAAATGGGAAGCAGCTGAAAGTAGAAATTAGATACTTCATAATAG
GCTTTTTTTAAGCCCCATGCAATTCGGGTATTTAAGCCTTGCAATCATTAGTCTTAATTT
TTTGCATCCCATTATATGTACCTTCAGACTTTTTAGGTACATAATTACTTGGATTAATGA
GCAGACAAAGGCTACTATCTAGCACTGTTTCTTTGTCCCACAGGAAAAGAGCTCAGACAC
GTGCCCTGCAGAAGAGGCCTGGGAGGCACTGCCTGAGGAGGTTCAAGCAGGTGAGTTGGG
TTATTGGGGTCTTCTAACACAGCAGCGTGGTGTAGAATTGCTTTTCTTTTTTGACCTCAC
TTTTCTTTCCTCCAATATAGATGAACAGTCTGCACAATCTCATGTCTTAGATAAAATGAC
TGAAGAGGAAGATGATGCTTATGACTTCAGTACAGACTATGTATAACAGAACCTTGTCCT
TTTGTAAGAGTTTTTGTTTTTAATGTTTTGAGGAGACTCCTAAGCTGTTAATAGGTGTGT
GGTGTACCAGTTTGTTACAGTATGGCATATGCTGTATAAATTTTGTGAATATGTATCAGT
ATATATTCATTTTTTAAAAATCAGGCGATTTAGAAAGTGTCTGAATTCTGTAGACAACTC
GTCTCTTAGACCATGAGTGAGTTGAAGTACAGTTACCTGGCAGCAAAAAATCAGATAGCT
ATTGAAAATGTAAGTAGCACTTTATTTATAGATCAGGCCACAGGTTACAAAATTAAAACC
AAGCAGTAGTGTTGAACTAGCTGTACCAGCCGTATCAGTCCATTCACCTCTGGTCATTCA
GCACGGTAGTAAGCAAACGCTTGGTAAGGCAGATGGAGACGTATTTATAGTCTGTCTGGG
AAGCTGACTGCCAGATGGAGCAGTTTGTCCTCTTTACCCAGCTGAAATGCCCCTTTTTCC
ATGGGTTGCTGTAGATAGGCACTGGAGTCTAGCAACTGTTACTTCCCACACATACTGTCT
TCTAGGATTTCCTGAGAAATGCTTATTGCATAAATTATATTTTACTTTATATTTGAGATC
TCCGTATGTCTTCGGATTAGGCTGAATTTGCCTGTTGGGTCTGGAATATACCATTTTTCC
CAGACATCAGTGTATGAAGCAGTTCTTCCCCATGGCTTAAAATGCCCATTCCAATGAAGT
AACTTGGCAGCCTTTACAAACTGGGGTGAATATCTTTTTCCAGCACTGGAACCTTTCATT
GAGAGAAAAAGAGCCAAGTGGTTGTACTAGTATTAGTCACACACAAGACAATGGCACATC
AAACTGCAGAAAACTTAAAGGAAACTGGATATATCCTATCCTTGAGGATAGTCCTTTAGA
GATTTAATTATTAGCTTAGGCCTTTGGCTAATTATTTCTACTTACCAAGATGGCGGACAT
TCCACATTGGGTCAATGGTGGAGTGCTGTTGATAAAATACAATCAGCAGTGGAGGTGTTG
TGATGCTGCCAGCCAGTGTTCTGCTATACAATCCCTCTCTTGGTGGGACAGAACAAATTT
AAGCTGTTAGTGAAGAATCCTGACCAATTCCTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1057, 1466..1603, 1723..1836, 2058..2141, 2913..3045, 3819..3943, 4182..4299, 4720..4807, 5328..5502, 5617..5759, 5842..5978, 6071..6252, 6523..6589, 6680..6892
1001..1057, 1466..1603, 1723..1836, 2058..2141, 2913..3045, 3819..3943, 4182..4299, 4720..4807, 5328..5502, 5617..5759, 5842..5978, 6071..6252, 6523..6589, 6680..6762
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved