Equus_caballus Locus RPL4
snOPY snoRNA Orthological Gene Database
Equus_caballus RPL4
Equus_caballus
RPL4
1
SNORD18, SNORD16, SNORD18, SNORD18
2640..2711, 3086..3184, 3657..3728, 4650..4719
6933
AGAAGCCAACACACCGTCACCTCATCCTTACAGCCTCAGTTCAGATGATAACTATCTTG
AGCAGACAATAACAACACTTTTCACACCGGCAAGGCTTTAAACAGGTGAAGGATGCCAAC
ATCTACTTTTCCATACCCTGGGAGGGGCTTCCAACACATCGCAAGTTGTGTGTATTATCA
GAATGAATAAAGCGCCTCTTGTAAAACCTGTCACCTTCCACCTCGATAACGTACAGATGT
TTTCTCTTAAACGAGACTACAAGCAAGCCCCGACAGGACCAACCCCACTCCAGAGCGGAT
AACTGGCCTCTCCCCGGCTCCCGGACCCCAGGACCGCAGACTTCGTCTGTAACAGCAGCG
CCCGCTAATCCCCAAGGCTGCGGCAAGAGGCTGGGTGCGGCCATCGAGACACCCCGAGGG
AGAAGTGCTGTCCTCGCACCCTGGCCAACAGCAGGGGCTACAACTCACTGCAGGAGACGA
GCGTAAAACTCCTCAGCAGCTCGGTTCGTTCGCGACCACATCCCGGCCCAGTCTCACTGC
AGATCCGAACCCGCCAAACCGAACTGCGCGCCGAGCGGTGACGTCCGGGGTCATGACCCC
CCGCCGGGACTACTTTTACCTCCTAGCAGTCCCCTTTTGTCCACAAAGTTAAACTTTTGT
TTTAGAGCATACAGCGGCTTTTCCTGTCACAATAGTTTTCCATTCCCGTAAGAAAGAGTT
AAAATAAATTACAGTGGTTGAGGAAAAGAACCCCTCCTCTCGCGAGAGTTAGCCACGCCT
CCTTGTGGATTATTCCGCGAAAAGGAGTCCCTTGTTTCTGAGTGCTATTCTTGGCTTTGA
AAGTCAGTAGACACCGCAATTGGACGCATATGAAGAAATAAAACACTATTTTTTATTTTT
GTAGAGCATCAGAGAGATATTTTGTGCCTTTATATTGGTTCTGAGGCGGGGCAAGGTGGG
GGCCGAGTTGAAGGTTACATATAGAGCGGGAGTGCTACGTCCTTCCTTTTCCTGTGGGAG
CCGCCGGGCTGAGAGGAGCGTGGCCTTCTCCTCTCCCTGCCATGGTGAGTGGAAGTCAGC
TCGGCTGGACGTTCCCCTGCTGTCGGGGCTCGGCAGGAATGGGTTGGGGGCACAGGGCTT
AAAATCTTCGGGAGGGAAAGCGAGGGAAAGCAGATGAGGACCAAAGGCGTCTGTTTGTGG
CCGGGAGCTGGGGAGTGCGGCTCTGCGGCAGCCATCTTAGCGGCAACGTGGGCGTCCCGG
CACGGGCCCCTCTGGGAGCGACGCGCGGGGACGCCAGATTGTTCTCGGGCGCAGGGGACC
TTGGCAATTTTAGCTTTTCTTGCATCCTAGAAGGCACGGGTTCTTCTAAAGAGTTGGGAA
CTCTTGGGGCCTAAGGCTGAATCGGGGCGAAAGAGTACATTTTTGGGCCTTTGTCTCCAT
GTGCTGTTTAGTAAGGAACATTTCCATTTTTTGAGAGAGATTTCTGTTAAAGAAACTTGT
ATTTCCTTCCCACCCCCCAAATTCTCGTCTGTGTTCAGCCTAAGAATCGCCTCTAGAAAA
GCTTTCTGATTTCCTTATGTTAAGTTAATGCATTTGGTGTCCCCTAAATCTTCGATGTCT
CAGTGAGCGCATAGTATGGCTAATGTACTGGGAGCGGTCTGTGCCCTGGGGAGTTCCGTG
AACAGAAGAGACAAAATACAGCGTCCTGAGGCTCCGCGCGCGGTTGAGGTGGAAAAAATA
CGCGGTGATGTTGGATGGTAGTCAGTGCTGTAGACGTCGGGAGTGGGAGAGGAGGCAGTG
GTTGGACTTGCACCCAACGGTGATCAGGGAAACCTGAGAGAAGGTGACCAGCGTGCTAAG
AGTGTCTTAGCTGCCTCTGAGGTAGGCAGCGGCTGGCCCTGAGCGTGGGCAGGGAGTATC
TGGAAGAGTATGGGAGGCGAGGGGCAGACTGTAGGCCATCCTCAGGGGTTTAGTTCTGCT
TCCAGGAGGATGAGCAAAAAGTGACACGACCGGTGTTGATACTAGGAAGTTTCAGGAAAT
GTTCAGAATGGGATGCAGGGGGCGAGGAGGAAGTTGGGAGCACAGCCGTGGTAGGCAAGA
TTTGCTGGCCTTTGGGGTTAAGGTTTATTTAGATGGTGACATTACGCAGCGTGTTCAAAA
CTTACGGTATGGTTTTGATCATTTTACTTTGTAAGAACTGCTTTGAAAGTTAGCGATAAA
CCATTCTCTTAAATAATAATGAAAATCATGTGGCAGAACTTGAGGTTCCAAGTGTCCTTC
AAGTGTAAGAAATATTGAAGTTGGTGGACCTGACAAAGTGTTGGTAACAGCCTGTGTTTC
AGCGTTAAGCGTTGTCTGCCTCACCACACTCTAGTCTCTCCTGTAACTGAGCATTTGACA
TAATCGTCTTTTCCTTTTTCCCAGGCGTGTGCTCGTCCACTGATATCAGTGTACTCCGAA
AAGGGGGAGTCCTCTGGCAAAAATGTCACTTTGCCTGCTGTGTTCAAGGCTCCCATTCGG
CCAGATATTGTCAACTTTGTTCACACCAACTTGCGCAAAAACAACAGACAGCCTTATGCC
GTCAGCGAATTAGCAGGTATGGGTCTAGATCTTTCCTGGGTTGTTTTAAGAGCTGCTTAA
CAGCAGTGATGAAATTCCACTCCATTGGTCCGTGTTTCTGAACCGCGTGATTTTCCTGGA
TGTTCTGATGCTGTTTGCTACCATGCATGATAGTCAGATTGGTGTGGCTGGGTAGCTAAA
ACTTGTATTTCTTTCCAATTTCAGGTCATCAAACCAGTGCTGAGTCTTGGGGTACTGGCA
GAGCTGTGGCTCGGATTCCCAGAGTTCGAGGCGGTGGTACTCACCGTTCTGGCCAGGGTG
CTTTTGGAAACGTATCCTTTATTTCACTACCTAGACTGGTCAGCTGTCATGGAATTTAGC
AGACTGGACCTGGTTCCTTCATGTTAGTATCTGGGAAATATTTGTGTCCAGAATACTAAT
GTCCACGTTAGACATTGCTCCAGACAGATTTGAAATTTTCCGGCATAAATGTTTTTACAC
CTTAGGGGCTTGATTTGAAATTTACTTGCAATGATGTCGTAATTTGCGTCTTACTCTGTT
CTCAGCGACAGTTGCCTGCTGTCAGTAAGCTGGTTCAGAAGGGTGACGAAAATTCTTACT
GAGCAAGGCAGTCTTTTTGTAATTCCTAAAATTTGAGAGATGTGAGTCTTAACTGGAAGA
ATAGATGTGTCGTGGGGGCCGCATGTTTGCACCAACCAAAACCTGGCGCCGTTGGCACCG
CAGAGTGAACACAACACAGAAGCGATATGCCATCTGCTCTGCCCTGGCTGCCTCAGCCTT
ACCAGCGTTGGTCATGTCTAAAGGTTTGTAATAGTTTGTGTCATAGGAGTGGTACAAAAT
ATCCCTTTTTTACCTAACCTGACCCTTTTTATTCATATTAATAGTGTGTATTAAGTTCCA
TTCATTTCAGAGTGCCTGACTAAATTTCCTTTTGTTAAATAATTCTGACTACTTCAGTTT
AACACATGACTTATCAGTGAATATATGTAACTGGGGAACCAGTTCAAATAGTGAATTAGT
ATATTAGAAATTTTTCCACGTAAACTTCATGTCACCTGCTCTATTTTTATTTAACTGTCA
AAATGATGAGATTCCACTTCATTGGTCCGTGTTTCTGAAACACATGATATTTGTGGAAAT
TCTGATTTGGTAAATTGTATGCCATTTTGCTTTTGTGGGTTATATAAAATGTTTGGAGTT
TTTCAAAAGGTTCGAGGTAATCAGGTCAGTGGTGATTGGCTTTGTCAGGTCATCGGATTG
AGGAAGTTCCTGAACTTCCTTTGGTGGTGGAAGATAAAGTTGAAAGCTACAAGAAGACCA
AGGAGGCTGTTTTGCTTCTTAAGAAACTTAAGGCCTGGAATGATATCAAAAAGGTAGGTT
TAGAGGCCAGCCCGATACCGCAGCGGTTAAGTGCACACGCTCTGCTTCAGCGGCCCAGGG
TTCGCTGGCTCAGATCCTGGGTGCAGACATGGCACCGCTTGGCATGCCATGCTGTGGTAG
GCATCCCACATATAAAGTGGAGGAAGATGAGCACAGATGTTAGCTCAGGGCTGATCTTCC
CTCCCCCAAAGTAGGTTTAATGAACACATTGACAGTTTGATAGTCCTTCGCACAAATTTC
TTAGGTTTCAGAAGATAAGTGAGAGACAGTATAGCTAAACCTTTATGGAAATGAGAGCAA
GGACTCTGGAACCCTGTTACTTGAGTTTGCATCCTGACTGCCATTTATGTCTGTGGGTTA
ATGTTAGGCGAGTCATTTGTGCCTCAGTTTCATCATCTGTAAAATGGAGTGGGGTTTTTT
TTGTTTTTTTAACTATGAAGATCTAGTGGCAGGGATCATATCTTAATCAGAATACTAAAC
GTTCTCACTTTTTACTTTTAGGTCTATGCCTCTCAGCGAATGAGAGCCGGCAAGGGAAAA
ATGAGAAACCGACGTCGTATCCAGCGTAGGGGGCCCTGCATCATCTATAATGAGGACAAT
GGTATCATCAAGGCCTTCAGAAACATCCCTGGTAATCCTTTTACTGCTTACATGTTTGAA
TTGCCCATATAATGCAAGCTTACTCGGCTTTTATTATGATGAGATTCCACACTATGGTCC
GTGTTCCTGAAACACATGATTTTGTGGAACTTCTGATTCTTGGCTGAATGGGTACACAAT
TGACAGTTGAAACTGCATAATGAATAAGGTAGTTTTCAGGTACCTTAGGTAGCACATAAG
CCTAAAGCTGATTTGTGTTTCTTCTGTTGAAATACAGGCTGCCTAATTCTCCTTTCCCTT
TAAAAGGAATTACTCTGCTTAATGTAAGCAAACTGAACATTTTGAAACTTGCTCCTGGTG
GGCACGTGGGACGTTTTTGCATTTGGACTGAAAGCGCTTTCCGCAAGTTAGATGATCTTT
ATGGCACTTGGCGTAAAGCTGCTTCCCTCAAGAGTAACTACAAGTGAGTGTTCTTCATAT
TCATATACTGAATACAGATGTTCATGTTGTGCGTATTTACGTTCAAAATTGGTTTGCATG
TTTTCTAAGTAATGGATTAACATTTCCCCTTATGTACAGATGCGATATGCTGAAATAGTG
AAATATTCTGAGAAGTGATAGTATAGTAGAAATTGTCGATGGTTAAATGATTAAGAATAC
ATCTTCCATTGAGTTCGTGTTCATTAGTCAGTTACATGAGGAACAGGAAGTGAACATCTG
TTGTCAACATTTTCTTTTCCTCTCAGCCTTCCCATGCACAAGATGCTCAATACAGACCTT
AGCCGAATATTGAAGAGCCCAGAGATCCAAAGAGCCCTCCGAGCACCACGGTAAAGTTGT
GATGTTGACAGTAGTTCTTGCCCCGACCTCATACTGCTCGTTATTTCAAAAATGTCGATA
GTATAAATAAAATGTTAATACAGTGTCTACCTTTTTGTAGCAAGAAGATTCATCGCAGGG
TCCTGAAGAAGAATCCACTGAAAAACCTGAGAATCATGTTGAAGCTAAACCCGTATGCGA
AGACCATGCGCAGGAACACCATTCTTCGCCAGGCCAAGAATGTAAGTAATTAATTGATTT
TTGCTGGTATGCCAAGCTTTTAGAAAGATTTGATTCTTAGATTTTCTTCCTAATTTGTTG
CAGCACAAACTCCGGGTGGATAAGGCAGCAGCAGCACTAGAAGCCAAATCAGATGAGAAG
GGGGTTCCAGGCAAGAAGCCTGTGGTAGGGAAGAAAGCAAAGAAGGCTGTTGACGTTAAG
AAGCAGAAGAAGCCTTTGGTGGGAAAAAAGGCTGCAGCTACTAAGAAGCCAGCAGCTGAG
AAGAAGCCTGCAGAAAAGAAACCCGCTGCAGAAGAAAAGAAGCCTGCTGCGTAAACTTGT
TTGTTTATTTCATAAAGGTCACATCATTTTGGACAGCTCCTTTTGAATAAAGACCTGATC
AAAGAGACAGAGAGAAACATGGCTTGTTGGTGTGTCGTGTGAATCTTGGTTAGCATTTGT
TAAATGGCACTTGGTTCTCCATAATTCCAGCCTTTCGGTGGTTCATTTCATAGTCTGGTG
TGAATTGGAGCCTTGGGTTTATACTAAATCCATGCAGTTGAATGGGAAAAGGGATGCTCC
CTAATTCCAGATAGAAAATCTGTTCTGTAACAGTGTCTTGAGAAACAAAAGAGTTGTATT
GGCAATACATACATGCTCTTAGAGTTTAGCCCCACCCCTAACATACCTTGGAAAATGGGT
GACATTCTATAAAGATTGGACATTTAAGTAACCACAAGAGGGCAGAGTCCGAAGTAGATG
GTTCAGAGAAGTGGGTAGGACCTGCTGTGATGGAATACAGTTGGCGGGCACGCTGGGTGC
GCTTTCTGTTCTGACCCTCCATGTCGAAGTGCCAGAATGTTTTTTGGAACCACTTGTGTA
TATCACAGTTTTACTAAGGGATGAATATGTTGACCGAACATGGTGCAGAGAAATGTACCC
AAGAGAGCTTTAGGTTTTTCCTAAAAGTTTTTAATGTGCTCTGTCAATGTGTCTCTTCCT
GCCTTACAGCTGGCCTGCATTTCCCTAGTTTTGTCTCACGGGGTCGTGTTTTGCATCTGG
GTTTTTTCCCATTGGCCATTTCAAAATCCACAGCCAGGACGAGTACAGCCTGGAGATGTC
AGTTGTTTACTATGTGAAGGCACCACCTCCGGATGCTGTTATCTAAGCACAGCTGTCTTC
GTGCTTTTGCCTCTTGGGAAACCACTTTTTGTTTAAAAAAAGATTGGCACCTAAGCTAAC
ATCTGTTGCCAATCTTTTAATCTCTCCATAGCCCCCCAGTATGTAGTTGTATATTTTAGT
TATAGGTCCCTCTGGCTCTGCTATGTGGGACGCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1063, 2424..2595, 2784..2890, 3244..3382, 3828..3952, 4461..4590, 4866..5022, 5306..5389, 5500..5620, 5703..5933
1019..1063, 2424..2595, 2784..2890, 3244..3382, 3828..3952, 4461..4590, 4866..5022, 5306..5389, 5500..5620, 5703..5930
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved