Equus_caballus Locus TOMM20
snOPY snoRNA Orthological Gene Database
Equus_caballus TOMM20
Equus_caballus
TOMM20
1
SNORA14
1714..1848
16805
ACCTACGAGTATTGCCATCCTGGGAAACACCTGCTTCTGTGCCGAGTTTTTATTTGGAT
TTCGTTATGTAGGCCAGGAGAAGTTGAACTCAATCTCCTGCCACCCCGCTCCCCTCCCCA
GAGGTAGGGCTGGTACGACATGGATCAAAGTCCCCACCCTGTAACCACACAGTTGGTCTT
TCTGGCCTGCCAACCCCATTATGAGCCATCTCCCTAGCATAAACTGTCATGGCCCACCAT
GAGTTTCTATCACTCAAGGGGATAAGAGGATCCCTCCCAAGACTGGGGACAGAGGGCCAG
CCAAATTCTTTACTACACGACGTGTACTTCTCTTACCGTGCCTCTCATCAATTTCTAGTT
ATTTAATGTCTGCTTTCTGCCCAAGGTTGTGTCCTTTTAAATTTAAACTACATATATGTT
TTCGGTGGCTATAAAACAACTCACGTTCTCTATTTTTTCCTTCAATTTCTTTTACCACCT
ATATTTTTCCAGGAACTGCTCCATTTAATTTTCTTCCGCTCCTCATGAGACTATATTGCA
ACATTCTTTTGAAGTTGAATCACCAAATTATGGAGCTTGTTGCACAATGGCTTGTGACTG
ACCTTGAAAAGCAAATTCAGTTAAATTCAAATAAGAGTCACAGGTTGCCTGAATTATACA
AAAATAAAATGAAGCATTTGACGTCAGCAACCTTCCATCTTTGTCTGACACCCACAAGGA
AGTCAGCTACAAACTCTTCTGAGTCTGTGCACGCCGGCCACACAGCCCCCTCGTTACATC
ACGCTCAGGGGCTTTTAAGGAAACGCGTGATCACTCGCAAAAACCTCACACCGACGCGGA
CACCCGCGCCGGGGAGCCTTTGCCCGGTGCGCAGGCGCAGAAGCGGTGCGGGCGTCTCCG
CTCAGGCACTGCCGAGGACGTCCCCGGGGGCCTCGGACGTCTAGGGCCGGAAGTGACGCG
TGTTCGGCCTTTCCGCGTCCCCCGCGGCGGGCGTGAGGTCTGAGCGGGGCCGTCAGCTCT
GAGGGTTCGCGGCCAACGTGCTTGTTCCCGGACCCCGGCGCCGCCGACCCGGCTCCTCGG
TGGAGAGAAGATGGTGGGCCGGAACAGCGCCATCGCCGCCGGTGTGTGCGGGGCCCTCTT
CATCGGGTACTGCATTTACTTCGACCGCAAGAGACGGAGTGACCCCAACTTCAAGAACAG
GCTGCGAGAACGTGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGCCTGCACGATTCCCTCCAT
TTTCGAGGGATGGCTTTTCCCATTTTGTAAAAACCAAACGCGTTTCCCAGATGAATGCGC
TCTCGTTTGTATTATAATGTAGGGTACGTGTGGGCCGGGGTTTTTTTTGGCCATTCACCT
TTTGAACCTCTGTTCTTAACTCGAAAGTCGTGTTTTTTGTATTTTACGGGTTTGTGCTTG
AGACTAAATTCACACACCCAACGCGGTATCATTGTCGCATTCTTAAACCCTCTTGGTAGC
TTCGCTCTAAACGCTTCCAAGATATGAGTGAATGCTATAGAATTTGCAGGGGAGTCCAAA
GGGCTGCGCTCCTCATGTGGCTCAGTCTTATTTCATACCTGCGACATCTTTTAAGAGAGA
TCTACAAGAGGAAAGTCGTGTCACCAAATCCATTGTCATCTTTGAGTTTCGGAGGCATAC
GCGTGTGCAGCAGTGGAGGAGCAAATTTGTTGCACTAAGAAATATTTTTGTAACTTATCT
AGGTTGCTCAGTCAAAATAGTTTCTGAAATTAAAATTGATGTGTAAGTTACTAAAGTCTA
GAACGTACAAAGAAGTGACTATCCTATTTCATACTGTTTTATTAAGTTATAAGAAGTCAT
TTCTGGTGTTGCCTAGCCACACGTGGCTGGGGACTAGCGTGTTGAACAGTGCTGATCTTA
TACCATCTATGATAGGAGCGCTAATTCTAGCTCTCTCACATTTTGGGAGGAAGGGATATG
GAGGTAGTTTATTTTATTTACGGTTAGGTAGACTGATGGCAACAGTGCTGTTTTGGATTC
AGATACTGAGTTTCCAGGCCCAAATTAGTCACAGATTAGCAGCATAATCTTGGCCTTTCT
GAATCTTAATTTTCTTAGTTTGTGAAATGAGGCGATGCCACCTTCCTCTAGTTGGTTTTG
TGAAGATTAAGATGTTTGAAGTGCCCACCACCATTCCTAACGCAGGAAAGGCCCCTCCGT
AAATGCTGCCTGTAAATGTAACTACAGGGATGTAGATGATTTTCCTACAGATTTAAAAAT
AGTTGGGGTGTGTGTGGAGGCAGAGCTGGAAGAATGGATTAACCCTTTCTTCCTTTGGAA
ACACTGCAAGCCTATTCTTGAAAACCTTGAGAAAACTATAATTTTTGGTTGAAGAAATCA
TAAAAGCTATCATCTTAGACAACCTGAGAAATGTGTTATTTTCAAAATTCCTTTTCCATC
ATTTTAAGTCAATAAATTTTTTTTCTAGCTTTAGTAGTAGCCTAATGGTTTAAATGGTCA
GGCTTGAGTTAGTATTAGCTGAGTAACCTTGGGCAACCGAGTTGAAGTTTTTGTTTCCCT
CTTGTAAAGATAAATGTAGAGTTTAGTACAGTCCCTGGCACATGGTAATTGATGGATGCT
AAAGATTGTTTATGAATATAATTATTATTTGATATTTTCTTTAGCAAGGAAAACTTTTGC
TCAGAGAAATTTTGTGTTGGCTGATTTTTTAAGAACTTGAGGGTGTTTTGTATTGGTGGA
ATGAAATTGATTTCAGTTTAGTTAGTTTTGACTTTTTTCTAGTCTAATTTCTAATAGAAT
ATTTACATCTGCAAAAAAGGCAGAGTTTCTCAGATCAGTCATTTTGGCTTGTTAGTGTTC
CTGATAATTTTTTTTTAAAGAAAAGAGGCTTAAGTTGTTTGCAATAGGTTTGAGGTTAAA
TCTGGGATTCTAATTTATTCAGATTTTTGTCTTCCATTAGCAAAAGCGGATTATGAGGAC
TCTTAGAGTATAATTTTTAACAATCTAAATAATCCTTAATAAATGAAAATTAATCTCCAA
ATTATAGTGCCAACTACAGGTGTGTTTCATTATACAGCACTGTTTAAAATGATTCATCAT
TTTAAAATATATTAACTAATTTCCTTACTTAAATGAATGCTTTAAGAGTGATTTAGATTT
GTGGCTTTTAGTAAGCTCATGTTTTATGTGTATTTTTTAAAGTAGACAAAATCTGTTTTA
ACTTGTTAGGTTTACACAGTACTTGGGATACTTGCAAATATTGAGTCCAGGCCTGATTTT
GCTGATTGAATGTGTACGTTGGTTTTTCAGTCTCTTACCATCTGTACTTTATCACAGAGA
TACTGTATGATACTCTCTGAAAATAAGTTAATGTAACAAGTTAATTGTCTTATGAAAACT
GAAGCCAGAAAATAGGGATGGTAATAGTACTTGTCTTCATGTTACTGTGAGGATTAAATA
AGCTAATTAATAACACAGAATAGTATCTGGCATGTAGCATCTAAAACATACTGAGTGGTT
ACCCTTAACATCTAAGTGTTCCTTGTCTTCATGTCCAGTTCCTCTGAAGTCTTCCATGTC
TCTTCTAGTCTCTTTTTTTTTTTAAGGGAGATTGGCCCTGAGCTAATATCTGTTGCCAAT
CTTGCTTTTTTTTCCTTCTCTCCCCAAAGCCCCAGTACATAGTTGTATGTCCTAGTTCAA
GCCATTCTAGTTCTTCTGTGTGGGATGCTGCCACAGCATGGCCTGATGAGCAGTGCTAGG
TCCTGGCTCAGGATTGAAACGGGTGGACCCTGGGCCGCCAAAGCGAAGCACGTGAGTTTA
ACCAGTTGGCCACGCGGCCCGCCCCCTCTTCTAGTCTTAATACTCTCCTTCCAGCACTAG
TCTGTACCTTGGTATGTAGTAATTAGTCTGATATCATTCATCATTTTCTGCCTAAATAGG
GCTGAACAAAACCCTTAAACAAATTGAGGGTTGAATATGCTGTGTGTTCTGTTTCCGCAG
AGTGAGTTGCTCAGTGACGAACAGCTAGGAAAGGAAGTTTGTTAGAAACGTAGGCAGTCT
TCAAATTAATATGTAAGATCTGCTTTAACCTATGTTTTTCTGTTGAAACTGCTAGAATTG
TGTTTAAGCCTTAGAGTTTCAGCACTTCGTGTATTTTGGGGGCTAGGGTTGGTAAGAGAT
GCTGGTGTGGTTAAACTCGGTTTGTAAGGGTAGTGGGGAAGGAAGCTTCCCTGGCAATAG
TAGTTAACCTGTCTGCAGCTGGGCGGACCGCTCACTGCCTCTTTAGTCGGCATCAAGACT
TGGATCTGTAGAATCCTTGAAGGTTTTCAGAGCACATTTGCTTGTTTTATGCCTTTTGTT
TCTTGGAGTGGCCTTATCTTTGGCAAGTTAAGAGATTTATTTGCTGAAAATTACCCAGGT
AATAAGTATTAGAGCCTTAGCTTTCTTAGGTATGCCACCTGGTCATTCTCCAGGTCCTTG
GTGGTTTTTAGGAACTAGTGAAACTTCCTTCTGTAGGTATTTAGCATAGCATAGCTCCTT
AGCTGAGGAGTGGGCATTCAGCTGTCTCAATACCAAGTGCTTATATGGCATGTTATAAAT
CAGGCACTATTCAGAAGTTCATTACATACTTTAACTCATTTAATCCCCACAACAACCAAT
TTTCCATACATAGAAAATGAGCAGAGGTTACTGTAACTTTCCCAAGGTCACGCTGCTAGT
TAGTGGAAGAGCTGGCAGAGAAGCCCAGGTTTCCTCCATGCCAACACCCTTTTACAGGGG
TATACAATTAAATAACAGTTTAAAATACTGTGTCTGTTACTGATTTGGTTTTAAGGGTTG
ACTGATGATTAAGATTTTAAACAACACCACTTACTCCTAAGATTTGTGGTATAGCTGTTT
CGTATCAAAAACAAGACAGGTTTTTTCTTCACTAGTCAGCAGTGTTGACAAGAATTGAGC
AGTGCTTCCCCCCCTTTTTTGCCAAATGCATAATTACTGTGTTTATTTTTTTAAGAAAAC
TTTCTCAAATGGTGATCCCCCCCCGCCCCCGTTTAAGAGTGCCAGATAGTTTCCAACATT
CAGTAAAGATAGAAGCTGTTACATTTCAGTAATAAAACTCCCTAACAGCAGTGGCTTAAC
TCTTGCTGTGTTTGATGACCTGTGTAGGTTGGGGGTGGGGGGCTTGCTCTGCTTTTGGTA
ATTACTCAAGAGACCCAGCTGTTGGAACTGTCTCCATCTTGTAAATTGCTGATCCTGGTG
CCCCAGAGGGAAGGAAAAAGCTCCTGTGCAGAGATGTCACATTGCCCATAGCTCATTGAC
CAGAACTATTCATATGACCCTGACAGACCACAAGGAGACCAGGGAAGAAGAGAGCTGGAA
TCGGGAAGGTTTTGCAAATAGAATGAATGACTGCCACAGCAGTTAGACTTCTTTTGATTC
CCATTTTACTAATGATAAAATGAAAATACTACATTTCTTGCAGGAAGAAAGAAACAAAAA
CTTGCCAAGGAGAGAGCTGGACTTTCTAAGGTACTGCGTAATCTGTTTTTTTTAAAGTCT
ACTTCAAATATGTATTTTGAGAAAGCTAGTTGATATTAGACATTGATTTTTTTTTTTTTT
TTTTTTTTTTTTGTTAAAGATTTTATTTTTTCCTTTTTCTCCCCAAAGCCCCCCGGTACA
TAGTTGTGTATTCTTCGTTGTGGGTTCTTCTAGTTGTGGCATGTGGGACGCTGCCTCAGC
GTGGTCTGACGAGCAGTGCCATGTCCGCGCCCAGGATTCGAACCAACGAAACACTGGGCC
GCCTGCAGCGGAGCGCGCGAACTTAACCACTCGGCCACGGGGCCAGCCCCTAGACATTGA
TTTTTTATATTAAAATATAATTTGTTGTTTTGGGGAATAGTTAACTCAGTTCAACTGCGG
ATTATCTAGGCCTTCATTAGCTCCCCTTTGTTAGCCATAATAGCAGACAGCTTGTTATAT
GAGCAATATTTAAGGAACGATAAGATTATAGTCTCCAGAAGACATTTATACCAAAAGATT
CAAACTTAGCTGCTTCAAAATGATAAAACATTTATTAATTTAATTTTCCTTCTTCCAACA
TCTTTCAAAAGAAGGACATGCTGTTTGTTTCAAAAGTTACATAAATTATTCACACCCACT
GATCCAGAATCCCACCACCTGGTAAATTTTTACCTTGTTATAATACGTAAGTGTAGATAT
AAATCTTTTCATTCATTTTTTCTTTTCATAGTCCTGTGTTCATGATTATTTTTAATGACT
ACATAGGTTTATCTGCTTGATAAAAAATGTTCTGTGGCATGTGTAAGTAAATATAATTGT
TGTGCATATAGCTTTTCTTTTTCATTGAACTTAGTTCCATTATCTAGGTTTCCAGGACTT
GGACTACTGGATCAGTAGTGGTTTTTTTTTTTTTTTAAAAGATTTTATTTTTTTCGTTTT
TCTCCCCAAAGCCCCCCAGTACATAGTTGTATATTCTTCGTTGTGGGTCCTTCTAGTTGT
GGCATGTGGGACGCCCGCCCCAGCGTGGTCCGATGAGCAGCGCCATGTCCGCGCCCAGGA
TTTGAACCAACGAAACACTGGGCTGCCTGCAGCGAAGCGCGCAAACTTAACCACTCGGCC
ACGGGGCCAGCCCCAGTAGTGGTTCTTTTTAAAGCAAGTCGAGGCAAGGAAAAATTAAAT
CAGTAAATGTTGTCTTTGTTATTTTGAAGCAGTAGTCAACACAGCTAACTGACTGTGTTG
ATACTAATGATAATATCATTAATAATGATGATAATGAAGTAAAACTAGGAAGCAACCACT
TTGTTCTATTAAGTCCAAACCACCTTTCTGAAATATATATGTTCATGATGCTTTTAGTAG
CCTTTTCTTTCTAAGGATATAGGGAAATAGATATATTATAGACATGTGCATTGGTGTATC
AGTTATAATCACATTCTTGCTGTATGCTGGGATAGTCTGTGAACGATGTCTCCATTTTGA
GAAATTTAAATTTGTTCACCTATCTTGTTAATAAGAGCGTATATAGTATAATTCAAGAAC
CAAAAACTTCCATTAATAGAGGGTCTTTTTAATACCAAAGCCCAATAAAATGAGGTATGC
TTCTAGTAGGTTTACGTTTTTTAAAAAGATAGGCCATATAGCTGGTGGTATTATATATTA
CCATAATCATTCAATCTGGTAATATGTAACAAATATAAAACAAAAACACAGAAATGCAAG
CTTATTTAAATACAGCTACTTGTGATTGTTTATAATAGCAAAAAATTAGAAGTAGCTCAA
ATGACTAACAAATAGATCATGATTATGCAATCATATATTCTTCAATGGTATATTCTATTG
CCGTTTAAAAATAACTAATCTTTTAGATGCACGTAAAATCTGTACAAAATAATATTGGAT
CAGAAAAGATTGATTATAGTTATGTAAAAATTTATAATGCGATCAAAAAATAGTGTAAAC
AGTAAAGAGCATATTTTATGGTTGTGATGTTTGTATTTTTCGTTTTTTACTTTAGGTTTG
ATTTACGGCTTTCTAAGAACTGTTCAGATACCAGTTTGATCAATAAGTATTTTTTTCTTG
GATTTATTTGAATGTAGTAGATACCAAACTCTAATACTTGAGATTGTTGTTGAAGAGTAA
TTTTCTTTTTATATTTTAGAATTAGCTATTCAATTTTTAGTTGTTTTATTTTTAGTGGTA
TGATTTTCTGTGTATTGGTTATTTCCCCTGTCGTAATTTTGTCATACTAAATATTCCATT
TCAAACAGTTACCTGACCTTAAAGATGCTGAAGCTGTTCAGAAATTCTTCCTTGAAGAAA
TACAGCTTGGTGAAGAGTTACTAGCCCAAGGTAATAGTCATTAAAAGACTAGGAAACTAG
ATAGAATTCTTCACACTAATATGAATTTATGGTGGTAAGGGGCTTTTTTGGTGTAGTAAG
GCTGTTTTTTTAAAAAAAAGGTATTCTAAATATTTCAAGACAAGTTTTTAGGCATTTAAT
AATGTGAGGACTGTTTTATTTAAGACTGGCTCTAAAAATAAATATTTCTTGTGGGTTATC
ACTCTCCATAATAATAATTTGAATGAGTTTTAGGTTTACTTGATGTATGATGGAGAGAAG
ATAATAAGTAATCTTTACAAATGAGGTTACTTTGTGTTTGTGTGTGTGTGTGAGAAAGAC
TGGCCCTGAGCTAACATCTGTGCCCATCTTCCTCTGCTTTATATGTGGGACGCTGTCACA
GCATGACTTGATGAGTGGTTTGTAGGTCTGTGCCTGGAGTCTGGACCTGCGAACCCTAGG
CCACTGAAGCAGAGCATGCGAACTTAACCACTGTGCCACCAGGCTGGCCCCTAAATGAAG
TTACTTTTAAATAGTTTGGAGAATATAGTCATAGTGCAATATGTAAATAGTAACTGAAGG
AATATGATCTAGGAATATCCTCCCTCAACTCCTTCATCTAATCTTGAAGTCTTTTCCAGT
ACTTACAGGAAGGATTGGTTAATATAAGTCCCAGAGAAGATTAATTACCTGAGCAGGGTC
ACACAGTGAGTTCTTGGTGGCCTGGTTTCAGAACCAGTCAGTGATCTAAATCTGATCCGG
AGTTTAGGCTTTGTGCTTTATGTATTCCATCAATAGGATTAAGAGGTTTTTATTAAAAAA
AAAAAAAAACTGCTGTGAAATTAAAATGGTCAAATTTATAAATTTGAGAACTATAATTCA
TTCAGTAATTTAGAGTCTTAAATGTATTTATAAATTTCTTTGGTGTCAAATTAGCTTTTT
ATCTCAAAAGTAGCTTTGAAGTAGTTGCTGTCATAAGTAAAAATAGTATCAAGTGTTAAG
TTTTTTAATTCTCATTGCAGTATCATAATAGATTTAGAGAGTATTGAACTATGTGATGCA
GGTCATTTGTGGTTTTTTATTTGTTTATTTTATAAGACGAGATTAAGTGTTTAAAATGGT
GGTGACCATCATTACTTTTTATCACATGTCCCTTTTGCCAACGAATACTTTTTCTTTTTT
CTTTTTTCTTTTTTTTGAGGAAGTAATTGTCTTTTATTTAGATGGTATAGTAGGCTGATA
AATATTTAAATAAAAATAGAAATGCCTTACCAGAAGGTAATTGTGACTTTTTCCTCCGAT
ATAGTAAGGAAAATATGAAGTTTAATCACAGGGCAATAGTAAAGCACTTAAATCCTCCTA
AAGATCATTTGAGGGGCTGAGTATAATTACATTACTTTATTATCTGAAAAGGAAAATCTG
CATGATATCGTTGTTTTTTAAGGATATAGATTGTAATATTCCAGTTAATGTAAACAAATT
CTCACAAGTTTTTCATGCTCATAGAGATATTTATTTGATACTATCAAAATCTTCTAGCCC
CCAAAATATAAACAATATTTTAAATAATTTTATTTATAATTTAAGATATTATAATGTACT
CCTATTACTTACATTTGGATTGTCTTGGTGATCCGTGCACTGTGGTCGTCTATCTGACTT
GAGCCGTTGGATCCAGGTCGAGGACAGTTACTCAGGGTGGTCAGGGGAGGGGAGGTCAAG
GGGGGACAGGGAAGAGTTGTCTTTTTTTCCCAAACTCATGTTCCACACTTCAACCCAAAA
CACCCAGTGAATTACTTAACAGCTTAGCTGCCAAGCTGTCTTTCTTCTGATAGAAAGTAC
CAACTCAACCTAAGGTAGAAGACTTAGGTGGATAGAATTAGGAAAAAGTCAACATCAAAG
TAAGCCAGGTGAAAGCGTAAGCAATTTGGGCAGTGAACTTCATTGCTTGGCAAGGTCTCC
TTCATCCAGGGGTCTTCCAGAAGCATATTCCCTTAACTGAGTAAGATCTCATCTCAGGAT
ATGTGAATGGGATCAAGTCTGCAAGTGCAGAGAGGAAATAGTTCCACCTGCAATGAGTTG
CTGTAGTTGTTTATTAACTGTTTTCAGTGTATTTAGAAGTATTTGGAGGTGTCTCAGAGG
ATCTCCTATGTTGTATACATACCATTCCAGTAGCAGCTCTATTTCCATTTAATAATCAGA
ATTAATGTCCCCAAGCAAACAGTGTAATCCACTCTATTGCTTCTAAATTCAGTGGCGTGA
GAATCCAGTGGCCAAGTGGCATCTTAATTTCCAAGTTGATGGGGCCATCATGTCCCCTGA
TGAAGTCCAAGCCCATGCAGAAGACATAAGTCTTTTTTTAATATTTTCCATTTTTAATAC
TTCTTTGTAGAGTTCTGCTTTCTTCAATTTGAATACCTCAATCTTTAAATTTTCTCGAGT
GAAAATGTTGCAGCAGGCAATTCCTCTTCATATCCCAGTCTTTAGTCCCTTATTTGGTTA
GATTCTTCTTATTCAGGGGTTTGAAAACTTTGTGTTTACTGATTTGTTATAAAGGGTACG
GCTCAGGAGCAGCCAGATGGAAGAGATGCATAGGGCAAGGTATGGAGGGTGGGGGAGGGA
GTGAGGAGCTTCCTTGGCCTCTCTGGCTGCCCCGCCCTCCTAATACTGATGGGTTCACTA
ACACAGAAGCTCAAGAAATAATTTCTTGACAAAATTAGAATTTGCTCAGTTTCACCTAGA
GAGTTATAAATGGCCTTCATTAAAGTTGCCTGCTAAGAAGGATTAGAAATGAATGAGGAG
AACCAATCAAAATGTCCGTAAGTGCAGAACGCGGGATAGATAGCAATCAGGGAAACGTTT
CAGGTCTCCTTTAGGCCGCACAGTTCAGTTCCCTAAAAGGGAGGGCATTCTGCTCAACTC
TGAAGCAGTGCTTGATACCAAGTGGTGACTTTGGTCCTGTACCACTGGGTTTGATCTTCC
TCTGCTGTGTAATAGATAGATTATATGATGCATTCGATGCTGTTGATATTAACAAAAGGT
ACCACTTATGATCTGGCTATCCAGTCAACAAAAGTTGTAGCAACATCTGCTTTTCACAGG
AAGGGAGCCCAAGATGACAGGTAGACTGCCATTGACTCTTTGTCAATGTATAAATGTATC
CTGGATATATAGGATTGTTTAGCATTGTTGGACCCACAGAAAAGATAATTGCCAGTGCTG
ATTAGGGTTGGAAGAGATTTAAAGCCTTTTGGTGTCTATTCACAAGAAGGAACTGACTGT
CAGCGGGTCACTTGATTACTACCCATCGACTGGATCAATGCACAACCCTGGGTTGGATCT
CATGATGGACATCATTGTTACATAATTTCATTCCCCATGGAAGTAATTGACTGGGCGGGT
CAAGATGGTGGCTGCCCATATCCAGGTGACAGTGGCTAACACGATCAGGAGGGTATCCAG
GACCAATGTATGGACAGGATAATTGCAGTCCCTGAAGTGGCAGTGGAGGTTCAGCCATTC
CTCACCTGAGCTCAAAGACATTAAGAAAGGGCTTGGAAAGCCATACGCATACACTGGTGT
CATGAGACACCTCATGGTATTCACACTTTTACCCAGAGGGTTTCCCGACTTCCACAGTGG
CCAGTTGGTGAAACAAGAAACACACCATCATATGTTGGATTCAAGACCCTGGAAGGAACA
CCAGGAATGACAGTCACCTTACCCATCTTTCTCATCAGTTGGCAAGGTCAAGCACGTGAA
GTGTGATGGTGGAGACGTTCCCTAAGGCACACTTAGTGCCCTCAAGCTTGGGGTCGTGTA
GGGTATGACAACTGAACCAATCTATAGGAAGATAAAGTACATGTGTAGGGATGGTCTGAA
TACGTTTTTCTAAAGTCATGAGTTGCTTTCGTAAAGGCTCAGACCAAGTTTTTTTGTAGT
ATCCTTGATTTTCTTGATAGTATGCCATTCTGTAAAGAAAAGTTGAATATGGAGGAGGTT
CAATAATACAGGCAAGGGTTCTGAAGTTAAGGAGCCCTAGGCTTAATAACTTGAAGCAAA
TTCTTAATTTCTCTAAGCCTCTGTTTCTTCAGATAGCGAATGAAGATACTGCTACTACCT
AAGAAGATTGTTGTGAAAATGATGTGAACCTGTTCATATAAGACACCAAGAACAGTGCCC
CTGGCACCTAGTAAATGTTAGTAGTTCTTAATATTAAGGCAGTGAAGATAACTCTGGGTG
ATACTATAAGGATGGATATATGTCATTGATTTGTCCAAATGCATAGAATGTACAACACCA
AGAGTGAACCCTAATGTAAGTTATGGACTTTGATTATGGTGGGTCACTGTAGTTCAGTAG
CTGTAACAAAGTACCACTCTGGTGAGGGTTGTTGATAACAGGGCGGGGTGGTGGGGAGAG
GCTATGCATGTGTGGAGGCAGGGGACATGTGGGAAATCTCTGTGCTTTACCCTTAGTTTT
GCTGTGAATTTGAAACTGCTCTAAAAAAATAAAGTCTTAATAAAAAAATTTTCCAATGGA
GTTGTTTTTCAATAAGGTACATTAAAAGGATTTCCTGCATAGAAAACTCCTATACACAAG
AACACTTAATTTGAAACCTTTTGTCTGTGTGTGTCTGTGTGGAAGGTTGGCCCTGAGCTG
ACATCTGTTGCCACTCTTCCTCTATTTTGTATGTGGGATGCTGCCACGGAGTGGCATGAC
AAGAGGTGCCAGGTCCGTTCCTGCGATCTGAACCTTCAAACTCTGGGCCGCTGAAGTGGA
GCACGCGAACTTAGCCCTACGCTATCAGGCTGGCCCCTGAAACCGTATTGAATAGCACAA
AGTTATTTGCTCAGAGAATTTGGGGCAGTTCTTTGGAGTTTGATTTAATACAGAATTAAC
TGAGGATCGAGACCACATGGCAGGCACTTATTATTCAGTTAAGCGAACCTTCAAAAATAG
ACCTTATGGAATTTTTTTTTTCTTTCAAAAGTAATGCATCTATTGTAGGATAAATAAAAA
GAAAATAAATCCTGCCACTCAGGGATAATCACTGTTTTATCTGCTTCTTCCTACCACTTC
ATTATTATGGCGGTTTTTCCTGCTAGCATTACTTTAAAAATAATTTTTTTTCTACTTGCA
TGTGGTAACATTCAGATGGTATAAGGGCTTAGTTTACAATGAAATTGGGCCTGCTTTTTA
CTTCGGTCCCCAATCTTCCCGTTCTCTCTTCTTATAGAAAAGTACTGTTCCATTGTTAGT
CATTTCTTATGTAATCTTTCAGAAATATTCCAAATATATAACTAATAACATACTTGGACC
TTTCTGCACCTTGCCCCTTTTTTGCATGTGTATTGGAGATACTTGCATATCAGTACATAT
ATTCTGATTTCTTTTTTTTTTTTTTTAAAGATTTTATTTTTTTTCCTTTTTCTCCCCAAA
GCCCCCCGGTACATAGTTGTGTATTCTTCGTTGTGGGTTCTTCTAGTTGTGGCATGGGGG
ACGCTGCCTCAGCGTGGTCTGATGAGCAGTGCCATGTCCGCGCCCAGGATTCGAACTAAC
AAAACACTGGGCCGCCTGCAGCGGAGCGCGCGAGTTTAACCACTCGGCCACGGGGCCAGC
CCCCTGATTTCCTTTTTTAATGGCTTCATAATATTCCGCTATGTGGATGAACTCTAGATT
ATTTCCAAGTTTTTACTTGCACGGTGTTTTTGGTCTATATCACCTGGAGATATAGGGAAG
ACTTTAGAGTTGAATTTTTGACAGAGGCAAAGGCGTTCCACGTTTCATGTTATTTTTCTG
TAAATCTTCCAGCTGAATATGAGAAGGGTGTCGATCATCTAACAAACGCAATCGCCGTGT
GTGGTCAGCCCCAGCAGTTACTGCAGGTGTTACAGCAGACGCTTCCACCGCCGGTGTTCC
AGATGCTTCTGACTAAGCTCCCAACCATTAGCCAGGTAAGAAGTTGAAATATGAAATAGG
AGTAGAACCTGAGAATGAATTTAGGGACATTGGCATTTAAAAGTGAGCCCAGTGAACGTG
ATGAAATCGGGAGACTCCTCCGTGTGATGAAGATAGCGCTGGAGAGAGCAGTGCTTGGAA
TTTTCTTCCATAGGAGAAAAACATTCAGCTGAGTGGGCATAAGGTCTAGGGATCGAGTCC
TAGAGGTGGTCAGGAAGTGTGTCTCTCAGTGTTTAACTCTCAGGCCTTTGTAGTCAAATC
CCATGATTCAGGCCACTCTGGCTAATTTCCAAAACTAGCTTTCTCCCTACTCTTGTGAGA
CCGTGCATTCAGTTAGGTGGCCTGGTGGGGGGTACAGGAGCCAAGACGGCATAGCCTGGA
ACTTGGATCATGAAGGACTGTGGCTTCCCTCTGACTGCACTTGTCTGAAGGCCCTGGTGC
CTCTGCTGCTGCCAGGTGGGCTTGGCGCTTGGAACTCTTTGACTACATCCCCAAATGCAA
AATGCCATTGTATAAAAGATTATACATAACTTGAGTTAAGTAAAATGTGTTCTGTTAATT
TTTAATCCTTCCCAGGGAGCCCAGATGAGTCTACTTTTTGGAATAATAGCATGTCTGCTA
CATGTGTTAATTTCCACAGTTGCTGTGCTTAAAAATTAGTAAAATGATTGACTGGTTAAT
TCTCCAAACTGATCTTTACTCAGCTAAATTGGAAAGGGACTGGAAAGAAAATTAAGGTCC
CAAAGATTGAAGGGAAACAGTTGAAAAACTAAGCTGTTGATATTAATCCTTTTATTTAGA
CTAATGTGGTCCCCAGTCTGTCTATATCAGAATCCTCTGTTGAATGTTATCTGCTCTTTG
AAAGGCAACATAGCATAGTGCTTTTGCAAAACTGACCTGAGGGTGATGTCTTCTGAAATA
TGGGGAAATTTAGGATGAAGCCTGAATTTCTCTCTGTAAAAATGGCCTCCTTGACTCAGT
TAACTTGTTTCATGTTATCTGGAAATGTTATCAGAATGGCTAATTTTGACTGTGTTCCTT
CTTTGTATAATGACTGAGCGTTTCCAAGCCAAAAGGGGAAGTATTTGGAGCATAGAATGA
TCAGTAAAGCACTCATCAGTATTCTTAGTTTACGTGGGAGTGAAAAAAGATTTTCAGTTC
TTTCTGGTTTCAGTTTTGTAACTGACTAACTTGTATCACAGTATGATGTTATGCCTCCTT
TATTAACTTGAATTCTGGAATGGGACTGATGCCATTCATACTGTGCGATTATCGCATAGT
GTGATCATTATTTTCTTAGACGATGATAATGTATAAAGTGTTAAATGTTGAAATCTCAGA
ATGGGTAAATTTGAACAAGGTTTGATTGATTACAAAGAGCATTTTATGTTGAATTTAGAA
TCCTGATTAAATGCTTATGATACTTATAAGAATTAATTTCTCTTTTTCAGAGAATTGTAA
GTGCTCAGAGCTTGGCTGAAGATGATGTGGAATGAGAAACGTCAACGTGATAATCCCAAT
TAAAAATATTTTTAAAATCTTAACTCGGAAGATGAACAGCTCTAGGGGAATAAGGGCAAA
TATGCTTGTTATGGACTGTCCTACACTGAAATCTACCAAAGTTAATTTTTACTTTGTGTA
GATCCATTTGTGTGTTTTATTTATTTTTCCAAGTGGAAAGTGTGTTTTGATAGAGAGCTT
TTCATTTTATAAATACACTATGAGTTACCGAAATATCATGGATTTTCTTTATTCCTAAAA
TGTGCAGTTAAAATATACATGTAACATCACTTATATTAATAATACCCAGTGCTCAGTTTT
CAAAGATAGGGAAAAAAGTATAGGAGAAAACTGAAGAATGCACATTTTTTAAGCTAGTGT
ATTTTGCTATACATCAGAAAATAGAATGAAAACTTGATTTTGTTTATCAAAACTGAGCAT
TAAAACTTCGAGAGATCATTTCTTTCCTTTTAATCTCCTAAATATCCCAGATGTGCTGCT
GTGCTGTATTAACAGCTTCACTCCCGCCCTGTGTATCGGTCTTGAAATGTTTTTTTTAAA
TCAGTGGACTTAATGTGTTGTGGGTATTTATCTCCTTGTATTTTAGATACATGTAGTTGC
AAATAGCACCAGGAGTTAAGTCTGCACACCACTATTCCAGCTGTATGAGCTTCCCCAGTT
AGTGTCTGCCCACTTTGCTCATTTGTAAAATGAAGGAATTGGCCTGCTAACTCAGAGCAG
TGTTCCTTTCAGCTTCTGGTTTTTTTCTCTTCAAGATCTTCGAGTCCACCTTCCCCTGAG
GTGTATATTTGTTTGGGCAACCAGGCCTTGCATTTTTTCTACTCTGAATTTTGCATGCTT
GCCTGACTTAGTATTTCTGAATTGATTTTTTTTTTTTTTAAGGAATAACGTGTTGATTTT
CACTGAATCATATGGTTCTGTCACTACTCTTGTAAATTAATCTGAAACTTAACCTTTGAG
GTAACTGGGATGATATGCTTGTAAAAATGTTCTCCTTTGCTTTTATCTTCTGTGTACCTC
TTTAATCTTCCTTCAGTCTGATTCATTTATCTTGTTATAATGAGAATAAGGTGTAACCTT
GTGGCTGAGGGACTTGCAAAGAATGGAGGTAATGTGGAGCTCTTATTCTCAAAATAGTGA
CATATCTGCAGTCACAGATTCAATATCAGACTTGAGAATAAAGATTCTTGGTATTTAGTG
TCGTCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1210, 5743..5789, 8048..8129, 13932..14074, 15530..15805
1087..1210, 5743..5789, 8048..8129, 13932..14074, 15530..15571
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved