Equus_caballus Locus ENSECAG00000007201
snOPY snoRNA Orthological Gene Database
Equus_caballus ENSECAG00000007201
Equus_caballus
ENSECAG00000007201
16
SNORA7
2128..2267
7445
CATCTGACTTCCCACAGGCCCGGGGATAAGCGGGGTCCGTGAGGTGGGGTACAGTCACA
GACACAATGGGGCTTTAGTCTCAGTCCTACTGTTTGCCAGCTGTGTGACCTCAGACGAGA
CATTTCACGCTTCACCTCCCTGGGTCTCCTCAAACTCCCCTTCCCTTCACAGTCAAAATC
TCATGGAGTTGTCAACACTCGCTTCCTTCCCTTCTCACTTCTCATTCAGTCAACAACACA
ATCCCATTTAGCTTCTGTCCCCATCTGGCTCTGGGAACTACTCTGTCAAGATCACTGATT
ACATCTGTGTTATGTTCGAGCTGTGGAATCAAGGGACGTTTTCTGTCTCCTGAAATTAGA
TTTTCACAATAATCTTAAAAACAAAAGTTAAGCAAAACAAACCAAGAGCAACAATATAGA
TAGTTTAGCCTAATGGTTAGAAGTGTGGATTTTTGCAGTCAAATCTCCAAAATTCATTCT
CTACATATGTAAAATAGGGAAAATAATAGAACCACCTGATAGAATCGTGGGAAGGAGAGT
AAATCCCTTTGGATGACAGCCGTTGTACTCATTGCTATTTATAAATTCACGTGAGGGAAT
TATTAGGAAGTCTTTGTTTTTTCCCTCTTGGCCACTAAGAGGTGCGCTTTAGACAGAAGA
AACGCGGGCGGAAATACTCTAACATCTGGCTTATCCTCCGGAGGAGCGGCTTCAGCTTCT
GGCGGAAGTGGATGCCCGCCACCAGGTCTTGGAAGCTCAGAAAGAACTCCAAATTTTCTA
TGGAGTCCCAACGGCAGGTATGAAGAACTTTCAATACTACTCCTAGATATTAATGTCTAG
GAAAACACAGGTAGCCTTCGGCTTTTTTTTCAGTATTATTTCTCTGACATGTCTTTATTT
TCTCTGAAGGATCAAGAGCCGGAAGTGCTCGCCTTTTCCCTGCCAGGACCCTAAGGTTAA
GTCCCGTCAGCCCTCGCGAGCCACCTTCCCATCTCTTCCTCGGCGCTCCCTACGGAGGTG
GCAGCCATCTACTCGGTAAGTCTTAATCGTTGGCCATCCGCGTCTCTGCGGTCTCCGTCT
GGTCCCATCGCTCCCTGGTGAGGAGGTCTGTGCTTCCGAGCGGTCGTCTCTGTGGACGTT
GTCCTTGTCGGCTGGCTGGAGCGCGTACAGGAGCAGAGCGAAGCGGCCCCGCGGGTGATG
GAAGTGTGGTTCCCTGGGCTCTTTGCCCTCCTACGGAGGCCGCCTGGGGTCAGTCAGACC
TGCTGACCGCTTGTTTGAGCCCCGAGGGCGAGGGCGCATGTTGGGGCCGTATTAACGGGG
CTGAGAAGCGGCCGGGGGAGGTCCGGCCTGACGGCCCGGGCTCGAATCGTGGGATCCCGT
CGCCTGGCGATGTCCGCCCATGTGTATCTATTTCCGCTTCCCGACGCTGCTTCCCTCCCA
GTTTCTGGCCTTGCGGTTCCTGTTGCGGCGGGATCGCCAGGGAAAAAAAAAACAAACCAG
CTGCGAGTCGACTCGTTCAGTTAACGAGTTCCGATAGGGGGTCAGGATCTCTGGGAATAC
GGAACTGCGGCCTTGTTTTCGAGGAGATGGTACCGGGGGCGGAGGGAGTCTTTCGTTAAT
GTAATGCATGTGCATTGAGTACCTACTGTGAGCCGAAGAAAGAAAGCGAAGGCTGTGAAG
AGAGCAAAAAGTGTGCTGCAGTAGGAAAAAAGAGGGTAGCTGGGAAGACCACCTGGAAGA
GGGTAACTTTTCAGTTGGTGCTCAGGTGATCTCCAGGTAGAACAGTATGTGCGCAGACGT
AGGGGCATTTTAAAAGGACGACGTGGTTTCGTCTAGCTTTTGAGATACTGCAGAGCTGCT
GCGCCCGCGGGGCGTTACAGGTTTCTCTTTACTGAGCCGCCCGGTCCGGGCCCTGCAGGC
CTTGAGAGTGCAGTATCTCCATTTCACAGGTGAGAAAACAGACTCAGGTTCTTGTAGATT
CCCCGAGGCCCGCTGGACCATCTCGGGGGTGGGACACGCTGTGGAGTGCCATTTGCTGCC
CCTGCAAGCTAAGAACGTTTTGGGGTCAGTTTGTTTGAGGTCAGCTGTTGGCGTTCTTTC
TTAGCTTTGAGTGGGTGAGGTGATCCCTAACCTCCCAGGATCGCGTCTGGAGAGTGGCTA
GTATTCTGCCAGCTTCGGAGACGGGAGGGAAAGCAAGCCTGGCAGAGGCACCCATTCCAT
TCCTAGCTTGCTCAGTAGCTGGTGATTGGAAGACACTCTGCAACAATGTTGAAGCCCTGG
GCCCGAAAGCTGCCTTCCCGGACTCTAATTTGACACAGTCTGTGCCTCTTTCTTGAAGGC
GTCATGGCTGCCCTCAGACCCCTCGTGAAGCCCAAGATCGTCAAAAAGAGGACCAAGAAG
TTCATTCGGCACCAGTCAGACCGATATGTCAAAATTAAGGTACATGCTCTTGGGACGGGG
TGAAGAAAGGCCTTCTTAAATGGGCTGTTGGATTTCTGACATCATCTCGTGGGAACATTG
CCTTGGGCAGATGAACCGATCTGTGGTTGGTGCACAGGCATTGTGTAGAAACCCAGGTCT
CCCAGTGTGCTTTACTGGCACTCAGTCTTTTGATGTGTAAATTGAAATTGAAAAGGAACA
GCTATTTTGAGGTGTCTAGAGACTTAACGATTGTATCATATTTCGGGTGGTGGTCTGACA
GTATGAGAGGTGGATAATCCTTATTTTATAGATGAGAAAACTTAGGTCTTAAGTGCAATG
TCAAAACCTGTGCTCGGGTTGCTGTAGTCTGCTTTGGCGGCCCAGGGTTTTGCTGGTTCA
AATCCTGGGCGTGGACATGGCACCGCTCATCAGGTTATGCTGATGCGGTGTCCCACATGC
CACAACTAGAAGGATCCACGACTGAAAATACACAAGTATGTACCGGGGGGGCTTTGGGAG
GAAAAGAAAACATAAAATCTTTAAAAACAAAAAACACCCCGTGCTCTTCATCTTACTGTA
TACATAATTCCCTCACATTCCACGGGTAAAGGGAAAGTCTGCTTTTCCTTTGCTTAGGAG
GAGTGTGGGTGTGCATCTGTACTCCCGGTGGTCAAATGCAGGAGCCTCTATTTATTTTTT
TCCACCCAAAGAATATAAAGAAGTAGTGAAATCCTGTTACCCAGAGAAGACTACTATTTG
GCATATTTCCTTTACATTTAGTCCCGTTTTTCCTACAAAAGGAAGAGTTGGCAGTCTGCA
CAGACAGTGACCCTCCTGTGTTTTCTTTCAGCGTAACTGGCGGAAACCCAGAGGCATTGA
CAATAGGGTGCGCAGAAGATTCAAGGGCCAGATATTGATGCCCAACATTGGTTATGGGAG
CAATAAGAAAACGAAGCACATGCTGCCCAGTGGCTTCCGGAAGTTCCTGGTCCACAATGT
CAAGGAGCTTGAAGTGCTGCTCATGTGCAACAAGTGAGTTGGGTCCCACTGGGTTCAAGT
GTCAGACGTCTACATCTGTGTGAGCATTTTTGGCAGGCATTCTAGACCTTTTAGAATGCT
TTTGGAGGAGTTGTATGTCCTCCCAGGAGCTTAGAGAATGCTTGTTGGGGACTTAAAAAT
GTTTCTTTTGCTGGGGTGGGGAGGATGGGATAGGACTTGTCCTGAAAAGCAGAGGCCCAA
GACTTGGAAAGAGAAGGACTTTGCTTGACAGTACAAACACTGCAGTATCCCGCTGGCTGT
CATTTCCAGAACATTGCTTTATTTATGTGGGAGGTAGTGGGGAGAACACACTTAGCCCCA
GAGCTAAGGGGTGCTGCACGCGGGGGCCGCGGGCGTCTTCAGAGGCCTGCAGGGATGGAC
GGGTTGCTGCATGATTTAGGGCTCAGTGTGATCTGAGGTGGAGAAGAGGAGGGCTTTGTT
TGCAGGCGCACCGGCAGTTCACAGGGTTACTTCCAAGTGTGTTGAGAAAGTTAGACACTT
GGTGAGCTCTGTAAGAGACATTTTTGGTCTGCTTAGGCCACAACTGGAGCAGTGGGCTGA
GAAAAGATTTCTCAAGGCAAGTGATTTAGACACTTTGAATCTGGATTGGAGGGAATGGTA
TTTTTTGGTTAAGCAGAGGACACTTTACCTTCTTCCCTTCCTGTTAAACAAAAGCTAAAA
ACCTGTGGGTGTGTGTTTTTAAGCAAATTAGTAAGGATATGGACAGAGGGTGACTAACTA
GTAACATCTGGGCATGTGTGTGTTAGAAAGATCTTTTATCTAGAGTGATTGTGGACACAA
ATAATAAAAATGAATGAAACTTTTATTCTCACCTTTGGTTGAGTTTCTACGTTGGAAATT
TAACCAGGCATTGAAATGCTGGCAATTTTATTTAGAAAAGGTGAGCATAGGAATTAATAG
TGGATCTCCAAACCGCAGTAAACAGGTTGATAGAGAATTATGACAGAAAGATGCAATTTA
ATACCTTTTGTGTGGTAAAAATGATTACCATGCAAAAATGTTGCTGGTTGTCATAAAGAT
GCGTTTTTGTTGTTGTTGTTGTTGTTTTGTGTTTTTTTTTGTGTGCTGAGGAAGATTATC
TCTGAGCTGACAACTGTGCCAGTTTTCCTCTCGTCTCTTTTGTATGCGGGTTGCTGCCAC
AGCATGGCCACGTGTAGGTCTGTGCCTGGCATCTGAACCCACAAACCCAGGCCCTGAAGC
AGAGTGTGTCAAATTTAACCACTACACTTCAGGGCTGGCGCAAGATACTCTTAATAGCAG
CTTGGCAGTTTGTAACAAGAGCCATAGAAATACTCTGAATCTGTGCCTTTTAATTCACAA
GTTCATCATTTTGTGGCATTTATTCTTAAATAAAAGCAGAGAAACTTTATAAGCTGATCA
TTGTAGCAGTAACTGAACAATTGAAAATATTGGTGAATGGTGAGAGTACAAGCACTGGGT
GGAATGTTATGCATATATGAAAAATGATTGTCATGTATGGAAAATGCCCATGCAGGGGAA
AGTATTAAAAGTGATAGGTACAGTGTGATTGTGATTTTTAAATACACATGGATAAGGACC
TGAGTTTTTGAAAAATGAAGAAAACATGAAAACTGGGGCAGGCTCCATGGTGTAGTGCTT
GGGTTCGGCATGCTCGGCTTCAGCAGCCCAGGTTCGCAAGTTCGGATCCCGGGCTTGGAG
CCCTACCACTTGTCAGCAATGCTGTGCTGGTGACGCACATACAAAGGGGAGGAAGGTTGG
CACAGACGATAGCTCAGACCTAATCTTCCTGAGCAAAAAAAAGGCACAAAAAAACATGAA
AACTAATACAACTTAAGTCTTAAAGATGATGGGAACATTTTAAAATACAGCTACTTTGAG
CTTGAATGGACTTCTTTATATAAAATAAGAAAATTCTTTGGATTTGCTTGTTTCTAGATG
TTAAAATATTTTCCTGCAGAGCTCTTGAACTGTAGATGCCCACTGCCTGTCGTCTTTTCG
CTGAAATTCCTCCAGGGGTAGAGTGTTGTCTTAATCCACTGTTGGTGGCTTCACAAATCA
CCTCCTTACTGAACTGTGCTCATTAGGCTGGTTTGTCATCAAACTGGGGCATGGTGTGGC
TGTAATGAATGAGTTAGAACAGGATCTGGCACACAGGGACTCAGGAAATGTTAGGTGTTG
ATACTCACTGGGTAACTTTAGGCAGTGTTACTCCTCAACTTGAATTTTGTCCACAGCAGT
CAAAATAAGACGTTTGTGGTCTGAGCCAGGGAGCCCTTGGCTGAATCAGATTGTTGGATT
CTGCTCTGGATTGTCTGCAGAGTGTTCTAGAACTTCACGGGCAAGTCTGAGACTGCCCTG
AGTGGGGCAGATTGGCCGGAAGGACTGAGGGAGGGAGAACCTTGGAACCTGGAGTTGGGC
TGGGCTATCCTGGCCCTGTCTGGTACTTAAGACGTGACTTAGGGATTCACTTGCACCTCT
GTGGGCCTTGGTTTCCTTGTCTGTAAAATGGACGCACTGCCTGGATTACAAGGCTGCTGC
GAGGACTGAATGAGAGGGGACGAAGAGTGTGCTTTTTGTCACTACCAGGGAACACTTCAA
GAGCCGTGCTGCTGGTACCATGGGATTAGGAGTTGTGATTTGGGGGCATGCCGGTCTTGT
TCAGCAGCCATTTACCAGCACCCTCTCTGCTCAGTACTGTGGCTCTGGAGGTGAAGTGAC
TGAAGCCGTTGCCTTCCCAGTGGTACACAGGAGTGTGTGTGTTCCAGGCTGGCTTGCTCC
TTACTCACTCACTGATTCTCTTCCAGATCGTACTGTGCTGAGATTGCTCACAATGTCTCC
TCCAAGAACCGCAAAGCCATCGTGGAAAGAGCAGCCCAGCTGGCCATCAGAATCACCAAT
CCCAATGCCAGGCTGCGCAGCGAAGAAAACGAATAGACGACAGCTCGTGTGCGCATTGTA
TTTGTGTTAATAAAACCATGAAACTCTGCCGTCTGGCAATTCACCCGTGTTTTACTCTTC
AGTTTCATACTTTGACAGCCTGTCACAGAGATTGGTCTTATGCCTGTTAGTACCCTGGAA
TCTTAGATCTGGAAGGAGTTCGTGAAGGTTGCTCCATCCTTCACAGGGCACAGACCTCAG
GTGCCCAGACCAGCCTTGGTCTGCTCCAGCTGGGGCGAGGGGAGGGGAAGGCTTGGCCCT
GAGATGAGGGTGGGTTCTGAGACCCCTGATTAAAGGACCTCGCAGCTCGGAGCAAGTCGT
CATTCTTAGCCTCAGTGTGTAAAGCTGGGTAATGGTTACCCTCTGTGGTTCTTGTGAAGA
TTGAGAACACGTACATGAAAGGATCTGGATGGATTTTTTCTTAATCCCTTAATGCTTGCT
TGGTGCTGGAATAGCACCCTATAGTTTATGTCCAAAAATGTACAACAGGATGACACACTC
ATCGCCCCACTACGGAAGAGCAGCCTCGGACGACTGGAGTATCTTCAGTCTCCCTCATGG
TACCCGCCCCCAACTCGCTGCTTGCGGGCTGAGTTAACAGCGGGTTCTGAAGCTGTGGGG
TCCTTCACTGGTGACAATCAGGCCTGTATGCTGGAACTCAGGATTTGACAAGCAAGCTCC
ATTTTAAAGTACAGCCCTAGAACTCAGGCAACAACAGCTAGAGTTTCGCTTTTAATTAAT
TATAACTGCTTTTCCAAGAAGTGGTATTAAGTGGCAGTGTAGGTCACATGGGGTATGGCA
TGTGGGCTCTAGTACGGGACAGATGTTTATGGGGTGTTTTTGTTTGCACCATCCTGGTCA
AGTGAGCAGAAATACTATACTGAAGATAAATTTCTTGGTGTGCTAGCCATGATTGGGTGT
AAGTCCCTTAGTTCCAGGAGATAAATGTCTTCCAGGGTGATTGCCTCCTATTCCAAACCT
AGGCTGAACACTTGGTGAGTAAATGCTGGTCATTTCCATGATTTCTTTAAATTGACTTGG
GAAGGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1034, 2338..2438, 3271..3452, 6266..6445
2343..2438, 3271..3452, 6266..6392
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved