Equus_caballus Locus ENSECAG00000015850
snOPY snoRNA Orthological Gene Database
Equus_caballus ENSECAG00000015850
Equus_caballus
ENSECAG00000015850
1
SNORA74
19042..19245
36580
TTAGATTTTACAGTCTGAAGACAGCGGCCAAGTTACCCTTGTGCAAAACTGTACACGAG
AGACAAGTACAATTCCAGCTGAGACTAACAGCTCTGCACTCGGGGACCTAAAACCTGAAT
TGAGGGAAGTTGTGACTTTCTTTGTAGCTTTCTTTCCAACCAGAGGCTGAAGCTTCACAT
AAACAATCAGACCTCCTTAACGACTAAAGCAATTTCTCAGTCAAACCCGAGGAAAGCAAA
CAGGTGGAGTCTGTTGTTGCCATTTCCAGCCCTATGAGTCACTACTCACGGCTTCTCACA
CCATCAATGGCAACGGGAAAAATATGGTCCATTTCCCCACTAGTATCCTTCGTGGCTCAG
CAAGGGGACCTCAGAGTGGAACACACAAGACCATAAAGGGGTGACTGAAGTCCCTGGTCC
TTAGACAGAGATCAAGCAGAGGTTTGCGCCGAGGCGAATGACAAAGATCTTTATTTCCCC
ACGTACCAAGCGAGGTGGCGCTGCCTCTGTGCGGTCCCGCCCGCCCAGGGACGCAGCCTG
ACGAGGACGGCGGGGCCCTGAACTGCACGGGAGCGTCCTTGGGATCGAGGACGCGCCTCT
GCCTGCCGGGGAAGCTCCGGGCGTCCAAGGCGGCCGGCGGAGAAGTTGCAGAGGTGACCC
AGCGGGGTCGCTTGGTGCAGGGCTCACAGCCGGGGCCCGCACTCATGCTGGGACCCGCAG
CGCACAGTCCCCGGGCCGGCCCGAGCGGAGAGCCTCATTCACTAACCCTGAGAGGGACGG
ACTGCGCCTTCTTCTCGGCGCCTCGCGGCACCATCCCCTCTCTGCCGTTGCCTGCTTCTG
CAGTTGCCACTCCGCCGGCCTCCCGAGCCAGGCGCTGTCCAGTCGCCTGCCTTCCCTCTT
CTACCGGCACCCCACCTGCCTCAAGACGCGCCGCTTTGATCCCGGCTTCCTTCACTTTCC
CACCACCGGAAGGCTGCCGTCAGGCGCTTCCGACTTCCGGGGCGTACACTGTCGCAAAGC
GGAAGTGTGAGGCTTAGCGGGCGCCGGCGCTCAGAAGGTCAGCGTGTGGGGAAGGTGGTG
GTAACGCGGGTCTCCCCGCTGTAGGCGAGGAGCTACGGCCGAGCCGACGACCCCAGCCTG
AGGCGGCGGTGAGAAGCAGACGAGCGGCTTGCTGCGACACCATGGAGGGCGGCGGGGGAA
GCGGCAACAAGACCACAGGGGGGTTGGCCGGCTTTTTCGGAGCCGGCGGAGCAGGCTACT
CGCACGCGGATTTGGCCGGCGTCCCGCGTAAGTCTCGGGCCTAGCTTGCGAACATTTCTG
CCTGGTTCTGGCGACCCGCCGGGCTTGCGGCGTACCCTGGGTTTTTTACTGGCGTCCCGA
GCTTCATTGCGGGTGGTGGGGTTAGTGTGTCTGCGCGGCACTCCGTTAAGACCGAACGAG
TTTTTGGAGCTGTGGATCCTCGAGAAGCTCTGTGATTGAGCAGAACTCAGGAGATGTTGC
CTCTTTTCTTCCTTTTTTATCCCAGCCTCGTGCCTTGTCTTTCGTTTCACACATTCCTGT
ATGTTGGGCTGTGTGCTTGGCCCTAGGTTAAGAGGAGAGAGCCCGGAGATGACTTTTCAG
CACAAAGTCATATTTTAAACCACAAAGTAGCCGTCAGGGTAAAACTCTCAATAATAATGC
ATGTAGGCGAGAAAGAAATAGAGTTGGGACAGCTGGAGGAGCTGGGAAGTGAGCTGAGCT
TTAAAGGTCATTGATAGGCATAAAGAAAGAAGTCAGGTAAGACTTTTAAGAAAGGAAATA
TGCGAGATCGACGGTGCAGAAGCCTTAATACCCTGCCTGTGCCCTCCCTCCGTCCTGTGA
ATGGGTAGTCCAGATCTTTGGGACTTTATAACTGAGAGTATTAAACTGGATGACTAGGAC
TTGGACTTAAAGATAGTAGGAAGTTGATGGAAGATCGCTTTGTAAAATAGCTTTCTGAGA
ATCCTTGTACTGTTTTTCTAGGTCTTTTATGCTCAAGAATAAAAAAGCCCTTATAAGTTC
CTACTGTCACCTGTGTCAAAACAATGTAGAACACAGTTTGTGTATAATAATAATAAGTCT
TAGCTCTGAGTTATGGAGCACAAAGGGCATTGCGGTAATATGACAAAGCATTGTTATGTT
ATTTGATTAAGATTTAAAGATAAGTTGAGAGACTGAGGGGTGAACACCATTTGAGCACCC
ACAGTGGGCCAGCACCTTCTGGGTGCAGGACTACAGCAGTTAAATTTAAAAAGATGACTG
CTGCTTTCGTGGAGTTTACATCATATTGAAGTGAGCCAAAAACAAGCAAAAACATTTCAG
TTAGTGATGCCTGTGTGAAGGCAGTAAAACATAATCGTAAGATGATGATGGGAGCAGGTA
ACCATTTTAGAACAGATCAGGGAACACTATTCAGGGATGTTGACATTTGAGCTGTGACCT
AAACAACATACAAATGCCTGGGGGAAGGCAGATGTACCAGGGAAAATGGCTAGTACAAAT
GCCCTGAGAAAAAACAAACTTGGCGCATTTGATGAACAGCTGTTAGGTCAGTGTGTCTGC
AGAGTTAGAAGGGAGTCGGAGAGGTAGGAGATAGAGATCGGAGGGGCAAGGAATGGCAGC
TAATTTAGTGTTTTGTAAGCTGTGGTAAGGAGTTCGGATTTGATTACAAGTGTAAATGGA
AGCTATTAAGGCTGATCTTCCTTTCTTAAAAGATCGCTAGTTGCCATGTGGAAAGTGAAT
TTTTAGAAGAAACTGAATTGAACGGACTAGAGCAAGTCAGGAGTCCAGTTAGGTAGAAGA
TTGTTACTGTAGTCTAGGTATATTTAATGGTTGGACTAGGATGGTAGCAATAAAGACGGT
GATAAGTAACACAGTTAAAGATAGATGTTGAATGTAGAACTAATAGGACTTTCAGTTGCT
GAAAAGACCAGTCACGGGTGATGAATAAATTTGTGAGCAAACAACTGAGATGCAGAAGAA
TTGAAAGATTACGTTTAACATGTGAGAAAATTGATCATTTTGGTAGATTTTTCTATCTTC
AGACTTAGTGGAATTCAAAGTCTGGCCCTCTGAACGTTTCCATTTTCTTTTGCCCTGACC
CCCATCCCTATGGTGATGACCCAAAAATTCTTTGTCCTGCCACGGTAAGTTAATTCTGTC
AGCAACTGTCAACACTAAGGGAACTGCCTTAAAATATTTATACACAACGCATAACCCAAA
CATTGTTTTTCCCGTGGAATTGGTTGGTCTCTTGTCAGTCTTATTTTGCAATTTGTATAG
TTGTCACACATTCTGGTAACAAAATAGAGGGAAATTATTGGGCTATGCTTCCTGCTACTT
TGATTATTTGATCCATATTACTGCCAATATCTTTTTGGCGTGAGAGCCTGAGGAGGGCCC
CAGAAGGGGACAGCCCCAAAACTGCCAGACGGAGGATAAGCGTAGAAAAGTGAGAAAATT
TCACATTCAGTGAGCCTGTAAATCAAAACTGCGAAGCATGTGAAACAATCAAGAGCAGAA
TTAAGCTACATGAAATAACTTTGTAAAATTTTGTTGCAACATGATGCTTTGTTTTCTCTC
TAGTAACTGGTATGAACCCTCTGTCTCCTTATTTAAATGTGGATCCACGATATCTCGTGC
AGGTAAGATTAAGACTAGTCCTTTTATGGTTTTACTAGTTTGGTGCTTTATCTCACTGTT
TAAAAAAATAATGCAAGTACTTATGCTGACTTGATCTATGATATGTACTTCTGGAGGCAC
CAAATCTCTTATCACCATTCCCCCTTTTTTCTTGCAAACCCTGGGGATTTGGCTTGTATC
TCTCCCTGACACTAGTTGATTAATTCCCTTTTAAGGGTTTTGAAGTTTGTTTTTTGTTTT
TTCCATTGTTTAAAGTTGTGGCAAAATACACTAACATAAAATTTACCATCTTACCCTTTT
TTTAAGTGTACAGTTCAATGGTATTAAATACATTCATAATGTACAGCCGTCACCACCCTC
CGTCTCCACATTGCTTTCATCTGGTAAAACTGACTACCCGTTAACCAGTAACTCCTCCTT
CTGCCTTCCCCCCAGCCCCTGGCAATCACCCTTCTGCTTTCTGGCTCTGAATTTTGAATA
CTCTTATGTACCTTAAATAAGTGGAATCATACAGATTTGTCTTTTTGTGATTGGCTTATT
TCATTTAGCATAATCTCCTCAAGGTTCACCTATATTGTAGCGTGTGTCAGAATTCCTTTC
CTTTTTAAGGCTGGATAGTATTTCATTGAATAATATTCCATTTTGCTTATCCATTCATCT
GTCCATGGACGCTTGATTGCTTCCATGTTTTAGCTACTGTGAATAGTGAACATTGGTGTA
CAAATACCTCTTCCAGACCCTGCTTTCGATTCTTTTGGTTATATATCCAGGAGTAGAATT
GCTAGATCATATGGTAATTTTGTTTTTAATTATCTGAGGAACTGCCATACTGTTTTCCAC
AGCAGCTGTACCATTTTACATTCCCACTACCAGTGCACAAGAGTTCCAGTTTCTCCACAT
CCTCATCAACACTTGTTATTTTCTGGGTTTTTGTGATAATAGCTATTCTAATGGATGTGA
GATGGTGACTCATTGGAATTTTGATTTGCATTTCCCTAATGATTAGTGACATTGAACATC
TTTTAATGTGCTTATTGGCCATTTGTCTATCTTTTGGAGAAATGTTTATTCAAGGCCTGT
CCATTTTTGAATCAGGTCATTTTTATTGTTGTTGAGTTTTAGGAGTTCTCTGTATATTCT
GAATATTAACCCCCTATTGGATAAATGTTATTCTCCCATTCTGTGCTTTGCCTTTTTGCT
CTGTTGATACTGTCTTTTCATGCACAAAAATTTTAATTTTAATGAAGGCCAATTTTTCTA
TTTTTTCTTTTGTTACCTGTGCCTTTGGTGTCATATCCAAGAAATCATTGCCATGTCCAC
TGTCATGAGGCTTTTCTCTTATGTTTTCTTCTAAGAGTTTTATAGTTAATAGGTTTTATA
TTTAGGTCTTTGATCCATTTTGAGTTCATTTTTGTGTATAGTATTAGGTAAGGGTTTAAA
TTCCCTCTTTTTCATGTGAATATTCAGTTTTCACAGCACCGTTTGTTGAAAAGACTTATC
TTTTCCCCCATGAAATGGTTTTGGCACTCTTGTTGAAAATCATTTGACGATTTATGTGAG
ATTTTATTTCTGGGCTCTCTATTCTATTTCATTGGTATATATGTCGGCCTTTATGCCAGT
ACCACAATATTTTGACTACTGTGGCTTTGTACTAAGTTTTGAAATCAAGCAATGTGGGTC
GTCCAGCATTGTTCTTTTCCAAGGTTGTTTTGGCAACTTGCGGTGTGTTGAGATTCCATA
TGAATTTTAAGATGGGTTTTTCTATTTCTGCAAAAACGTCATTGGTATTTTGATAGGGAT
TGCATTGAATATGTAGATTGCCTTGGGTAGTATTGACATCTTAACAATATTAAGTCTTCC
AACCCATGAACATGAGGTATGTTTCCATTTGTTTATGTCTTCAATTCTCTTAGCAAGTTT
TGTAGTTTTTATTGTAGAAGACTTTTGCCGCCTTGGTTAAACTAATTCCTAAGTATTTTA
TTCGTTTTGATCCTGTTGTAAATGAAGCTGTTTTCATCATTTCCTTTTCAGATTGTTCAT
CGTCAGTATGTAGAAATGCGTCTGGTTTTTTTTGTATTGACTTTGTATCCTGCTACTTTG
CTGAATTTGTTTATTAGTTTTAACAGGTATTTTTGTGCAGTCTTTAGGATTTTCTATATG
TAAGATATCATCTACAAAGAAAGAATTACTACTTCTTTTCCAATTTGGATGTCTTTTATT
TCTTCTTCTTGCCTAATTGCTCTGGCTAAAACATCTAGTATTACATTGAATAGAAGTGGT
AAAAATGGGCATCCTTGGGGCTGGCCTGGTGGTATAGTGGTTAAGTTTGTGTGCTCCACT
TCAACAGCCCAGGGTTCATGGTTTCAGAACCCCGGCACAGACCTGCATACCACTCGTTGA
GCCATGCTGTGGTGGCATCCCAATACCAAAAAATAGAGGAAGATTGGCACAGATGTTAGC
TCAGGGACAATCTTCCTCACCAAAAGAAAAAAATCAGGGGAGGGGGAGCATCCTTGCCTT
TTCCTGATCTTAGAGGGAAAGCTTTCCATCTTTCACCTCTGACTATGGTGTTTGCTATGG
CTTTTTTCATATAGGGCTTTTATTATGTTGAAGTAGTTTCCTTCTATTCCTGGTTTGTTG
AGTGTTTTTATCATGAAAGTGTGTTGGATGTTGTCAGATGCTTTTTCTGTATCAATTGAG
GTGATGATGTGTTTTTTTCCTTCATTCTGTTAGAGTAATGTATTACATTGATTGGTTTTT
GTATATCAGACCATCCTGCATTCCAGGAATAAGTCCTGCTTGCTTATGGGATATAATCCT
TTTAATATGCAGCTGAATTGAGTTTCCTAGTATTTTGTTGAAGATTTTGCATCAGTTTTG
ATAAGGGATATTGATCTGTAGTTTTCTTAGTGTCTTTGTGTGGCTTTGGTATCAGGGTAA
TGCTGGCGTTATGCGAAGAGTTATGAAGTGTTCCAGGTATTCCCTCCACTTCAGTATTTT
GAAAATAGTGAGAAGGGTTGGTGTCAGTTCTTCTTGAAGTGTTTGGTAAAATTCACCAGT
GAAACCATCAGGTCCAGGGCTTTTCTTTGTTGTGAGATTTTTTTATTACTGATTCAGTCT
CCTTACTAGTTATAGGTCTGTTTGGATTTTCTATTTCTTGGTGAGTTTCATATTTCAAGG
AATTTGTACGTTTCATCAAGGTCATCCAATTTGTTGGCATACAGTTGTTCATAGTACAGT
CATGTATCACTGAACAGTGATGATATGTTCTGAGAAATGCATCATTGGGCACTTTCGTCC
TGCAGACATCATGGAGTGTACTTAAACCTGGATAATTTAGCCTATCACACACCTACACAA
ATGGTACTAATCTTATGGGACCACTGTTGTATATGCAGTCCATCATTCACCGAAACGTCA
TTATGCAGCACGTGACTGTACTTTCTTACCCTTTTTAATTCTGTTGATTTGGTAGTAGTG
TCCTCATCTTCATTTCTGATTTTAGTAGAGTCTTCTCTCTTTTTTTCTTAGTCCATCTAG
CTAAAGATTTTTCATTTTTTTTTTTTATCTTTTCAAAGAACCAACTTTTGGTTTCGTTGA
TATTTTTTTCTCTATTGTTTTTCTGTTCTCTATTTCAATTATCTCTGCTCTAGTATTTAT
TATGTTCTTTGTTCTGCTAGGTTTGAATTTAGTTTCTTCTTTTTCAAGTTCATTATGTTG
TAGAGTTAGGCTGTTGATCTGAGATCTTTCTTGTGTTTTAATGTAAGCATTTATAGCTAT
AAATTTCCCCCATAGCACCACTTTCACTGAGTCTCCTAAGTTTTGGTATGTTGTGTTTTC
TTTTTTACTCATCTCTTAAGTATTTTCTCATTTCCTTTGTGATTTCTTCTTTGATGTGTT
GGTTGTTTAAGGTCTTTTTTGATTTCTACAAATTTGTGAATTTTCCAATTTTACTTCTTT
TATTGATTTCTAACTCATCCTGTTGTGGTTGGAGAAGATACTTTGTATAGTATCTTTTAA
AATCTATTGAGACTTGGGGCTGGCCCCGTGGCCGAGTGGTTAAGTTCGCGCGCTCCGCTG
CAGGCGGCCCAGTGTTTTGTTAGTTCGAATCCTGGGCGCGGACATGGCACTGCTCATCAG
ACCACGCTGAGGCAGCGTCCCACATGCCACAACTAGAAGAACCCACAACGAAGAATACAC
AACTATGTACCGGGGGGCTTTGGGGAGAAAAAGGAAAAAATAAAATCTTTAAAAAAAAAA
AAAAAAAAATCTATTGAGACTTAATATGTGGCCTGTCAAATGGTCTATCCTGGAAAGTGA
CCCACATGCACTTGAGAAGAATATGTATGTTGTTGTTATTGGGTAGGGTGTTTTGTGTAT
GTCATGTTAGATCTAGTTGATTTATTATTGTTTAAATCTTCTATTTCATTATTATCTTCT
GTCTGGTTATAATGGTTACTGTCCATTATTGAGAGTGAAGTATTGGAGTCTCCAAATGTT
GTAGAACTTTCTCTTTCTCCCTTTAATTCTGTCACTTTTGCTTAATGCATTTTGATGGTC
TGTTATTAGGTAAGTAAATGTTTATAGTTGTTGTATCTTATTGCTGTATTGAAGCTTTTA
TTGACATAATGTTCATTTTTGCCTCTTGTAACCTATTTTGACTTAAAGTCCATATTTTCT
GATAGGAGTATAGCCACCTGCTCTCTTATGGTTATTATTTGCATGGACTATCTTTTTCTA
TCCTTTTACTTTCCATCTTTTTGTGTCTTGGATCTAAAGTGAATTGCTATATGCTGGTAG
ACAGCATATAATTTGGTAATGGATTTTTATAGAAAGTTTAATCCATTTACATGTAAAGTG
ATTTCTGATAAGGAGGGATTTCTGTCATTTTGCTATTCATCTTCTGTATGCCTTCTGGCT
TCTTTGTCCCTCATTTCCTGCATTACTGTCTTCTTTTGTGTTTACTTGATTTTTTTGTAG
TGAAATGTTAAATTTCTTTTTTCCTTTTGTATATATTCTATAGCTCTTTTCTTTGTGGTT
ACCATGGGGATTATATTTAACACCCTAAAGTTATAGCACTCTAATTTGAATTTATACCAG
TTTAACTCCATAATGTACAAAAATGCTGCTCCTTTAACAGCTCTATTCTCACCCCTTTTG
ATTGTTGATGTCATAAAATTACATCTTTATACATTGTATGCCCCAGAACGTACACTAATA
ATCTTGTAAGTGCTTTAGACTCTAAAATTATGTAGAAAACAAAATGTGGAGAATTACAAA
CCTAAGTTAAAATAATACCTTTATAATTGCCTATATGTTTGCTTTTGTTAATATCTATAT
CTCTTCGTAAGGCTCTGAATTACTGTCTAGTGTCCTTCTCATTTCACTTTGCAGGACTCC
CTTGATCGTATCTAGCAGGGCAGATCTAGTGGTCATGAACTTCCTCAGCTTTTGTTTATG
TAGAATTTCCTAGTATCTCTCCATCACTTTTGAAGAACCGTTTTCCTGGATATAAGATTC
TTGGTTGACAGGTTGGGTTTTTTTTAGCACTTTAAATATATTGGCTAACTACCTCGTGGT
CTCCAAAGTTTCTCTTGATAAATCTGCTGCTAATCTTGTTAAGGATCTCTTGATGTGACA
AGTTGCTTCTTTCTTGCTGCTTTCAAGATTCTGTCTGTCTTTAGCTTTCAAAAGTTTGGT
TTTAATGTGTCTCAGTGTGAGTCTCTTTGAATTTATGTTACTTGGGGTTCATTGAGCCTC
TTGGATGTTCGTATACATCTCTTTCATCAAATTTGGGAAGTTTTCAGCCATTATCTTTTC
AAACATTCTCTCTTTCTCCTTCTGAGACTCCCACAATCTGTACATTAGTCCACTTAATGG
TGTCTCACAAGTCCTTTAGGCTCTACTCACTTTTATTCAATTGTTTTTCTTCCTGTTCCT
AAGACTCAGTAATTTCGGTTGTGCTATCGTCAAATTTGATGATTCTTCACCCTGCTCAAA
TCTGCCTTTGAATCCCTCTAGTGAAGTTTTCAGTTATTGTACTTTTCAGCTCCAGAATTT
CCTTTTGCATTCTTTTTAGGTTTTCTGCCTCTTTATTGATATTTCCACATCTCCTTTAGT
CTTTGAGCATCTTTGAGACAGTCGTTTTAAAGTCTTTTCCTGGTAGATGTACCATTAGTC
ATGGTCATGTCGTGAGTGTTTCTGTTTATTTATTTTTTTCCTTTGAATAGGCCATATTTT
CCTTTTTCTTTATATGCATTGTGCTTTTTTTGGTTCTTATTGAAAACTGAACATTTGAAT
CTAGTAACGTGGTGACTCTGGAAATCAGACTCTCCCCCCTCCTCCAGGGTTTGCTTTTCT
TTTTGGTTATTGTCTTGTGGTATTATTATTATTAATTATTATAGGCTGTCTCTGTGCCAG
GGCACAACCTGAGATGTAAACTTAAGCTCTTCTCAGTTCTTTTCGGAGCCTGCACTTTTT
CCTGGGCATGTGTTGTCACTTTCTAATTTTCTCTTCATATGCAGTTGCTTTTGAATGCCC
TAATCTTTAATGTCTGCCTCACAAAGGGGGAGAAAAGAGAAAAATGAAAGAGGAAGCAAA
GGATAAGATCTTCATTAAAACCCCTGAAATAAGCAGGGTGGGCTGAGGTGGACATGCAAC
AACAGTGGCTGCCTGCTGTTTTGTCCACATCTCTGTAGTCAGAAGCAGCAGTCAGTGATC
AGAGCACGAATTAAAGGTTTATTTTTAAAAGCAACAAGCAACATCTTCTCAGAGAAGGGA
CACAATAGAAAGAATAAACAAATGGGACTTCATCAGACTAAAGAGCTTCTTCAAGGCAAA
TGAAAACAGGATTGAAACAAAAAACAACCCACTAACTGGGAAAAAATATTTCCAAGTCAT
ACATCCAACAAAAAATCAAACAACCTGATCAAAAAATGGGCAGGAGGCATGAACAGACAT
TTCTCCAAAGAAGATATATGGATGGCCAGTAGGCACATGAAAAGATGCTCATCATCACTG
ATCATCAGGGAAATGCAAATCAAAACTACACTATTACATTACACTCGTTAGAATGACAAA
AATATCTAAAATTAATAGTAACAAATGTTGGAGAGGTTGTGGAGACAAAGGAGCCCTCAT
ACACTGCTGGTGGGAATGCAAACTGGTGCAGTCACTGTGGAAAACAGTATGGAGATTCCT
CAAAAAATTAAAAATAGAACTACCATACAACCCAACTATCCCACTACTGGGTATCTATCC
GAAGAGCTTGAAGTCAGCAATTCCAAAAGTCCCATGCACCCCAATGTTCATTGCAGCCTT
ATTTACAATAGCCAAGACGTGGAAGCAACCTAAGTACCCATCAACAGATGAATGGATAAA
GAAGATGTGGTGTATATATACAATGGAATACTACTCAGCCGTAAAAAAGAACAAAATTGT
CCCGTTTGCAACAACGTGGATGGACCTTGAAGGAATTATGTTAAGTGAAATAGCCAGATA
GAGAAGGACAATCTCTGTATGACTCCACTCACATGAGGAATTTAAAAATGTAGACAAAGA
GAACAGATTAGTGGCTACCAGGGAAAAGGTGGGGTAGGGGTGGGCACAAAGGGTGAAGTG
GTGCACCTACAACACAACTGACAGACAGTAATGTACAACTGAAATTTCACAAGATTGTAA
CTTATCATTAACTCAATAAATAAAAAAAGTTAAAAAAAAAAAAAGCAAGAAACAACAGTT
TTAAAAGCATCCCAATAAAAATACTGGAGTGAGTAGTTAGAAAATTATAAGAAATTGTTA
ATATTAAGTTAAATGTAAATGAGAATGTAAAGCCTGGGTATCTTTTTAATGAAATCTTAA
ACCAGATTTCTACATATAATTTAAAAATGTAATTTACTACTTGAGTTTATTTTATTAGAT
CAGATTATTAATATTACTGAAAGTCTATGGAAATAAGAGAAGCGTAATGAAAACAAATAT
TTGAAATTGGAATTATACATTTTAAAGTTTATATTAGCCTCAGCATTTTGGTTTTTGGGG
TTTTTTTGTTTGGTTTTTGGTTATTTGGAGAAGATGCTGATTCAACACAGGTAAAGGTGC
AAATGACAGATTGTTTTAAATCTCAGTTTATAATATCGTTACTGGACTAAACTGATCAAG
AAGCTTCAAGGAGTAGTTGTTGGTTATATCAGGAATGTAAGGTTGATTTGACACCTGGAA
ATCAATGTGCTACGCCATAGCAATAAAGGACAGAACTTTATTCTACCGATTATCTCAATA
GATGCAGGAAGTGTTTGACAAAATTCAATATCCCTTCATGATTGGAAAAAAACCCACTCA
GTAAACTAGGCGTAAAAAAGAACTTCTTCAGCCTGATAATTGGCATCTACAGAATATCCA
AAGCTGACATCATACTTAATGGTGAAAGACTGAATGCTTTCCCTCTAATAAGGAACAAGA
TAAGGATGTCCACTCTCTTCCCCTGTTAGTTATTATTGTATAACCAGGGCAGTTAGGGAA
GAGAATAAATAGCATCCAGATTGATCACAGAAAAAGTAAGACTGTTTGCAGATGACACAA
TCTTGTCTACAGAAAATCCTAAGGAAACCACAAAAAATTATTAGAATAAACAAGTTCGGC
AAAGTTGCAGAATACAAGATCAATCTACATAATCAATTATATTTCTGTAGAGTAACAGTG
GATGCTATAAAGATGAAGGTACAAAAACAATAGCATCAAAAAGAATAAAATATTTAGGAA
TAAATTCAACAGAAACGCAAAACTTATACTCTGAAAACTACAAGGCATTATTGCAAAAAC
ACAGAAGACTTAAATAAGTTGGATGATATTCCACTGTCTGAGAAGATTTAATATTGTAAA
GTAACAATAAGCTCCAAATTGACCTGCAGATTCAACATAGTCCCTATCAAAATCTCAGCT
GGCTTTTTTGCGGAAATTGGTCAATCCTAAAATTCACGTGGAAATTCAAGAGATGCAGAA
TAGCCAACAATCTTGAAAAAGAAGAACAAATTGGAGCCCTCACACTTCCTGATTTCAAAA
CTTATTACTGAGCTACAGTAATTAAGACATTGTGGTGCTGGCATAAGGATGGATCTATAG
GTCAATAAGACAAAATTGAGAATCCAGAAATAAACTCCCACGTTTACAGTCAGTTGGTTC
TCACCAGGGGTACCAAGACAATTAAGTCTTTTCGACAAATGATGTTGCGACAACTGAATC
CATATGCAAAAGAATGAAGTCAGACCCCAGCCTCACACTACCTACAAATGTTAACCCAGA
ATGGATCAAAGATTTAAATATAAGAGCTAAAATTATAAACTCATAAGCAATTATAGGGGT
AAATATTTTCGACCTTGAATTAGGCATTGATCTCTTAGATATGACACGAAAAGCACAAGT
GATAAATAAAATCGATGTTAGATTAAATCAAAATTTAAAACTTTTGTGCATCAGACTGCA
CCATCAAGAAAAGAAGACAGCCCACAAACTGGGAGAGAATATTTGTAAATCATGTATCTG
ACAAAACTTTTAACTCACTCATAAGACAAGCCAATTTAAAAATCGGTGAAGGATCTAAAT
AGACATTTCTCCAAAATGTATACAGATACCCAATAATCACATGAAAGATGTTTGATGTCA
TTAATTAGAGAAATGCAAATCACAAAACCACAATGAGATACCAATTCACACCCACTAGGA
TAGCTGTAATGAGAAGCCCAGGCAGTAACAAATGTTGTTGAGGATGTGGAGAAATGGGAT
CTTCATACATGTGGCTAGAAATGTAAAATTATAGAGCTGTGTTGGAAATAGTCTGGCAGT
TTCTCCAATTATTAAAAATAGAATTACCGTATGACCCAGTAATTCCAGTCATAGATAAAT
ACCCAAAAGAATTGAAAACATGTCCACACAATAAATTTTACAATATTCATTGATTTTGTT
TTAAAGGTAGCCCTCTGTCAGTTGTTTAATCAAAATGTCAAAACTAATCACATGTGTTTT
ACTTAAATGTTGAACCCAAACTTAAAGGTTGTAGTCTAGCTCTGTTTTAAAATACAGAAA
CATTGTGATCCTGCATTGCCAGGTGAGGCTTATTAAGTTAGATATAAAAGAAGATTCTGT
ATTTTTAAAAATTGTCATTTCTTGCTTAATCATAAGCACTTATAGTGGCATCTTCCATTT
GAATGCTAGAGGGTCTTCAGAAGTCAAAAAGTTTTCTCAATCTCGTTGTTATAAATAACC
ATGGAAAGCCTAAATTTAAAGACTACACCTTAATAAAGATTGCATTTTGTGAAATATTTT
TTCCATACTTTTGAAGGATGGAGACATGTTAAGTAGTACCTGTCAACTCACCGTATAGTG
ATTTTTGGCAGCAACTTTTATCTGAGGCACTATTTGTGGTTTCTCTTGCTATTGCTTTTG
TATTATCACTACTTTTGCATCCTCACTGAAATATTAAAAATTATATTAAGTAGTCTTTCT
CTTGTTAGGCCAGAAGAGCGAGTATAAAAACAAGGAGAATTTAAATATTTCCGACATCCG
TAGTGTCATCTAGTTGAAATATAAAGATTTCATATAATGTTGGCCTTCTATTTCATCAGG
TACAGTGATGCCCATTCTTGGATTCATTTCTCTTCTGTGTTAGTGAACAAATGGTACAGA
TAGTATTTTAGTGACACTAGTGTCCTAAGTGTCAGCAGCACATATTTTAACAGGAACTTT
TCAGTATATCTTCCCTACTTGCATTGTTTCAAGATACTTTGATATCAACCTTGTTAGATG
GTTGTTTCTTACAGTTTTAAATTTGGCTTGCAGAAGTTTTTTCTGTATAACCATAAACTG
TTTATCTTTTCTTTTTAACTTGTTAAAAAATTTTATTGAGGTCATAAGTTAATAACATGA
AATTTCAGTTGTACGTTATTATTTGTCAAGCACCGTATATATGTGCCCCTTTACCCTGTA
TGCCCACCCCCCAGCCCCCTTCCCCTCTGGTGACCACTACTCTGTTCTCTTTGTCCATGT
TTGTTTATCTTCAACATGTGAGTGAAATCACACTGTGTTTGTCTTTCTCTGTCTGGCTTA
TTTCACTTAACATAATACCCTCAAGGTCCATCCATGTTGTTGCAAATGGGATGCTTTTGT
CTCTTTTTATGGCTGAGTAGTATTCCATTGTATGTATACCACACCTTCTTTATCCATTCA
TCAGTTGGTGGGCACTTGGGTTGCTTCCACGTCTTGGCTATTGTGAATAATGCTGGAATG
AACATGGGGTGCATAAGTCTCTTTGAATTGTTGATGTCAGGTTCTTTGGATAAATACCCA
GTAGTGGGATAGCTAAGTCGTATGGTATTTCTATTTTTAATTTTTTGAGAACTCTCCATA
CTGTTTTCCACAGTGACTGCACCAGTTTGCATTCCCACCAGCAGTGTATGAGGGTTCCCT
TTTCTCCACATCCTCTCTGACATTTATTTTTTTGTCTTGGTAATTATAGCCGTTCTAACA
GGTGTAAGGTGGTATCTCCTTGTAGTTTTGGTTTCTGTTTCCCTAATGATTAGTGATGTT
GAACATCTTTTCATGTGCCTTTTGGCCATCTGTATATCTTTTTTGGAAAAATGTCTGTTC
ATATCCTCTGCCCATTTTTTGATTGGGTTTTTTGTTGTTCAGTTTATTAATCATATTTTT
AAAGAAACCAAGAGCCTTAATTTTATGCGTTGTTTTTTGTTTTTGGGTCCCCGAAAGAAT
GAATGTAATTTGGCCAGGTTCCCCTCCCTCAAAAAATCTTAGCAAATTTTTGTTATTTTA
TAAATGTTGTATGGTACATTTTTATTGCCTTGAAAAGGTTAAGCCCCAATGACAAATAAC
CAATCACATTGTTTTCAAGTGGCTCTTTGTGTGAATTGATGTACATTTTCTTTCAACCCT
TGTAGTGTTTTTTTATGGTTGACCCTACCTGAAGATTGAATTGTGCTTACTAATGTTCAT
CACTACCATCTTTTTTTTTTCCTTATTGTAATTAGTGATCCATTTCTGGGTTGAAGGATA
ATAATTCACCTCATCAAATCACATGTAGCATTTCTAAAAACCTCAAACAGGAAGGACGCT
TTAAATCTAAGTCATTAATTTAAAGCCAGGAAACAGCCCAAATTTGTAGAACTAAGTATA
ATAACTACATCATGACACAGGATCTATTCAGAGTTTGTTCATTATTGCCCAACAGACCAT
TTCTGTATGATGAGAGTAGATGCTTACTTATTTGTGCCATTTTGGGTAAGAATGTAGACA
CAATCCAGAAACCAAAAGCCAGTGCAGAGCTACTGTTTTCCTAGTGAGGATTGCATTCAC
CAAAGGTCAGTATACCCTTTGCCAAAGGGATGTGTACTTGTTAATGTTTTTTGCCAAGGG
TGTATGCTCTCCTTTGGGGATTTATTTTAACCATTTTTGTATGGAAAGCTTGGCAAAAAT
GTATTGGATCTGTATTGTATTGTATCATAAAAGTGATTGTATTGCAAAATCAGTCATATT
GTGCTCTTACAGTATCATTTCTCAACCTAGGATTCTTAGGTGACCTTCAAGGGGTTCATA
CCAAATTCTGTGTATATAGTTACTGGAAAGAGGGTTTATAGATTTCTAAGATTGTCAAAG
GAATATATGCCCCCTTAAGAATTATTAAGAAGGTAATTGTGCCCTTGCATAACTGATTTA
AATGGTTGTGCTTGTATAGTTTCTGTTCATTTTTTAAATATCATTTGGTCTTATACATAG
TAAAATAGTACTTGATAAATAGTAGCTATAGAATGAAAGTTTTCTTTCACCTTCCAGACC
AGTCTCCTATCCTCTGTTACTTCTCATAGCTTTCAGTTTACACTTCTCTCCTTCCTAAAC
TCTCTTGCATTTTAAATTTATCATTAAGAAGGCAAATTACATAAAACTATCAAACTTACA
TTGAGAAGCAAAGTTCTCTATGAGAATCCTCCTAAGAACTAATGAGCATAACTATATATG
TTGTATTTTTCATTTCAGTTTGATTTAGGAGTTACTTTTGTTGAGCAAAATTTTATTTTT
ATTTGAAGAAAATTTTACTTTTGTTTGACTAGGTATAGTTGAGTTTTAGTTAATTTAGGT
TTTACTTTCTGTGAAAAACTACTTTGAAAAATTAAAAAATGCTTTGCAAGTACTGTTTCT
TGAGGGAAGCTCAGCTTGGGTTTTGTTATTATCCCTTTAGGATACAGATGAGTTTATTTT
ACCAACTGGAGCTAATAAAACCCGAGGCAGATTTGAACTGGCCTTCTTTACCATTGGAGG
ATGTTGTATGACAGGTGGGTATAAGAGGTCTTTTTTAAATGTCTTCAATCCAGATAGTCA
AAAGTGCTTTAAAATCAAAAGGGGTTAGAATATTGCTTTTGGGGTTGTTTTAAAACATCA
TTATATACATTTTTTAATCTTTTCCTATTAAATAAAAATGAAAAACAATCAGAAGTGCGG
TTGTTTTTAATATAAACCTGTATTATTTGGATGACTTGTTACTGTGGTTTACTAGGGGCT
GCATTTGGAGCAATGAACGGTCTCCGGCTTGGATTGAAGGAAACCCAGAACATGGCCTGG
TCCAAACCAAGAAACGTGCAGTAAGTCTTATGCAATTATCCAATGTAGTGGTGTTTGAAT
ATGAATCTCTACTTTGTTGGCTTGATGAGCACAATCTTGAGATTATAAATACTTAGAGTA
TTGATAATATGTTTTGGTCACTTTTTTTTTATTCAAAATATAAGGAACTAAAGAATTAGG
TTACTGTGAGTCTAAGCTTTCAAAAGGAGTGGTTTTCGAGTCAGTGTCCCTCAGCAGCTG
GTGCTACCCCAACCTAACTTCTCAGCTACACCTGTTCCATTCTATAGGCCTATATAACAT
GCTGTTCAAATTGTTAAATTACTAGTACATTATTTGGATTGTTCGAGGGACATGCAGAAC
CGTAGGACGTGTGTGGTAAGTGAAGAAATAAGAAGCATATAAGAGTGATTACTAGGTCTG
ATGTCATTTGAATTGAACTGCTGACTTCACTTTCCATTTCTCATATGGAAAGCTGCAGAA
AATTTAAATGAAAATCCTAGAATTTAGAGGTAGTTCCAAAAGAAATAAGACAGTCTTCTC
TTAGGAAATTGAAGTTTGCAGAGAAGGGAAAGTACTATTTAGAAGGTCAGGAAGTGTATA
AAATGTATATCTTCACCCTGCTTAAGAAATAAACATGACCACTCCCTGTTGATACTCCCT
AAATAATGTTATTTAATTTTGCATGTTTTTATACTTTATTAGAGTGGAATCACACAGTAT
GTATTCTTCGATGGCTCATGGTTTTGTTTTGGACACTTTAAACTCCATCTTGCTTAACCA
GCAGATGGCAGCAGGTGTGCTAGAATTAGACCTTGGAAAAACCTGAAGGCCTGTCAAGTT
TTCTTATTCCTGTTACTATATGGGTTGCAGCTCTTGCTTTACTAGCCCAGATCCTTGCAT
ATTTTTATGTTCATATTCTTAATATTTGTTCCTTATGTATTATGTATTCTTATGTGTATT
ATGGAGAATTTTGAATGTATATAAAAGTAAACAAAACAGTACAGTGATACACACATCCTT
CAACAATCATCAGCCAGGACCAAGACCAATTGTATCCCATCTCCTTCTCCCCTCCCATAT
TATTTTGAAACAAATCCCCAAGTCATAACATTAAATACCAATTTGAAAGTGGAAGGTCTC
CTAGCAAAGACAACCTTTATTCCTTAAAACAATGATGGCTATTAATGTTTGGGGGAGAGG
CAAATTGGTTTGCCTTGTTTAAATCATATTTTTAAAATCTTGTATACCATTTTTTAATAT
AATCATTCTGATCTTCCTAAATAGGGAAACAGCATTTAAAAATGAAAAGAAGATAGGATT
TGGGGACAGACAGATCTATGTAGTTTGAAAGTCTAGCTTCATTATGTACTGTTTTGTTTT
CTTAGGTAAGCTTTCTCTGCTTTTTGCCTTTAAGAATTATTGAGAGATGATTAAAGTAAG
AGTAGATAAGGGCCCAATAAATGGAGGTATGTTGCCAAATTGCAGCCCAAAGAATTTTAC
CGGTTTGCAGTGCCGCCAGCAGTACAATAATGAAAATTAATAGTTTTAAAAGCTTGTTAT
AAATGAAAAGACAGTGTGGTGAACTTATAGTAAATATGCACCGTAATTAATCAGAAACAA
TATACTTCTCCATAATCATTGCTAATTTTTTTAAATAATCTTTTAGAGGTAATCCATATT
TTTGTTATTATTGGGCATTAATTTAAATGAGCTCTTAAATTAAATGAGCTCTTTTACTGT
TCGTTGTTGTAATTCCACAATATCCAGCAGTAGTCAGCTGTCCGGACAGAATCCTTCCTG
TGACGGTGTTACACTGCTGGGAGAGGAATGTCCTGTCTTCTTCCTCCAGTTGCCTCTGCC
ACTGTTCTGGTGGCATCTGGCACTGGTGCAAGGCAGAACTGTGCTTCCTTGAGAGTGTGC
TAAGCATTCACTTTGGCTGCTTAGTTCTAGTCTGGAAGCAGACACAGTGTGCTTTCTCCG
TGTATTCTGGTTAGATAGCTTTTTCCTTCTCCTTGAGTAATCATCTTTAGTTCTGCTTTA
TACTCTATAATAGTCCATGCTTTGATTCTCCCTAATATTCAAAGTATATACTTCTCCCAG
AAAAACTTAATGGAAAGCTACTTTGTTCATTATAATGGCTTTTTTTTTCATGATCAGTTT
CTGTAAACTTCTCTGTAAAATATATTCCAGACTGTCACTCAAAGACTATATATGTTTAAT
AATAATTTCCCCTACTCATTGCCCAAAAGTGTTGGAGGTTTTAACGTAACCTTCATTTAT
ATTTATATAAAGTGAAACCATCCTTATTGAATTCTGAGGTATTAAGTTTTAAAATTAAGA
AAACTTTGGGTATTGGGTTTATATGTTTTAAATAGCTAAAATTATGGTTTTTCAAATTAC
TAGTGAGCTAATGATTCTAAATACTGATTCTTTCTCTTTTCTCTTTCTGCCCTGCTAGGA
TTTTGAATATGGTAACTAGGCAAGGAGCGCTTTGGGCTAATACTCTAGGTTCTCTGGGTA
AGTAGAGATCTCATTTGATAATAAATCATTAAATGCAAAGAAAGTAAGTACACATATGAT
GAACAATTTGATAGACCAAAATTCTGGTCCTTGGATATTAAAAATTATGTTTAAATCCAC
TCTAGTGAGTAGTGTAAATAGTACTTAGGAAAACACCGTGAACTACATAATAAAATAATT
CCCAATGCCGATACCCTTGTGAATACCATTTCTGAATGTTTTAAATCTTTGTAAACATTG
CATCCTCTCCTGTCCGAGCGAGAAACCAAATAAAATCATGTCTTAACTAAATGAAGTCCA
GGTAATTTAGGTCCAAGGCAAATGGCTTTGTATGTTAGGAGAGGTTCAAGGTCCTGTACT
TAGACATGATATTAATTCGGCCCTCTTTCTATCTTTTCCTAATAGCCCTTTCAGCATTCT
GTCTACTTAAGCAGATTTCCCTGACTTAATTGCCAGAGTTGCAATAGGGCCTTTGTAGAT
AATGAAAATATTTGCAGAAACAAGGAGTAATTTAATAGTACTTAGTCAAGACCAAATGAT
TTCATACTATATTGTTCACGAATGATTGACTCTCTTGATTACTCATGACTTATAATAAGC
CTACTTGTGGCACTTATGCCCTAACATCCAAGGTTTTCTTGGTGACTTAGTTGAAAGTCT
GAAAACCTTTTAATTGTGGCAGATTAAGTAAGGGAAAATGTAGGCATCTCGTTGAAAAGA
TAGGAAAACCTCTGTTATGACAGACTAAGATCCTGGCGTTGTCCCAGGATGTGGGAGCAG
TACGTTTTCACACTGTAAAGTCAGATTCACATTTTGGATCCTAATAAATGGCTGGTTCTG
TATGCTGCTCTTGTCCTCATTGCCCCCACCCCCACACACACCCTCCTCTTTTGTTCTTAT
TTGATTGTTTATATACCTAGAGTGATCAGGCATCCTGGTCTGCCCGGGACTGTCTTAGTT
TTAGCCCTGCAAGTCTCATGTTCCAGGAAACCCTCAGTCCTGGGCAAACTGGGATGGCCA
ATCACCCTGTATGTTCCTGTTGTAATATGATCAATCACAGTGTTCTGCTCAAGTTCAGTT
TCAGTTAAATAAGTTGAAAAGGGAAGAGCCTTTATAGAAGTATAAAAACATTACAACAGA
GGAGTGGTAAGGCTGAGCTTGATGTAAAGTTGACAGGGTCAGATGTGGCTATAATTTTAA
GAGGGTAAGGGAAAGGATTAATGCGTTCACAGCTAATGGGAATCCTTACAGGCATAGAAG
GAGGATGGTTTGGGGGAAGGGTCTTGTCATGACTAAATAGTGCTAGAGCTACAGTTTTTA
CACGTGCAGGAACCAAACCTCACTTTTTTTTTTTAAGTTACATTTTTTATAATAGAAATA
CATGTGTTTTTGTTTCTAAATCCAAAGTATGGCTATGATAAACAAAATATGTGAAAATTA
AAGATACTTTTTCTGGGACTCCCCAGTGGTGCTTTTCATAAATGGCTACTATTAGTGTTT
CTTCTGAATTCTTCCCAACATATTCTTTGCATAGCCAGAGTAATACACACATGTGCCTAC
TTTACTTGTAAGTGAATATAGCTCTTCCTGCTTTTTAAGTGAGTGTATAGTATTTCATTA
TATGCAAAGTCCCTTTTTGGATCAGCTCCCTCTTGGTGAGCATTTTGTTTGTTGCCAGGC
TTTTGCTGTTACAAACAATGTTCTAGTGATCATTCTTTGTGTATCTTTGAATACTTTTAG
AATGATGTCTGTGGGATAACATTTATCTAAATATAATTACCATACTGACATTCAGCCACT
TATTTATTTCTGATCAGTTCCATTTCCCCTGTAGCTTTGCTTTATAGTGCATTTGGTGTC
ATCATTGAGAAAACACGAGGTGCAGAAGATGACCTCAACACAATAGCAGCCGGAACTATG
ACAGGCATGTTGTATAAATGTACAGGTGAGTACTGTTGAATGGAGAGCTCTCTCAATATA
CTTGACATATGCTTTTTATTCATAGTTTTCAAAGAAAACGTTAATGCATTTTTGCAGTGT
AATCTAGGGTTCTCTGAAATCTCATGGTTATTTGGGGATTGTTTTTTTTTTTTTTTAAAG
ATTTTATTTTATTTCCTTTTTCTCCCCAAAGCCCCCCCGTACATGGTTGTATATTCTTCG
TTGTGGGTCCTTCTAGTTGTGGCATGTGGGACGCTGCCTCAGCGTGGTATGACGAGCAGT
GCCATGTCCGCGCCCAGGATTCGAACCAACAAAACACTGGGCCGCCTGCAGCGGAGCGCG
CGAACTTAACCACTCGGCCACGGGGCCAGCCCCTGGGGATTGTTTTTTATTTTGTTTTTT
AATTTTGATAAAATACACTTAAAAGTGAACAGTTCAGTAATGTTAAGTACATTTACATTG
TGATGCAACCAGTCCTCAGAACTTTTCTTCATCTTGCAAAACTGAAAATATACCCATTAA
ACAACAACTCCTATTTTCCCCCTTCCTTCAGCCACTGGCAACCAGCATTCCACTTTCTAT
CTTTATGAATTTGACTACTTTACGTACCATGTATAAGAGGAATCACACAGTATTTTTTTT
TATGACTGGCTTATTTCATTTAGCATAATGTCGTCAAGGTTCATCGATGTTGTAGCATGT
ATCAGAATTTCCTTCCTCCTTAAGGCTGAATAATATTCCGTTGCACATATATACCACATT
TTGTTTATCCATTCATCTATCAATGGACACTTGAGTTGCTTCACCTTTAGCTACTGTGAA
TAATGCTGTTACCTAACATGGGTGAACTTAAATACCATTGAATTTTGAAAAAAATAATCA
AAACTCTGTCCTTTCCAAGGGAAAGGGCAGAGGAAAAGGGACACACAATCCTTAAAACTG
AGAAAGTTCCTTCAAATCAAGAGGGAAGGCAGGTCTTCACTTAGCACAGGTAAAACAAGT
GTTGCTATTCTACTTAGTTCTCAGAGAAAAGAGCAAGATCTGCCTACTTTGGGAGAGAGC
TGCTATCTGATCTCTTTTCACCCTTGTGGCCAGAAGCACAGCACAGCCTCTGCTGAGCGT
CTCAGGGTGCTGAAATCAAAGTATTGGCTGGGGCTGTGGTTCTTAACTGGGAGTCCAGGT
CCTCTGCAAAGATAACTGATCATTTTCAGAATTCATTCCTTCTCTTGCTTTCCGTATGGA
CCTCTCCATCTTCAAGCCAGCAACAGCACATCAAACTCTTCTCATGCTTTGAATCTCTCT
TACTTGTTCTTCTGCCTTTCCCTTTTGCTTTTAAAGCTTCATGTGAGTACATTGAACCAA
CCTAGTAATTCAGGATAATCTCCCCATCTTAAACTCAATATATTAGTAACCTTAATTCTC
CCATAAAGTCCCTTTTGCCATGTAGACTAATGTATTCATGGGTGTAAGAGCAGGGAGCAA
AAATCATGGAAGCCAAATTTCTGCTTACCGCAGTTAGATGATAACACTCCCATTTTATAA
ATAAGAGAGTTGAAATTTAGGAGGGATAAAGAGCTTGCCGCAAGTCACACAGATAGTAAA
TGGCAAAGCCAGAATGAAAGGCCAAGTGTATGTGAGTTCAGGCTCTGTGTTTCCCTTGAC
CCTGAAATTCCTCTGTTCCTGCCCACCGTTCATCTTAGACAAGTGATGCAGTTTATTTCT
AATCAAACACAGCTGTGGAGGACATTTTTCTGTTTAACAGAGAAGAGAAAGACATGCTCA
TTGTACTTCACAAGCCCTCTGTTTCTTTCATCTTGATTTTTCTGTTTTAACCCTCACCTC
ACAAATGTTCCCCCCTCCTCAAAAATGAGAAATGGTTAGGGAGAGAATAATAAAGGGCAT
ATAAAAAAAACAAACAAGGAAATACAAGAGGCAGAGGTACAACAGAAAAGAGAGAAAAGG
GAAAAGAAAAAGTCGAGGCGAGGAGTTTTGGAAGATGGCAGACTAGGAGGATCCTTAACT
CACCTCTTCTATGGACACAACAAACCTACTGCCCGTGGAACAATTTCCTCTGAGAGAGAT
CTGGAAACTGGATAAAAAGAACCTCCACAACAAGGGACATCACAGACAGGGGTGAAAGAG
GCAGAGATACAGCCCCACTGAGGAAAAAACCACATCCTAGCGGCAGTGCTTCACAGCCAG
GAGCGATCTCAAAAGTACAGAGCTTGTCCTGGAGGAGTTGGGGATTTGAACTCCACATTA
GGCAACCCAGCTCTTAGATCCAGCACGAGAGAGATGAGATCCCATAATACCTGGCTTTGC
TGGCTTTGAAAACCAGTAGAGAATACACTCAGGAAAACTATAGACCATCAGGGAAAGAAA
AACCTGCTGTTAAAGGGACCGTGCATAGACTTAATCCAGAAACCAGCACAGAAACACCAA
ATAGAAAAACGTATAGTCTTTTGGTAAAACAGACTTACTCACTAAGCTCAGAGTGCATCC
CAGAGAGGCAGGAGGTGGCTGGGCCCAACCCCAGGGACTGAGACGCTGACAGCAGCCATT
ATTGTAACCTGGTTCAGTCGAGTTAACATGGACCCTGGGAGTCGCCATTGGAATCCTTTT
TCTAGTCTGTTAGTACGTGAGTCTGCCCTGCCCACTAGAGTACCCAAGGCAGTCAAACAC
AGCCAGGCAGCAGGCAGACCGCTCCAGGGACCAGCCCTGCCCACCAGTGAGCCCATGCGG
ACTTGTGAGCCCACAGGGGACTTGTCTTGCTAGCCATCACAAATGGCCACACAGAGGCTC
TGCCCCACCTACCAACACCTGACAGGGTTGTGCACTCCTGTGGCTAGGGCCTGCCCCGCC
CATCAGCGCTCCTGAGGGAGCTGTGCACTGCGGGGCAGCAAAGCTAGTTCTTACCAGAGG
CCTGCCCTGCCCAAAAGCAAACTGACAACAGCCATGCGTCATGCAGCTAGCCTCACCTGA
AGCCTGCACCACATACCAGAGCAGAGATAGCCGAGTGCTGCAGGAGCTCACCAGGGGCCC
GTAGCAATCGTGTGCCCCCTGTCCTAGCATCCAGCCCTGCTGGGAGCCTGACTCACTTGT
CAGCAAGACCATGGGAGATGTGTGCCTCCAGACCTGAAGCAGCTGTGCCGGGGGCTTGCC
CCACCCAATAAAGTGCCCATAGGAGATACGTGCAGCCAAGCTTCACAACCAGCTGACCTG
GGGGCCATCCTAGCCTACCTGTATGCCTACAGCAAGAACAACCCCACCACAAAAGGACAC
ACACAGCCCACACAGAACACTCCTGGAGCATTTGGCACGGGTGTGAAGAGGGGAGCACAC
TGCTGGGCCCCATAAAGCGTCTCTTACATAAGGCCACATTTCCAAGATTGGGAGACAGCT
CATCTACCTAATACATAAAAATAAGCACAGAGAAGTAGGCACAATGAGACAAAGGAATAT
GTTCCAAATACAGAAACTGGACACACATCCTCAGAAGAAAGAAGTAAATGAAACAGATGA
ACAATCTACCTGATAAAGAGTACAAACTAATAGTCAGAAACATGCTCCCTGATCTGGGGA
GGAGAATAGATGAACACAGTGAGAACTTCAGCGAAGAATACAAAATATAAAAAGGAACCA
ATCAGAGCTAAAGAATACAATAATTGAAATGAAAAATTCATTAGAGGGAATCAACAGCAG
AGTAGATAACACAGAAGAATGGATCAGTGATCTGGACAAAACATTAGAGGAGATCATCCA
AGCTGAACAGAAGAAAAATTTAAAAGAATGAGAGCAGTCTAAGGGACCTCTGGGACAACA
TCAAGCATACTAACATTGCATTATAGGTGTCCCAGAAGGAGCAGAGAGAGACAAAGGGGC
AGAAAACTTTCTTGAAGAAATAATAGCTGTAAACTTCTCTAACCAGGGGAAGGAAACAGA
CATCCAAGTACAGGAATTACAGAGTACCAAACAAGATGAAAGCAACAAGGCCCACACCAG
GACACATTATAACTAAAATTATAGAATTAAAGGGAGAATCCTAAAAGCTACAAGAGGAAA
CCAAGTTAACATACAAAGGAAACCTATAAGGCTATCAGCTGGTTTTTCAGCAGAAACCCT
ACCACCTAGACAGGAGTAGCACAATATACTCAAAGTTATGAAAGGAAAAAGCACACGACC
AAGAATACTCTATCCGCAAGGTTACCATTCAGAATGGAAGGACAGAGTTTTCCAGACAAG
CAAAAACTAAAGGAGTTTATCACCATTAAACTGGCCTTGAAAGAAATGTTACAGGCACTT
ATTTAAATGGAAAAGAAAAGCCACAAACAGGAATAAGAAAATTGTCAAAGAAAAAATATC
ACTGGTAAGGCGAATACCACCTCTGAAACCAGTATTAAGGCCAAAACTCAAAGTACTAAA
ATTCTATCAATAAGAGGTTAAGGGATACACAAAAATAAAAGAGGTAAAATACGATATCAA
AAACATAAAGCATTATAGTGGGAGAGTAAAAGTGTAAGGCTTTTAGTAAAAGGTCAGACT
TAAGAGACCAGCGACTTAATATAGATTGCTATTTGTAGGTTATGATGTGTGATAATAAGG
GCAACATTTCTTTATTGATCTTCTGTCTGGATGATATATTCATTGACGTAAGTGGAGTGT
TAAAGTCCCCTGTTATTACTTTGTTACTGACAATTTCTCTATTTGTCTGTTAATATCTGC
TTTATGTATGTAGGTGCTCCTCTGTTGGCTGCATAGATATTTCCAAGCGTTATATGCTCT
TATTGGATTGTTTCCTTTATCATTATGTAGTGTGCATTAGACCAGATGGACCTAATAGAT
ATACACAGTTTTCCCTCCAAACACTACAGAATACACATTCTTTTCAAATACACACGCAAC
ATTCTCCAGGATAACTCAACATGTTAGGCCACAACATAAGTCTCAATAAATCTAAGAAGA
CTGAAATAATATCAAGCATCTTTTCTGACCACGGCAATATGAAAATGTAAATCAACTACA
AGAAGAAAACTAGAAAAGCCACAGATACATGGAGATTAAAACATGGCCTGGTGGCACAGC
AGTCAAGTTCACATGTTCTGCTACAGCGGCCTGGGGTTGCCCGGTTTGGATCCCAGGTGC
GGACTTACACACCGCTTGTCAAGCCATGCTGTGGCAGGCGTCCCACATAAAATAGAGGAA
GATAGGCACAGATGTTAGCTCAGGGCCAGTCTTCCTCAGCAAAAAAAGGAGGATTGGCAG
CAGATGTTAGCTCAGGGCTAATATTCCTCAAAAAAAAACCTAAAAATACTTAGATGTTGA
AAATCTTTAGGGTCAGACAAAAGAATTTCAAACTTTAATTGGCAGCACAAGGGTGGCATT
CAACCAGCAAGAGTTTAGTTGGCCCAAACTATGTTTATAAAAGATCAAATTAATATTTTA
AAACCTTAAGATTTCACACAAAAACCTGGAATTCCAGCTTCTTTTGAGTAAATAGAAGAC
ACCAAGCCCACATTATGCGTGGTGGCACATGGCTGGAGCCGAGTGGAGCTGCTTCTGCCC
CACTGGATGGGCACTGAGGCTCCAGCTCAGTTCCCACCGCTTGCTGTTTTCTTCCTCAAG
GTAAGCCGCTGGGGCATTTGCTGTGGTAAGCTCAGCCCTAAATATAAGAATGTACCGAGT
TATGTAATTTAAGATGTACTGTATGTTTTTAAAAGATAGGAAAAAGGCAGAACACTTACT
ATTATCGAAAAAAATGGGAGCCTAGCTACTTGTGTTAAGGACTTCCTTGTAGTAGTAGCA
TTTCTAACGCAGCTTATAAATTATGGAAGAGGAAGCTCTTGGCCCAGAAGAAAAGCAGAA
AAGAATGTCCATTAACTCTGTCAGGTGACAAGTGGATTTCAGTTTCCATTGCATTTGCGA
ACATAGAGGAGGTAAATAATCTGCACGCCTACAGCTCCAACATTGGTTCACAGTTTCTGG
CTGAACAATTTAGCTCAAGACATCAAAATCACTAACAAAGGCAATCAGTGTCTGTTATTG
ATTTCTGGTTTAGAATAAACTTAAGAAGACAGAGCACAGAATTAGGAATTTTGTGTGGCA
CGAATACAAATATAACTTCAACTTCCAGATCGAAGAGTTTGGAAAAGAGTTGAGGCACCC
TTTTAGTGTAGAGCTAGCATAAACTGTTAAGGAAAGAAGTATACATTTAGGGAATGGCTA
ATTCCTGCCGACCTAAAATATTTCCAGTCCCAGTGTACTCTTCAGAAATAGAAAGTACAC
AAAAGGTAAGGAGTCTGGAATGAAAGCAGTATGACTCAACATAGGTATGGAGCTACTTTT
GAGGAAAGAAAATTCATGAGGAAAAATACTTGAGAAAATGAGTAACTGTCAGACCAACAA
GGGGATCAGTGTAAAGGAATAATTCTGCTGATGTGATTTTAGTTCAGGTCTAATGCTTAT
TTAATGAGCTGTGTAAATATTTTTCAGAGGGTTTGAAATGTCATTATTAGATTTCCTGTG
GGATATGAAACTCTGTTTAATAATGACCAGTATTCTACCAGAACAAGAGCAGCTGTAGTT
TTGCTATCATTCATAAGCTTAGGAATGTTTAAGAGGCCTGGTCACTTATCTTCAGGAAAC
AAAGCCTCGGAAACCAAAATGGGCGCCCCCTTCCCCTCGCAAATATCCCTGAGATATCCT
GCGCCTTCCATAGGAAAATCATCTTCTAAAAGCAAACTAAGTAAAAGGATGTACAAATCC
AGTTCTTCAAATTAGCTAATTGTCATCTAGGTTATTGGTAAGCGTACTATTTATCAATGA
ATGCTAGGCCTTCAAAATTAAAGTTCATATGCCAAGAAGAGCCTCTTGGTGACTTCTTGA
TTTCTGTTACTGGCATCAGCATTCTTCCCGTAAACAGAAATGCATGTCACATGGGTAACA
GGCAAAGGACTAACTGCCATAATATATAAAATAGTTCAGGGGCCGCCCTGTTGCCGAGTG
GTTAAGTTCTCACGCTCCGCTTCAGCAGCCCAGGGTTTTGCCGGTTTGAATCCTGGGCGC
GGACATGGCACCGCTCGTCAGACCTTGCTGAGGGGCATCCCACATGCCACCAACTAGAAG
GACCCACAACTAGAAATATACAATGGTACGGGGGCACTTTGGGGAGAAAAAGGAAAAATA
AAATTGTAAAGAAATTCAACAAATCACTTGAACCAGTAACCCAATAAAAAATGGAGTATG
GACGTGACACAGCACTTCAGGGAAAAATACAAATGACCACTAAATGATGAGAGTTGCTAA
GTCTCACAAGCAACCAGGGAAAAGCAAAATAAAACATTAGGATAATATTTTTCACCAACT
GGTTTTAAAAAAATGGTAGATGACACTAAATATTGGCAAAGGTAAGCAAGTATTTTGAAG
GGCAATTTGGCATAATAAAGTTATTAGTACTTTAAATATGTAGATGCTTTGCTCAAGTAA
TCTTTCAGCAATTTATCCTACAGCAAACTGAGATGTTGCACAGCTGTATGTATCAAGGTG
TGTAAGACAGGCTAAGGAGAAGGTGGTTTTTGAACCAAGATAGACAGATGGGGGAGCATG
TGAGGTGGGTGTCCGGAAGGAGCGATTTAGGTAAAGGTAACAGCAAGGACAAAGGCCCTA
AAGTGGGAGTCAAAAGGCAATGGGGGGGGGCTGGCCCTGTGGCCGAGTGGTTAGGTTCGA
GCACTCCGCTGCAGGCGGCCCAGTGTTTCGTTGGTTTGAGTCCTGGGCGTGGACGTGGCA
CTGCTCATCAAGCCACGCTGAGGCAGGGTCCCACATGCCACAACTAGAAGGACCCACAAC
GAAGAATACACAACTATGTACAGGGGGGTTTTGGGGAGAAAAAGGAAAAAAATAAATTCT
TCTAAAAAAAAAAAGGGCAATGGGAAGAGTAGTAGAATGTGGAGTCAGAAAAGTGGCAAG
GGACCAAATCAAAGAGAAGATAGAGCTTCATGGGCCCTCGAAAAGAATTTGGCCTAACTG
GACTTTGATTAGTTCTTATCTTCTAAATACTAGCATTTCCCTTTACTTATAAGCCTTAAA
TTGTTTTTTTGTAACTTCCAGAGAGTTAAACTTTCACCCTTCTCCTGAGAATAGAGTTTA
CAGCAGGAGGTGTTAACTCAGGGTTTATAAACCCTCCAAAACTTCCATAAGATTCTCAAA
CAGGTCTCACTTCCTACCTCCCGCAGAAAAGCAACCACCAGAGAGACCAAGAATCTGGCC
GAAAATAGTCCTCAAAGGGCCCAGTGATGTGGCGAGTCAACAACAACTCGTGTTTAGCGA
GTCTGGCCCTGCCTGGGAGAACTGGGATTGCAGGGAGGGCTGGGTGCGGCGGCGGCGAGC
AAAGCCAGCTGCTGTGCTCTTCAAAGTCACACATGTTGCTTCCACTCTGTAGCAGAGCAA
AAAAGGAGAAGACAAGGAAACAGCCTTCTAGTGACCAGTCACCTTTGATTGACCTTCCTC
TCACCATCCCCCATTTCATCAGTTGTGAAGGTCACCACCAGTCACCTGAGTGGAAGCCCT
GAACTTCTGTGACAGTATTTCTCATTGGCCATTTTGACTTTAGGCTTCTACTGCTACAGT
AGTCTATCTTATCTGCTCTCTATTTCTAACTTAATCTTCCTTAGGGATGGTTCTAATACT
CCCTGTCAAGAAACCTTTGATGATGACACGCTGCCTTTCAACCGAAATTTAAACTTCTCA
CTGTAGCTTTCCATGCTCTAATCCTAACCTGTCTTTCCAGACTTTTCTCTCAGACCTTTC
TTATGCACATCCTGTGACCAAACAGATAAATTTGAAATCCAGTCCATCCCTAAGGCCGAG
CTTAACTGTTATTAGCTTTGCAAGAAATTGTGCTGATTTTTCCTTTCTGTTTCCTGGAGG
CATGGTGAAAAAGGCAGTGGGCTTTGGAGTCAGACTGGATCGACTTGATCACTAAAGAGC
TTTGTGAACAGAGAGAACTTGTCTGGATTTCAGTTTCTTTGTCTGTAAAACAAAGGTGAC
CTCTGTTCCCTTCATAGAGCTGTAAAGGAGATAACCTATAGAAAGCAGTAACTTCCTTTT
TTCACCATAAGCACATTTCATACGATTCTCACAAGACTTAACACAGTTTTCCTGGTAGGA
AGTCAGTAGACAGTATCTAAGACTGAAAAATCAAGAAATAGGAAGATAATCATCTTGTTA
AGAAACGTGAAGGTAACAGAGCAAAGAATTAAAGTAGTTGCCTTTGGGAGCTAGGAATTA
GGGTGAGGATGATGAGTGCAGCAGATTGTTGTGCATTGCTCAAATCTTTTAGTACCATCT
TGACTTTTAAAATTATGTATATGGACTACTTTGATAAAAATAAAATTAAAAGTGAGCAAA
GACGTATCAACATAAAAAATTAGGCATAATTAGACTGGGGAGGGGATAGTTAGTGTTTAA
TGGGTACATAGTTTGTTTCAGTTTTACAAGGTGGAAAAAGTTCTCTGGAGATGGATGGTG
GTGTTGATAGCACGGCAGTGCCAATATGCTTAATGATACTGAACTGTCCATTTAAAAATG
GTAAAGTTTATGTTATGTGTATTTTACTGCAATTTTTAAAAATAATAAATTTGACAAAAT
TTTTTAAAGTTAAATAGTGCAAAAGATTTTTGGTATTTAGTAGCCATCTCAGTGTGTAGG
GAGCGCTATTCGTCTGCAGCAGTGGCCAACTCCTGCTGGCCAGATGTCTGGCTGTTCGCT
GTCCGCAGGCTACAAATGTTTTACATTTTTAAGCAGTTAAATTTTAAATGGTTATGTAAG
TCCCTACGTAATATCCTTTGGGCCTTCAAAGCCTAAAATACTTACTTTTGGCTGTTTTAA
GAAAAATTTGCTGATTCCTACCCTAAAGTAATTGTCAGTTTAATATGTTGGCTCTGCCAG
TAACCAGCTTTATGTCCCACAAACAAAGCACCTTGAATATTCCGGGCCTCATCTTCCCGT
GTTTAGAAGAGGGAATATTTGCCCTTTCTGGAAGAGTTGTGTAAGGATCCAAAAGATAGA
AGGTGAAACTGTGAAGCATAGGTCTCGTGTTTATTTTGCTTTATAGAGATTGACCGTTGG
CCTTATTTGGTTACTCTTTGTTCAAAGCAAGTGTGTTTGCTAATCACCTTCCTGTGCTCC
GTTGGGCAGAAATTTGATTACAGAAAGCCTAAAGCCAAGGCCCTCAAACTTTTTTTTTTT
CTTTTTTTTTTTCTTAAGTTAATGATAGGTTACAATCTTGTGAAATTTCAGTTGTACATT
AATGTTTGTCATTCGTGTTGTAGGTGCACCACTTCACCCTTTGTGCCCACCCCCACCCCA
CCTTTCCCCTGGTATCCACTAAACTGTTCTTAGTCCATAATTTTAAATTCCTCATATGAG
TGGAGTCATACACAGATTATCCTTCCCTCGCTGGCTTATTTCACTTAGCATAATTCCCTC
AAGGTCCATCCGTGTTATTGCAAATGGAATGATTTTGTTCTGTTTTGCAGCTGAGTAGTA
TTCCATTGTATATATGTACCACATCTTCTTTATCCATTCGTCTGTTGATGGGCACTTAGG
TTGCTTCCATGTCTTGGCTATTGTAAATAATGCTGCAATGAACGTTGGGGTGCATAGGAC
TTTTGGGATTGCTGACTTCAAGCTCTTTGGATAAATACCCAGTAGTGGGATGGCTGGATC
GTATGGTATTTCTATTTTTAATTTTTTGAGGAATCGCCATACTGTTTTCCATAGTGGCTG
CACCAGTTTGCATTCCCACCAGCAGTGTATGAGGGTTCCTTTGTCTCCACAACCTCTCCA
ACATTTGTTACTATTAGTTTTAGATATTTTTGTCATTTTCATGGGTGTAAGGTGATATCT
TAGTGTAGTTTTGATTTGCATTTCCCTGATGATCAGCGATGATGAGCATCTTTTCATGTG
CCTGTTGAAGGCCCTCAAACTTAACAGTTGGAAAACTCTGGAGTTAATGGAAAGAGTTAA
AACTAAAACATGGCTGGTATGTGATAAAAGGCTACCCTTGAGTCAGGATTAACTGTGCTT
AGTAAATCAAAGACTATGTATGTTTGGTGTCTTGTTGCTGGAAATTACTTTCTTTGAAGA
CTAGAAAAAGTTACCTAATTCATTTGAACTAAGTTTGTTTCATTCTGGCCAGAAAGTAGA
AAGCTTTCTGGGGGATAAATGATTCTTAAGGGAACCTTAATATGCCACTGATGTCCCAAA
GATCTTAAAGCCTTACAGTTCTCAATGTCATTGTGTTACCCCTGGCACCTATGCCCAAGG
AGGCTTGTTATTTGATAGCTGAGAACTAGTGTGAAAATCCTTCCAAAAGGGCCAAGTAGA
AACCGTGTCCTTAGGACGCTCAAAGCAAAGGGCCCACTGGAAGGAACAGTGTGCGGCTCT
TTCCAAACCAGCCGGCAGACTGGAGAGTCCTGTGGACCTGTACTCAACTACAGGCCGAGG
GCAGTTAGTCTGAAGTTGAATGTTTGGTCCCAGGAAAGTGTCTGCAAAATTCTTCTTTCA
ATAACCTGCTCTCCATCATTTTTCTACTAACAAACAGCAGTAAGGCCACCTTAGCTTTTG
CTTTGCTTTGTGTTGATTCAGAATGGAGTTAGAGTAGTGTTATGTTGTAAGCTGCTTGAA
AGAACCCTCATTACACTCAAAGTTTAGGTCTAATAACTGAGCCATAGTGATGCTGTTGCA
GATAGCTGAGCTGCCTTTTTTTTTTTTTTTTTTTTTTTTTTAAAGACTTCGTTTTTCCTT
TTTCGTCCCAAATCCCCCTGGTACATAGTTGTATATTTTAGTTGTGGGTCCTTCTAGTTG
TGGCATGTGGGACTCCTCCTCAGCATGGCTTGATGAGCGGTACCATGTCCACGCCCAGGA
TTCGAACCAGTGAAACCCTGAGCTGCCGAAGCGGAGCACATGAACTCAACTACTTGGCCA
TGGGGCCGGCCCCCTGAGCCTTTTTTCTTTTGTGCTTCATAGTTTAGTTTTTCCATTTTT
AGGTATTTGGAGATAATTATAGTTCACTTTCAGATCCTGCAACATTTTATTGACTTACTG
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTGAGGATGGTGGCCCTTTAATCTATCAGCAGAAGCCACCTGGC
AGGACAGTCATTGCAGAAGTGGTTAGTCTGGAGTCTTCTAACTCGGTCACATCACTGAAT
TTCACAGAATTTACTCACTCATAGCTGCAGGGCCTCTAGTGGGGTAACCACTGGACCACA
GCTCCAATCCACTTTGCTTTCCTAACACATGACTTGGAACAAGTACTCCATTGGCACAGT
ACAGACTGCCCGAAGTTCATGGTCCCTGCTTGTTTGTGAAACTGTAAGAAGTATTTCTTT
AAAGCTGCTTTTGCTACCTCCATTCCTCTTATTAGACTTGGGAGCTATTTTTCAGGTAAC
TGAAACATTTTCGTTTCTGCATTTCATATGAAATATCTATTACCAATCTTTTTCCACATG
AAAAATTGTTTTCTTGTGAAGCAAAAGTAGTTCAAAGTCTAATCCTTGAATGTTTTTCAA
CTAGTATGATGATGCTAAGCGCCTCACTGCCCATTAGTTGTGTTAGACTGTCTGACACAG
TGTGGGAGAGAGCAGTGATCAGCTCCTGATTCAGAGCTTGCTTATACCCGTCTTATCACC
ACTGCTTCTTGAGTCTTCAAAGTTAATATTTAGAGGACCTGTCCAGAGTCCAAAGGCTGA
TAGTATTGTTTCCAGAGTGTGTCACCTTGTTGACACTGCAGCCTTCAATCAATCGACAAT
GCCAGTGAAGTTATAAACTATATGACCAGCAGGAAATTATTGATCTGGCTGGGACTTTAA
TAATAATAAGCATAAGATCTTGTGCAAAAGTGTTGTGGAAACAAGTTGGATGGGGAAAAA
TCAAGAAGTTATTAAAGATGATGATCTTAGGTACAAATTGTGAAAAGTGAAAAAAGGTTG
TGAATATGAAAATAAACGTATTAAGTAATTTAGGGGATTTCTCTCCTAGTCTTGGTTTCC
TACATTAAAACTTGTATTCTCTTGTTTGGGATTGAATACTTATAATCATGAATGGTGTGT
CTCAATTTTGTGACACTCTTATTTAACCCTTTGATGCTAGAACACTACACAATGCAAGGC
TGTTTTTTTCTTCTCTCTCCCCCAGGTGGTCTTCGAGGCGTAGCACGAGGTGGTCTAACA
GGACTAACACTTACCAGCCTCTATGCTCTATATAACAACTGGGAGCACATGAAAGGCTCC
TTGCTCCAACAGTCACTCTGAAAATTTTGCCAGCTTGTGAATGGAGGACACTTTAGTAGT
TATCCAGATCAATTTATAAGTCAGTCTGGAGTTATTCTCTCTTCTGCCTACAATTAGTTT
GAAAAATTGGGGATTCCAGTTTGCTGTGATGAAGACCACGGATGTTTGACCAGGACTGGC
ACGCCTTCCAGCCATTAATGAGTTGAAGCCAAAACCCTTTGGTGGCTGAGTAATGTGGTT
CTCTTCTCCTTTGAAGAAGATCTTGCACCTGTTCTCTCCTACCCCCTGAACTGGACAGCC
ACTTACTCCCAGAGTTCAGGTCATGCTTGTCATCCATACTGTAATACCATGTTTGTTCAT
TTAATGACTCAAAAGTATAATATTGCCCTGTATTCCCAATAAAGGGTGAAAACAGAACCA
AAGTCATAACTCCAACATAAACAAAGTGGGCATCTCCATTAAAAGATCTTTCTGGGTATA
AAGTGAAAATTATTCTTTTCTTTCTTTTTGTATTTTTTCTGCCCCAGAGACTAAAACATG
TCACGGTTGTGTTGAAATGAAGGGCTACCGACAGCATTAACAGCTAGGAGATTTTTCTCC
AATAGAGTTGACAGTGAACAACCTCAAGATATTTCAGATTAACCATATTCCATTAGAGTA
ATGTAGGAAACAACTGGTGGTGATTATGACTGGAAAAAGTCAACTAGGGCCCTTGTGGAT
GCATCTACTAAGAAGGAATTGGGCAGAAAAGCACTGAACCTTAGCTGAAGTCCTCTTGTT
TAAAAAAAAAAAAAATTTAATATTTTAAATTTCATCTGCAACAGAGCAGATTAAAAATTA
AAGAGTGGATGTGAAGAGTTTGCAGAAAAAGACTGAAAATGGGAGTCAGTAAAGATATAC
CTATTCTTTGCTAATTTTAGATTTGTAAAATACATTGATATTCCTCAATTTATGTTCAAG
TTGAGCTGTACTCCTAAGCAACGGTTATCACGCTTATATAATATGATAGAACATTTTGTG
ACAGAGTCGTTTTACAGATACACACAACAACTGCGGCTGTTATGCTTTTAATGGAGGGAG
GTACAAAATGCATCAATGCAAAAGAATGTTTTACATACTCATTAGCATAGTGATTAATGT
AAATTTAGGACTACACAGTATATTAAAACTCAACTATAAAGTTTCCTGCAACCTAAGATA
ATGGAAAGGCTCCTTAAGTTTTTACCACCACCTTTATTTTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1286, 3603..3661, 16900..16993, 17215..17299, 19738..19796, 21634..21744, 35245..35580
1181..1286, 3603..3661, 16900..16993, 17215..17299, 19738..19796, 21634..21744, 35245..35357
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved