Equus_caballus Locus CCAR1
snOPY snoRNA Orthological Gene Database
Equus_caballus CCAR1
Equus_caballus
CCAR1
1
SNORD98
27685..27749
53538
ATGATCTGGAGTCCCAAGGACTACAACACCAGATGGTCCACATCCTGAGACCCCTGCCC
CTTCAGCCCATTTGCTCTATATAACCGCTTCAAAATTTTGTAGTTTTAAGATGGTTCATT
AGGACACTAGTCTGCCATCTTCCCCCTTGCTGGCAAGCTGTAATAAAGACCCTTTTCTCT
CCTATCACCTTGCCTCTGGACTGTTGGCTTGTTTTTGCAGCCAGCAGAAGGTCCCTTTAG
GCTGTTACAAAATGAATAAACAAAATGTGGTATTATCCATTTAAAAGAATAGTTTTAGCC
ATAAAATGGAATGAAGTACTGATACATGCCAAAAGAATCTTGGAAACAATATAGTAAGTT
ACAGAAGTCATACACAAAGGCCATATATCATAGGATTCCATTAAAATAAAATGCCCAGGA
CAGGCAAACGCACAGAGACAGCCAATTAGCGGTTGCCGGGGCTGGAGGGAGAAGGGATTA
AGGAGTCACTCCTCAAAGAGTAGGGGTTTCTTTTAAGGGTGGAGGTGATGATGGGTACCC
AACCTTATGAATATACTAAAAGCCACTGAATTGTACAATATAAAATATTTAAAACAGTGA
ATTATATGTTAAGCAAAGTTCATCTTAATTTTTAAAAACAGAAGATGCCACAGGATATAC
CCTTTCTTCCAATTACTTTCTTCCAAGCACTTGAACTAGAAGAAAAAACAAAAATGGCGA
AAATATACAAAATGGCGGCGGCCTCATCAGATCACGTGACTGCAGATTCTTTCCTTCCCA
CACTCTCAAAGTCTTTCCCTTAGAGCTTGCGCGTTGACACAGCCCTGCTTATTGTTATGC
AAAGCCAAGGTAACCCTTCTTAGGCGCGCTCTGGTTCTAGCCGCGTAGTGAGAGGTGGGC
GTACGGAAGGCGAGGTGAGGAGCGCGCACGTAGAACGTATATCCGTAAGCGCCGTTCCCC
GGAGAGACAGGGAGGAGGGGAGAGGCGTGGAGGAACAGGGGGAAGTTGGCGCATGCGCCT
AAGGCTGATGGGTTTGAAATGGCTTCGGTGTTAGCCGGGACCCGATTCAGGTGAAGGTCT
GGTCCTCGCGGTTGGAGCGGCGGGCCGCCGAGCCGGTGTTCTTAACGTCCTGTCGGATCT
GCGAAAGCTTCGGGAGCCACCGTTTTGGTAGCACGGCGTCCATAGGCCGGCGACGGTGGG
ACTCGTGGGACTGGGGCGGGAGGGACGCCGTCCCTTTTGTGCGGGTCGGAGCAGGCCCCG
CGCGGCCGGCCCCTCCCCCACGCCTCGCTCTTTTGCCCGCGGCCCCTCAGGTGCCCGCAG
CGCCGCTCGGCCTCGGCCTGGCGGTCCCGGAGTGTCTGCCGGTCGCCCTCGTTCCTGAGC
CGCCGCGGCTTTAGCCTGCTGGTTTCCGGCCCGGGGCGTCGGGGCGGCGGCGGCGGCGCG
GCTTTTCGGGGATGGAGGCTTTCTCCGCCCGGCCCGGACGTTAAGGGGACCCGGGCTCCC
AGTATCACCCCTCTTGGCGCCGCTCCCAGTCCTGTGGGACGGAGGAGTCCGCCTTCTTTG
GTCTGCGGCCCGCGAGCAGCCGGGGTTGGAGGAAGATGGATGGCAGAGCTCCGGCCTGTC
TGAGGCGCGGGGGGAAGGCGAGGGGACGCGGGCTGAGATCTTCGCCTTTTCTGGCCTGAT
TTTGGGGGAGGGGTTTTCAGGGCGGTTCTTGAAGGCGCATCCGTTAATTCAACTGTCTTT
CCCCTCGAGGGTAGGGAGAGAAAAGGAGCCCCCAGTTCCTTTCCTGCTCGAGAAAGTAAG
GAGATGTTCGTTAGCTAAATGGTATTCTTAAATAACTTTATTCTGTGTTTCGTCCCAATT
TCCGTTACTGATTTCATCACTTTCATTCCCCAGCTCTGCCAAAAGAAACACGCAGGCGAT
ATTGCCTTTGAACATAAAGCTGTGAACTTATTGTTAAGAATTGGGGAGACCACAGCAGAT
GGTCTTGTGTAGTCTCCGAAAGAAGTGCCTTTTTTGTAAGGCTTCCCCTAATGTCATATA
ATTGGGTTCTTTTGGTGAACTACTTGACGTAAAATGTTTTCGCTGCATGTTGGACATTCA
CATGGCCCCTTATTATTTATACCCAGACCTATGAAGATGCCCCTGACAAATATTTCTTTA
AAATAATACTTTTATGATAGTTATAGTTTGGTTGAACTTTAAAATGTGAATCCTTTCTTA
ATAGATCGCTGCTCTAGAAGAAAAACGAGGGAAGGTTTTTTTCCTCTTTCATCATGGCTC
AGTTTGGAGGACAGAAGAATCCGCCATGGGCTACTCAGTTTACAGCCACTGCGGTATCGC
AGCCAGGTCAGGCCACTGAACACATGGACTGTAAATGTGGGGAGGATGTGTTCTAACTAT
GAGAGTTAGGCTATGCCTAATATTGTAAAATGTTCGCAAATAATGTGTCTTTTATTTGTG
GAGCTTCTAAAAATTCATAGATGAACCAGCAAAAAAATCTGTTTACACAGCAGTTTGGAC
AGTTTTATAGTTTTTCAAACAGTAAATTGATTAACTTTTAATTGATTCTCATTCGTTACA
TAGAGTTTACCTCATTTGGTATGTTAAGGTGTCGATATTCATTCACAAGTTATGTTTAAA
AATAAATATAAAAATCCATACTTTATGAAACGTTCTGTATGATTGTGGTTTTCAGTTGTT
TGGTTTTAAAGTAGAAAAATGAACTCTAAAGAATTTATCAAGTAAAGGAAAAAGATAGAT
ATAAAAGGAGCAACAGAATGTTTACATTTTCAAAATAAAAAATGTCATTGAACATATTTG
TTTCGGTAAGTTTCTTCTCATTGCTCGTAGGAAGAAATTTTTTCTACCATTTCTTGACTT
AACGGTTTGAACCTTAAAACAATTAAGTTTCCCAAGGATTCTGTAGAATGAAGTTTTGAG
TTTCTTTGAATACTCAGAAAAGTTGCAGGTTATTCTGTTAAATTGATTTATGACATATCT
GATACTAGTTTTTTGCTGTGTTTTACTTAAAATATGTATTTTGTAATTCGAGAGGTCAGT
TGCAGAGGCGCTGTGATCTTCTAACTTGGATGTTCTAAAATTTGATGGACGTGATTATCT
AGTTATGTAGGCGACCTTTCTCCTTAAAGAAATGGACACTAGGGTTTTTATTTTAATTAC
TCTTTATTTGGGGGTTAAATGGTCTATAGTTAGTCCTGTAGGCAAGTGGAAATAGTATGA
AATAGTAGTTAGAGATTATATTTAATTCATATCCAAATATCTCTCCTCTATGTTAAATAA
TGGAGAACCTGGTAGTGACTTACTGATGAAACAGGAATTAATTAGCAACTACTGTGTGTC
CAGACACAAGTGCTATATACTGGTATTTTGGTAAAGTAAACATGTTTTACCTGGCTTTTT
CTACATATAATTTGTTTTAAATTTATATCTGTATTGTTCCACTAAAATAGCCATTATGGT
AGAATTCTGTTGTTTATAGCTCTTAACATTTGTATTGTAATTACTTAAATATACATTATA
CTCTCTCGTTTTTATTTTAAGACTGAGCAAAGGAAAGACCAAAGGTTTATAAAACTTGGC
AAAGACAGGGACCAGCATGGTGGCGCAGCGGTTAAGTGCGCACGTTCCACTTCTCTGCGG
CCCGGGGTTTGCTGGTTTGGATCCCAGGTGCAGACATGGCACCGCTTGGCACACCATGCT
GTGGTAGGCGTCCCACGTATAAAGCAGAGGAGGATGGGAAAGGATGTTAGCTCAGGGCCA
GTCTTCCTCAAGCAACAACAACAACAACAAAACTTGTCAAAGACAGTCAATTGTATATAT
AGGTCTCTGTTTCCATATTTGGCAAGAGAGGATCCAAATGTAAATAATAAAATTTGTGCA
AATAGAGCTTGTATTTGTGCTGTAAGAAATTATTTACAGATTTTCTTGGCCCTATCATTA
ATCAGAGTTCAAAATCTGAAATTTTATTGATACTTCATGACTTCAGTAAGTAGGCAGGTG
TTTTGTTAGTATCTACACTTACCTTACCTATAGAAATCCTGGAGTAGGTTCTAAATGAAA
CTCCGTAGTGATACTTTTTAAAAAAAATATTTAGTTTCTAGGTGTTGTATTTTGGGCTGC
TTCCTCAAAGCCTGATGTTTTCTTGCCTTCATTTTAAAGTCTTTTTGAGTATTATTTTGT
CTTACTAAAGCTGATTCTCAGAGCCATGCAAATTTCTTCAGAGTTAAGTTTTTTTCAATC
CTGAGGGAATTAAAATATGTCTTATTTACACCTAACCTCAATGGAGAACATTTTAACCTA
GTATAATACCTTACATTTTCTCCTTTAAGTTTTCTCCTGGCGGCTTCAAATATAATTTGA
GAAGAAATTTGAGAAGAACAAAGGACCTAAAAGGACTTAATTGGGGTAATAGTGTAGGCG
TCAGTTTAAAAAATATATAGGTACCGATTGAAACATGCCAGATACATTAGTATCAGAGGC
CACTGTCATAAATCAGATGATCTTTTAACAGAAAAAGGTTAACTGAATAATTCAACTCGA
TGAAATATTTTGTTCTTTGTGCCTGTATTTCTGACTCATTTTTTCCTGAAAGCATGTAAA
AATTACCACAATTTCCTTTTTCTATATAGCTTAACATGGCTTTGTTCAGCTAATGCCTTT
GCTATTCCATTTTCTAACAAAGTTATTTTGCATTTGTACTAACTGGAAATTCTCAACTAA
CCAGTGATTTGAAAATTTCAGTGCATTCATATAGATGAGATATTTAAAATAATATTAAAA
ACTTGGGGGGCCGGCCCGGTGGCACAGAGGTTAAGTTTGCGTGTTCCGCTTCTCGGCAGC
CCGGGATTCGTTGGTTCGGATCCCTGGTGCAGACATGGCACCACTTGGCAAGCCATGCTG
TGGTAGGCGTCCCACATGTAAAGGGAAGGAAGATGGGCATGGATGTTAGCTCAGGGCCAG
TCTTCCTCAAAAAAGAAAAAAAAAACCTTAAAGCTTTCACACTAGCAGTTTATTGCTGAA
ATCTGTTGTAAAATTGAAGAATCAGTATTGTAATTGTTTCTGATTAATTTTAATGCTGAG
CCTGTTTAGTTAGAGTCAGTAATTCCTAGATGGCATTATTTGTCACCTTTAATTTTCTTT
TCCATATTCAATCATATCAAACCTTGACTTTTTTCCCCTTTGAAAATGCCTTGACTATAC
TCCTCCATTTACATTTAGACTCTTGCACTTCACATTTGGGTAACTGCAGCAGTGGCAGCT
GTCTCTTGCCTCCAGCTCTTTTTTAAAAATTTTTATTTTTTTCCTTTTTCTCCCCAAAGC
CCCCCAGTACATAGTTGTATATTCTTCGTTGTGGGTCCTTCTAGTTGTGGCATGTGGGAC
GCTGCCTCAGCGTCGTTTGACGAGCAGTGCCATGTCCGTGCCCAGGATTCGAACCAACGA
AACACTGGGCCGCCTGCAGCGGAGCACGCGAACTTAACCACTCGGGCACGGGGCCAGCCC
CAATTGCCTATAGCTCTTATGTCAGAGTTTCTCACCTAACTTTCAGGCCCTTCCATACTT
TTTCCCAAACCTTTATATCCTAATCCGTAGTGCTTACCATAGATCCTTTGTTTAAGTCCG
GAAGCACTTGGTGGTGATGCTCTATATGTATTATCCTTTATTTAGTTTTAACTGCTTTTA
CTGGCTTTCTCTTAAGCTTACTTACTGGATATGCTGCTTCTTGTTGCTCTGCCAGCTCCA
ATATATCTGTCAGATGTATTGATATTCCTAAAGCATAATTCCTATCTAAATCACAGAATT
TTTCAAAGCTGGATGGAGCCTGAGCTAGCTTCTGTGTCAACTCCTCTCTGACAGATGACG
ATATTGAGCCTTAGAACGATGAAGAAATTTCTTTAGGTCTCAGAGAATGTCACAGAAGAG
TCAATGTTAGGACCTCGGAGTTGTGGTTCATTGTATCTTCCATTACTCTATTATTCATTT
GCAAAAATATCTTTAAGGACTTTTAGAATACCAGGGTCTTCTGTGTTTCCAGCCCCATTT
CTCGTTTCTTCCACACTGAAATACTTGTTCTCAACATTTACCCTGTTTTTCCATCTCCTA
GCTAAAGTGCTGTGGTGTGTATTCAGTGGCAGTCCTACTTGGGACCAGAACTTTTAGGTT
TGAAGACACAACAGTTTTCTGTTGTTTAAAGAGACCTTGAGAGACAGAGCTGGTAAACCA
CTGATTGAATCTTTAAATAGCCCTTAGATCGATTATATTGACTAAGGGTACCTTCCATAT
GTTTGACTCTACATATTTGCATGTGTACATGTATATAATTGCAACACTATTTAAGTGTGG
GGGTGGATTTAGCAGATTCAGACCTACTTTCTCCCTCAGTTCTTTTGACCATTTGTGAGA
TGACTGCATTCTGGCTATAGAGAAAAATGAACTAGTTCAGGAGTTAGAACTAGTGATATG
TGGTGCATTAACACAGGTGACTGAAGCTAATACCAGTACGGTGTTTTAACTGTGACTCCA
TTTTTCCTGTGTCTTCATTGTGGTCCAAGTGGTCATTTTCTAAAACCGCAGTCTCTTGAA
TCAGCAGCTGAAATTGTTAAATTCCAAGATTGATGGTCTTTTTCAAACAAATAATAGCTG
ATGTACTGTGTATACTTCACTTACATTAATTAACCCTTAATAGAGGTGGGTGTTTCAAAC
TCCTTTGGGAGAAAAGGAGGATTGCTACTGGTGTGGGCTTACCCTTTTTAGATCGTATTA
GTGCTATGTAATAGCAAATTGTCTCTAAAACTTTTTTTAAGTAAAAGCACATAAAATCTA
TTAAGGCACGTTGTTGATGCATATTTTTTTCCTCGTCCTCTGAGCGTGCCTTGTGCTTTC
ATCCAGTGAGAGCTGCATGAATGTACCATACCATGAGCCAGTGAGTGCCCCATCTCTGTC
CTGAGTTGACTGTACGACACTTGAATGTTTATGCACTTGTGGCTTCTCTTGTACATGTGT
TTTATGATCTGGGAAATAGTTTTGATCTGTTATAGCTAAAAATGTATTGAAAGTAACAGT
GAGAGTTGGAGTGTTAACTTTGGGTGATACAAGTCTCCTTGATGGGGTCGAGAACTAGGT
AAATATCAGAGGCAATTAGGGATGGAAGGAATCTTATGATGTTTTACAAATGGTATCTTC
AGCTGCCTAGGAGGGTTGACCAACAATTGCTTGAAGAGACTGGCCAAGATTACTAGTCAT
TACTTCAGTGGGAGTTCAGGAGAGTGGAAGAGCTATAGTCTGCTAGGATATTAATCTTTA
TAGAGACTGTAAGAACCGTGTATAACATTGATTTAGTTAAGGCTTTGCCTCTTTCTTATG
GAACAGCACTGTCCACTAAGTAGAACTTTCTGTGATGATGGATAAATTCTGTACCAATCT
TCATTGTCTCATAGGGTAGCCACTATCCAGATATGGCTATTGAGCACTTGAAATGTGGGT
TAGTGTGACTGAGGAACTGAATCTCTAATTTTATTTAATTTTCTAATTTTTATTTAATTT
TCACTAAGGTGAAATACCTGCACATGGCTGGTAACTAGTTTAGGGAACAATGCAATTATA
GAAGGTTACAACACTTGGAACATGTTATATTTAAAATACTATTTTGTGCCTTAATTTCTT
CTTTTATTGACATCTTCATGACTTATTTATTTTCATATCCCTAGAAGTGTGTACCTTTTG
ACACCCTTCATTTCTTGTTCTTCATTTCTTATTTTTAATGCCTTAATTTTTTTTTTGTGA
TATTCTTTTTTTTTAAGATTTTATTTTTCTTTCTTCTCCCCAAAGTCCCCCAGTACATAG
TTGTATATTTTAGTTGTGGGTCCTCCTAGTTGTGGCACATGGGATGCTGCCTCACCATGG
CCTGACGAGTGGTGATAGGTCTGCGCCCAGGAATCGAACCAGTGAAACCCTGGGCCGTTG
AAGCAGAGCGTGTGAACTTAGCCACTCAACCACGAGGCTGGCCCCATAATGCCTTAATTT
CTTATTCTTAAAAGGTAACAATTATTTCCAGTCATTGGGTACGTTATGGGCTTAGAATAG
AACCTCGAAAGCCACAGCAATGGATTGACCAAGGAGTTCTCTGGTTGTAAGAAAGTTATC
TGTACATGGGAGCATCCAAGGTTTTGTATTTGTGTGAAATCTAATATTTAAAGATCACGT
TTTAGGAAGGATATTGAGTAGAAGATGACAATTAGAAGGTTTGTTCACTTGATTTAAAAC
CTGCGTTTATAAGTATTTTAGTAAATCCGTAAGTTAGAAAGAGAATCCCTCACATTTTCA
TGTTGTTTTTTTCTCCAGATAGCATGAGATTGCTTTTTGAACATATATGAATATATGGAA
ATTTCATAGGATAAAACATTGCTTGACTAGTGCTTTAAATAATTTTGCAAAAGGTGAAAA
AACAAAGTTTCTCGAGTTAGTTTGAGGTTTCGAATTTTATTCATTGTTTCAGAAGGATGA
CTCATCTTAGTAAAGATATAACACCATGGTGTAAAGGTAATAAGGATTTTTTAAATTTAA
AAGTGATGGGCCGGCCCGGTGGCACAGCTGGCACAGCGGTTGAATTTGCATGTTCCACTT
CTCAGTGGCCTGGGGTTTGCCAGTTCGGATCCTGGGTGCAGACATGGCACCCCTTGGCAA
AAGCTATGCTGTGGTAGGTGTCCCACATATAGAGTGGTGGAGGATGAGCATAGATGTTGG
CTCAGGGCCAGTCTTCCTCAGCAAAAAGTGGAGGATTGTCAGTAGTTAGCTCAGGGCTAC
TCTTCCTTAAAAAAATAAAATAAAATAAAATAAATAAAAGTGAGTTTTAGAGGCTGGCCT
GGTGCCATAGTGGTTAAGTTCATGCGCTCAGCTTCAGTGGCCAAGAGTTCACGGGTTTGG
ATCCCAGGCACGGACCTACACACTGCTCATCAAGCCATGCTGTGGTGGCATCCCACATAT
AAAGTAGAGAAAGATTGGCACAGATGTTAGTTCAGGTACAGTCTGCCTCGAGCAAAAAAA
GAAGATTTGGCAACACATGTTAGCTCAAGGCCAATCTCCCTCACCCAAAAACAAATAAAT
AAAAGTGAGTTTTATAAGATCAAGGGACAACAGACAATGGACAGGTTCTTCTTGTGTTTT
AGTGGTGTGTTCACTGGTATTGAGTAAATAATTACTAGTATGTCATGACATGAAATTTTC
AGTCATATGAAACTGATTTTACATTTTATAAAATAACATGTTTTACATTTGTGCTGAAAT
GTGTAAGAAAACTTAGCCCTTAAATTTACTTATTTACCTGGTAGCGTGTGGTCATTCAGG
GCTCATTTCATAGATTTGTCTGTGAAAGTACTGATACATAGCGATAAGATGTTTCAGATG
GGTGACAAGACCTTCAGCAATCATATTGAATCAGGTACAGGTAAATGAACACACTATTCC
AACGTGGATAATTGGAAGAGGTCTTCTTGTGACAAGTGTTTGGCCACTTACGTAGGGAGA
AAGATTAAATTAGAGATAAATGCCTTTGTACTTTGCAAGTTACAGAATTATTTTGCAGAA
TATTGATTATAAAAATTCACAAGAAGAATGGAGAATGCTATGTACAGATATTCAAGAATA
GCTTCTCAGATATCCACAAGAAAGGGGAGCATTAATAAATATTAAGGAAATATACTTTAT
TGAGATAAAAATCTCAAACATAATGAGTTTTAAAAAGAGCTGTTTTATAGACTTATAAAA
GCCACAATCACATGTACAGTGGTTTCCACAAAATTTGAATTAACTGGTTAGTGGTATGAA
GCAACTCCAGTGGAAAATAAATTTTCTTCCCATGAATTTCTCCTACCAATTGAACCCTTC
ATTACCAATTAATCTATTTTTGTAGTTTCTGACTCATCATATTGACTATCAGCAGTAGAA
AAGAGATGTGTAGGTATCAGCTGTTATCCCACCTACTTAATGCTGGGGTGCTGTATGCTG
CCAGGGTCTGGAATACCTAGAAAAACTATAGGAAGAAAATAGATTTTCTGAGATATTCGG
CTCTGAGTTCTGCTGTGGCCACTATCAGTACTATCCAGGGTTCTGGAAATTGATACCAGC
AGAGTGAAGTAGAGCAGATCTGAAGTCAGAGCTCAGATGGATAAAGGAGATGGGTATGAT
ATTTGAATCACGGATGTTACCTTTGTCAAATGCAGAACATGTCATTCTTAGAATTTAAAA
TACTAATAATTTTTCCTAAGGTCTTTCCCTGTCTGGTGTTTACAATGAGAATTTTGCTTC
TGTTATCCTAGAATAGTGGTGCATAACCTTTATAGGTCCACTTCAATCCATAATTGAAAA
TCTGATCAAAGTTTTGGACTTTCTTATCAGCAATTTTGCATACAATTTCAGAAGGTGAAC
AAGACCCACTGGTCAGAACCTGTGGCCTAGATTTTGGTACCTTTTTCTCTATTCTCATTG
CAGTTAATCTCATTTTGAACTTACATTGGTGTTAAGATATTCCCTACTTCTTTCTGTTTA
AATTCATTTAGTCAGTCCTGGTTTCTACTTCCTGCCCATCTGTGACATCTTTTACGTTAA
ATGATTTACCTTAAAAACAAAAGGGAAAATAAAAAGTAGCGTGGTAAGGATTTCACAGTG
TGTATTTAAGACATTTGGAAGATTTTTTTCCCCCCTTAGGTTCTCCTCTTTCTCTCCTGG
TCTTGTAATTTTTAAAAATCAGTGTTTTTCACTGTTTTAGCAGGGATAATTGATAATATT
CAAGAATTCCACCATGATTTCTGGGGTTTTTGTTTGCTTTTGTCTTACTTTGTTATTGTT
GGTTTGTTTTATTTTTGAGTAAAATTAATCTAGACTCATAAACAACTGGTTTGTGATGAA
CCTCACACTTCTAAAAATTTTCTGGGATATTCTAGACAAGGTGCTTTGGTTAGTACATTA
ATGCTCTTCTGTTGTTTTCCTGTAAAGCACAATATTGTTCTTTCTGTAGGGTTATTAACT
GATAGTTATAGAGCAGCATTTTTTCACGTTATTCTCAGTTACAAACAACATGCTTTGGAA
AAGGGGGTGTTCCATGAACAAATATTGCTTTTATGGCAACCTCTTTGAGATTCATACTCC
TTAGTGGTGTATTAAAGGTTCTGAGAAATCCTGCAGTAAAAATATGTGCTTAATTCACTG
TTTCCCAAACTTTATAAACCTTGGACTCCCTTTTTTCAAACTTTTATGTTCTGGGAAGCT
AGTCATTTTTCCATGAAATACAATTTGGGGAAGTGCAGTGCTAGACCACAATTTTTAGTT
GATTGCCTTTTCTTTTTGAGATGTTAGCCCTGAGCTAACATCTGCTGCCAATCCTCCTCT
TTTTGCTGAGGAAGATTGGCCCTGAGCTAACGTCCATGCCCATCTTCCTCTATTTCATAA
GTGGGATGCCTGCCACAGCATGGCTTGACAAACGGTGCGTAGGTCCGCACCTGGGATCTG
AACCAGCAAAACCCAGGCCACTGAAGCGGAATGTGCAAACTTAACCGCTATGCCTCCTGG
GTGGCCCCCAGTTGATTGCTTTTTTGCATTTAATGAAATTACGTAAAAGCATCAAGTAAA
ATTTTTCTCATGTTTTCTTCAGCTTTTAGCCTTGTCTAAGCATAGATTAAACGTTAAATA
TCTGAGTTTGTTATTCTGAGGTCTCCCCCCAATTTTTTGGTTTAAGCAGATAATCATTTT
AAGTCACTGTGTGGTTACTTTTCTCTCTCATTGCTCAGTACAGTAGTGCACTAATAGTAG
AAACTTTTTGTGCTTTTCAAGTGTTGTTGTCTGTTTCCTCATTATACAATTCTTTATGCA
AAGTAGAAAATTCTGTCCACTAGGAAGTTTTCAGGATGGATCACTTCCAGCAACACTGTC
CTAAATATATGATTCTCATCTGCTTGAAGATAAAACAGTAAATTCTATATTAGTAAAATT
AGATTATTTTCTATACTTCTTCCTAAAAATACTTCTTGAGGGTATTTTAGCCCCTTGGTC
TAGGTAAGGTTGGTTGGGTTCATTTTGTAGTTTAATTTTATAGAATAATGTTTTCTTATA
TCTTTCATGACATGAACATTTAATATTAAGCCATTGGAATCTGGAGTAGGACATGAGTCA
GTTAAATTCAACACGTCAACAAGCATTACTGAAATTTTTCTTTAGGTTTTTGCCAGACAG
TGTGGCAGACCATGACCCATAACTAAACACTCATGAAAAGTTTCTGGAAAGGTTTCAAAT
AATCTTGATTTTTTCCCCCCTCTTTTTAATCTCATTTTAGCTGCATTGGGTGTTCAGCAG
CCATCACTTCTTGGAGCATCTCCTACCATTTATACACAGCAAACCGCATTGGCAGCAGCG
GGCCTTACCACACAAACCCCAGCAAACTATCAGTTAACTCAGACTGCAGCCTTGCAGCAA
CAAGCCGCAGCTGCAGCAGCTGCATTGCAACAGGTGAATTTTTGATAGATTTTAATATGT
GACAGAAAACTGTCAAATCTGAGTGGCCAGGGTAGGTACCTTTAGTTTTTGAAGAATGAA
TACTTGTGGGTTTTTATTATAAATATTTATTGTTTTTTCCTAGTGATAATAATTACATAT
GCCCAGGACATAACAGAGAAGTGTAGTTGCATAGTCAAAATTTTTAAATTCTTAAATTGA
ACAGTTCTTATACTTTGATTATGTGAACAAAATTCAGTTCTTGATGGATCTGAGTATAAG
TAATCACCATTTTGTATATTTTAGATGAAGTTTACCTGTTACAGAAAGTTTTTTTCAGTG
TAATTCTGGTTATGTATTTGTATGTATGTATGTATATCACTTTCTGAGAATCAGTAAAAC
TAATGTCTGTTTTTTTTCCCAGCAATACTCACAACCTCAGCAGGCCTTGTATAGTGTGCA
ACAACAGGTTTGTTTATGTTTTCCATGTTAAAAACCAATTTTCAAATAGCCATTTGTTCC
AAATTTTATTTATATAGATTTTATTTCCTCTTGGCTACCTTAATGTGTGATTTAAATTCT
TTTGGGATAAGGAAAATGAGGTAGGTGAAAAGGAATGTCTCCAAAGGAGAGGAAGATAGG
AGCAGTCCTGAATACCCAAATCCTCACCTAGCAGCCAGTCTGTTAATGTTTCTAAGCGTG
CATGCAGAGGATAACCTGGAAAGAATCACTCTATTATTGAGTATTTGGCTCAGTACTCCT
GTCTAGAACCTCCTGCCCTAATATGCTATACTAGATACATGTGAAAATGAAAAGCTCGTT
TTTCCCATTTGAAACCTAAACTATAGATAGACCACTGCCTTAACCTTTTTTTAAAGCAAC
CGAACTCTCCTTTTTTTCCCTAGTGAAATTGTATATTGAAATCCAATATACAAAATATTA
AAATAGAGCTGTTGAGAGCCAGCTCTGATGGCCTAGTATTTAAAGTTTGGTGCACTCTGC
TTTGGTGACCCGGGTTCACTTCCCAGGGATGGAACCCCACTACTCATCTGTCAGTAGCCT
TGCTGTGGTGGTGGCTCACAGAAGAACTAGAAGGACTTACAACTAGAATACACAACTATG
TACTGGGGCTTTGTAGAGGGGAAAAAAGAGAAAACAAGAGAGGAAGATAGGCAATAGATG
TTAGCTCAGGGTGAATCTTTCCTAGCGAAAAAAAAGGAGCTATTGGAAACAGGAAGAAGC
CTCCCCTTGTAATTCCCATTCCTATGCCCAAGGCACATTTGAACAATTTGAAAACTCCTG
ACTTAGACTGAAAGTGAGTTTCTTTGGCCCCCTTTCCCCAGGCTCATACTCTAATCATGT
TCCCCAAGGTCTTTTATCGTGATGGCGGGAGGAGATTAAAAAAAACTGAACCCAAGGAGA
AGCATGTCAAGGAAAAAAGAATTTGCCCTGCTGAAATCTAGGTAGTTTCTGGCCTAAGCT
CCTATTCTAGGCTTTTCCAGGGTTAAGAGGGAGTCTTCATTCCTTCTCAGTGCCATTAAG
AAGCTTCAGGAGGGGTCGGCTCCGTGGCTGAGTGGTTAAGTTCGTGCGCTCCGCTGCGGC
GGCCCAGGGTTCAGATCCTGGGCGCGGACATGGCACCGCTCGTCAGGCCATGTTGAGGCG
GCATCCCACATCCCACAACTAGAAGGACCTGCAACTAAGATATATACGACTGTGTACAGG
GTTGGGGTTTGGGGAGATAAAGCAGAAAAAAAAAAAAAATTGGCAACAGATGTTAGCCCA
GGTGCCAATCCTTAAAAAACAAAAACAAAACAGAAGATTGGCAACAGTTGTTAGCCCAGG
TCCCAATCTTAAAAAAAAAAAAGAAAAAAAGAAGCTTCAGGAAAGTATAGCAGTCAGGAG
AGGAAAAGGGGTTACAATAGAGAGGGAGCAAAAACAGGATCCAGAGACACTGGGGAAGCA
TGAAGCTTTTCAGTCCATAATCTCTTGTCTCTAGATCCATGGCTCAATTTCATTCTTCGA
TTAAGACCTTTGGGGCTTCACAAGCATTCCTTTTCCCCTGAAGATTATGATATCCCACTA
GTAATTGTTTTAAACTTCTAAAAATTTGACAAGAGGTTGATGTAAAAGTTGGCTATCTTG
TTTTCAAAATATCTTCAGACTTATTTTAATACTGTTATGAAATACATTATTAAAGATTAT
TTGTTAGGTTGAACCATATGAAAATGGCAATACTCAAATGTTCTTGCCTTAAAAAATTCC
ATTACTCATCTGTTCTTGACTTGCAGAAAAATAATAATTTGATTTAACCTCTAATACATG
GTGACCCCAGGTATACAGTGTTGTGAATTAGAATCTCATATAGAATCTCATATTTTTTTA
TCTTAGCTTAAGTCACGTTTCTGTTCCAGGGTTTTTAAATTTCCCCCCTCACACCAGTTG
TTTTTACTTTCTGGAAATGCTACACTTTGCTGTTGCCAGAAAAACTATATGTCAGAGTTT
GTGGTCCTTTATAATCCCCATGCCTGTGGCAAATCTGAACATCAGGAGTGCTTCTTGTTT
TAGGGATATATATAAATTGGATAGCCAGTGATATTTTTGATACAAGTAGCATACTGATGA
TACAGAAGCAGTTCTGTAGCATGGTAATTAACACGTGGCAGAACTAGAAAGAAAGCTTCC
CCTCTGGGGACTTCTGGGGTATTTTGTGGGTATTATTCCTGTGAAATAGCAAAAAAGATA
ATTTCTTTATTATTGCTGAATGGGTTAGTTATATATCAAGTCTGCAGTTGTTAGAAATAG
TTGCAGGAAACTTTATACCTAATGATCTCTGTTACTTTTCCCATATTTCTTAATTAGAAA
TATAGTACCTGTTAGTAGGAATTTTTCCTTACATAAAACATCTATGAAACAACAATTCTG
ATTGATTCTTTTCTTTTTTCTTTCCGGTTTGGTGTGTCTCCTTTTTCTGTTTTCAGTTAC
AGCAACCTCAGCAGACTCTTTTAACACAGGTTAGTTTGGCATTACTTTATTTCTTACAGA
TATTGATTGACAAGCAGACCAAAGTTTTATTCCTGTTCTAGTTTTTCTTCAGGGTTTCAA
GATGAAAATTTGTTAGATAATAGTTTAGCAATACTATATTAAATAAAGATGGAAAACGTG
TTGTTTTTGTTTTTTCTTTTATGGTTTTTGATTGTAGATCCAGCTGTGATCTAGTTTGAA
TAAATGTGAGGTCTTATCTTAAACTTAATACTGATTTTGGCTTTTACATTTTCTTTGTAG
GTAATATTTTTAGGAAATTTTTTGACACTATCTTTTTTAGCTTTACCTTAGAGGTGAAGT
TACTGTGTTACATTATCAGATTAATTCTTCAGCACCATTAAAAAGTTTTTGAACTTTTGA
TGTAGTGCTACTGTAGGCTATGTGGGCCACTTATAGTCTCTGTTGCATTTTTTTTTTTCT
TTTTTGCAATCCTTTAAAAGTCTAAAAACCATCCTTGGCTTATAAGCTGTACAAAAATCC
TAAGCTATGAGCTGGGTTCACTGACCCCTGCTGTGTACTTAGAGTGAAATGCTATGCAAC
TGAGAAGTTAACCTCATTTTCTGTTTTTATTAAAGAGCTAAAATTAACTAACACGTCTCA
CATTTTCTATCTCCAGTAGTAGAATTTCCAAATTAAGTAGAAAAGCTGTAAAAGTATGTC
TTTTCTTAGAATAGCATGTCAAAAAGTATGCCCAGGAAGCATTAGTGTCTTAGGATGTTA
AAGAAGTTTCATGAGAAAATAATTTTGTGGCCACAGTTTAAGAAATGCTGAATTCCTTTA
CTATATACTGTAAGACTTTCCTTTTTTTCTTTTAAATTGTAGAACTTAGAGACTTGCTTT
ATTGGGCAGGTGTAAAACAAATTCCATGGTTTGACTTGAATCAGATAATTATTCCTTTTT
AATGATTCTATTTACATACAGAGGTTTTAATGAATAATACGTTGTTATTCATACTTAATT
ATGCCAGAAAAGACCAGTGAAAGTGTTAAAGTTCTTCTTTTTGTTCCATTTTTATTGAGG
TGTAATCGACATGTACCATTATATTAATTTAAGGTGTACAACATAGTGATTTGATGTATG
TATCTCTTGCAAGGATTACCACAATAAGTTTGGTTAACGTGCACCTCATAGTTACAGTTT
TTTTTCTTCTGTTTAGAACTTTTAAGATCTGTTCTCTTAGCAACTTTTGGATATACAGTA
TTGTTAACTTTAGTTACCATGCTATACTTTACATCCCAGAACTGATCTATGTTATAATTG
GAAGTTTGTACTTTTTGACCACCTTCACCCATCCCCCCGCACTGGCAACCACCAATCTAT
TCTCTGTTTTTATGAGTTCTTCGGGCTTTTTACATTCTATATACATATTTGTCTTTCTCT
GTCTGACTTATTTCTCTTCTATAAGCCTTTCCTGAGTCTTTATTATGCCACTATGGATTT
TGAATTTCTAAGAGAGGGCTGAAATATTCAGTGTTTTTTAAACTTAGTGCACTGTGTCTT
TTTTTTCCTGGAACAATCTGTGAAAAATGTTCATCCTAGGGAACATAATGATGAAATAGA
TCAATAATAACATGATTTTTTAGACTTGAGTCTCACCTTCAAGGTATACATAGGTATTTT
CTAACTTCAAATAAATTATTTTTAGCATTTTGAGTTAGTTTTAAGTAGTCTTTTTAATTT
CTAGACTATTTCAAACCATTACCTTAATTTGATGTTGATTTTGTTTTATAGCCAGCTGTT
GCACTGCCTACAAGCCTTAGCCTGTCTACACCTCAGCCTGCAGCACAGATAACTGTATCA
TATCCAACACCAAGGTCCAGTCAGCAACAAACCCAACCTCAGAAACAGCGTGTTTTTACA
GGGGTGGTTACAAAGCTACACGATACATTTGGATTTGTGGATGAAGATGTATTCTTTCAG
CTTAGGTAAACTTCATTAGGTGTTGGCAGATGGCTTCTTATATTTAGCATTGAGTATATT
GATAGGGTACCTGCTTAATTGTGGCATAGGATTGTGGTTTAGCTATAATTTCTGTTTTAA
TCATTCAGCTTGAATTATATTTGTACATGTGACCTTTTATGATAATGTGCCGATGATATC
TTTTGAATATGGAACAAACTAGTTATGGTGAAATCTTTATAAATGTTTCAGAGTGAATTA
ACATTTCTGACTATTCATGGGCAGGTTTAAATATGCCTTTTAGATTGGAATGGTAATAAT
ACCTTTTAAAATTTAATCTTTTGTTTGACGTGCTAATGACAATATATACTAAAAAACATT
TTTTAATTGAAAAATTAATAGGATTGAATGATTGATGAACTAACATTCAGAATAGGATTT
TGTTAGTGTCGTGTTTGCAGGAAACATGAATTTCCTTAGATATTTCAAATAGATTTCTAA
TGAACTTCTTGAAAGTACTTTATTTGGGAAAAAATTGCTGTGTAAGATTTTTCTATAAGC
AGTCTACTGTTTTCCATCTTATCTGCATTTCTCTCATCTTTCCAAAGCCCAAAGCAAATC
TTACTCTTGGGATATAGAGGTTAGAAAGTGCTATAGAGGAAGGGACACAATGTTAGGAGA
CTATGGAGTGGAAAATGATTTCTTCCGCTTCAAACCCTGTGTTTATGTAAAGAGGGTGAA
ACATGATCAGTTCTAAATTAAACTAAGGGTAGAAGGTATGTCTGCTTTTTAAAAGCTTTT
TAGGCTTCCATTCTAGTTATAGATTTACTCAGTATATAAGTCTTTTTTGAAGGAATCTTT
TAATTGTATTTATATTTAACTTAATTTTTTCCAGTGCTGTCAAAGGGAAAACCCCCCAAG
TGGGTGACAGAGTATTGGTTGAAGCCACATACAATCCCAATATGCCTTTTAAATGGAATG
CGCAAAGAATTCAAACGCTACCAAATCAGGTATGTAAAATACTGAGTTAAGTATTATAGA
AACTTGGTAATTGAGTCTTCTAATTTACAAAGATTTTTCTTTAAAAAAATTCTTTATTTC
TTTATTTTTGTTAAGAATCAATCCCAAACCCAGCCTTTACTGAAGACTCCTCCTGCTGTC
CTTCAGCCAATTGCACCGCAGACGACATTTGGGGTTCAGGCCCAGCCGCAGCCCCAGTCG
CTGCTGCAGGCACAGATTTCAGCGGCTTCTATTACACCGCTGTTGCAGACTCAGCCACAG
CCTTTATTGCAACAGCCGCAGCAGAAAGGTACTGCGTGCACTGTACCTTAGCTTTGTATT
AAAGATTCAGACTAATTCATACCTGTTTAGTTGTTGAAATAATGAGAGTATGCTTTTAAT
TACAAGAAAGGCAGGAGCTTCCAGAATACTTCAAAGGAAGCTTAAGTATCTGGTGTAGAC
AACTTCTACTTCTATAGCTATTTGGAAGTATTTTTATTTTATTGCTCTTATTCAAAGACA
TCTTCTTTGTAAACTTAAATATCAAAACTATTGATCCCTTGTCCTCCTGTTGATACCTTA
TCTGTAATGGGAGAAAATGGTTTTGAGACTTACAACATTTTACATACATGTAGTTCTGAT
GATAACACTTTAAATTACTCATTGAACCATAGTGCGTCGAAGAAATGAACTGTTTTAAAT
TTTCCTTTGCAAATTATTTGAAAGTCTTGACATTTTCTTATCAAAGCTGTTAAAAATGAT
AGCCTTGGCTTAACAGAAGCCTGCTTAATTGGTATTTTTTTAAAAAGTAATTATGGCATT
TTCTCTTTTATTATGTGAATTATGACGCTTATACCAAAGTGATAAGACAGTTTGCAGTGT
AACACGTTATTAAACGAACATTTGTAATCACCACTTACTTTCTAAATATGCATCCTTATA
AAACTGTTTAAATTTGTTTTTGAATTTTAGATGTGTGATTCCATTTATATAGTCTTTTAT
ACAGGACTTTTTTTTGTTCAACATTGTTTTAAAGTTTTTCTTACTGTTTATTCCATAAGG
CTCTAGTTTCTTGATTTTCATTGTTGCATAATATTCCATTGTGTGAATATTGTATAACTT
ATCTGTTGTTCTTTGGTAAACTAGATTGTTAGTAGTTTTTGTTTTCTGAAATTGCTGCTT
TGTATGTTCTCATATGTGTGTCCAGAGGCAATGTGCCTGAGTTTTTCTAGGGCCTATGCC
TTAGTTTGGAATTGTAGGATCTGAGGGTTTGTGTATTTTAAACTTACTAGGTAATGAAAG
GCTATTTCAAGCTACTTGGTTCTTCCATGTATCTGACCTTTAGTCCTATGATTTCTGATT
TTTTTCCTCATCTTTTTCCTAAGAGGTTTTGTTTCCTCTTGTGAATTGGGACTTGAATAC
CATTTTTTCCCTGCCTTGGCTCAAGAAGAGATAAGGCTTCCGTGGAAGGGCTCATGGAAG
CAGTATTTCTGGTGGTGATGTGTACCGTGAGCTTGGTGGATGATTGGTAGGAGCAATGGA
AGTAGGGTAGAAAAAAATGGAAGAGAGAAAAGAGGCATAGTGGGCTGGGGGATTTCAGGG
AGTTGGAGGTATAAGGTTTAGTTGGCGGAAGGGTAGGGAAATCTCCATTGGCAACTAGGA
TTCCTTTAGGATTGGTAGCCTGTTAATCTTTAGCTGGCAGTATTTCTTAACATAAGCAGT
CATAAGTTAGCTGTTTTTGTTTTGCTTTTGTGTTTTTGTTTGGTTTTCCTGGTCCTTCTC
CCTTATTTTTTTTTTTTTTTTAAAGATTTTATTTTTTCCATTTTCTCCCCAAAGCTCCCT
GGTACATAGTTATATATTCTTCGTTGTGGTTTCTTCTAATTGTGGCATGTGGGACCCTGC
CTCACCGTGGCTTCATGAGCAGTACCATGTCCACACCCAGGATTTGAACTAACGAAACAC
TGGGCCGCCTGCAGTGGAGCGTGCAAACTTAACCACTCGGCCACGGGGCTAGCCCCTATT
TTTTTTTTTTTAATGGAGTTCATAATAGTCTACTTCATTGTGAGATTTCAGTTGTACATT
ATTTCTTGTCTGTCACCACATAGGTGCTCCCCTTCACCCCCTGTGCCCACCCCCACCTGG
CTTCCCCAGGTAGCCACTGAACTATTTTCTTTGTCCATGTGTTTGTTTATATTCCACATA
TGAGTGAAGTCATCTGGTGTTGGGCTTTCTCAGTTTGGCTTATTTCGCTTAGCAGAATTC
CCTCCAGGTCCATCCATGTGGTTGCAAATGGGATGATTTTGTCCTTTTTTTATGGCTCAG
TAGTATTTCATTGTATATATATATATATATATACACCACATCTTTATTCAATCATCAGAC
GATGGGCACTTGGATGGTTTCCATGTGTTGGCTGTTGTGAATAGTGCTGCACTGAACATA
GGGGTGCATATGTTACTTTGGATTGTTGATTTCAGGTTGTTTAGGTAGATACCCAGTAGT
GGGATGGCTGTTCATATGGTGTTTCTATTTTTAATTTTTTAAGGAATCTCCAATACTGTT
TTCCATAGTTGTTGCACCAGTTTGCATTCCCACCAGCAGTGTATGAAGGTTCCCTTTTGT
CCACACCCTCTCCCAACATTTGTTATTTTCAGTCTTAATGACTATAGCCATTTTAACAAG
TGTAAGGTGGTAGGTAATAAGTTAGCTGTTTTTTCCCCCAAGTTTTTATCATGAAAATTT
TCAAGTATACAAAAACGTTGAAAGAACAGTATAATGATCACTTGTATACTTACAGCCTTG
AAAAGTTAACATTTTACTGTGTTTTATCTGCATGTGTATACAAATATACACACTTTTTGC
TGAATCATTTGAAGTAATTAGCAGGAATTATGACATTTTATCCCTAAATACTTAAGCAGA
CCCTTCCTGAAACAGAACATTTTCCTGTATTACCACAATCTATTATCACATCTAAGAAAA
AGCATTTAAATATCCTGTTTATATTCAGATCTCCCCAGGTGTCTCCCAAATGTCTTTTAA
GGTTGTTTTTTGGTTTCCTAAACAAAAAGCCAGTGAAGTTTCTTGCATTGTATTTGGTTA
TGTTTCTTTAGTCTTTTTTATTCTAGAATAGTTTCCTACTTTTTTTTTCTTCCTTTCTGA
CAGTTGACTTTTTGAAGTAATTGGACTGATGTGTAGATTCTTTTGGAATGTTGTGGTCTG
GGTTTGTCTTGATTCCTTGTGATGTTTTTACCTGTTTATCTGCCATATAAACTATGAACT
AGAAGCTAAGCCTGAAGACTTTTGGCAAGAACACGTTATAGGCGATGTTTTGTAATTCAT
ATTGCATCACTCTAGGAGTCTCATGTTGTCACATTCTTCCACTGTTGCTGCTAAGTTTGA
TTACCTGGTCAAAGTGGTGGCCATAGTTCTCTCCATTAGGGTTTATTTTTTGTCTGTGCA
GATAAATCTCTCGTTGATACTTTGGCAACCTGTGAATATCTTGTTGTACAGCAATCTTTG
ATTTAATGTCTATAGATCAGAGATTGGCAAACTGTAGCCGTTGGATTTGGTCCATGGTCT
GGTTTTGTGTGGTCCCTGAATTAAAAGTGGTTTTTGCAGGGCCAGCCCTGTGGCCGAGGG
ATTAAGTTTGCATGTTCCGCTTTGGCAGCCCAGGGTTTCACCAGTTTGGATCCTGGGTGT
AGACATGGCGCCGTTCATCAGGCCATGCTGAGGCAGCGTCTCAGATGCTAAACCTGGAAT
ATACAGCTATGTACTTGGGGGTCTTTGGGGAAAAGGAGGAGGAAAAAAAAAAAGATTGGC
AACAGATGGTAGCTCAGGTGCCAGTCTTTTAAAAGAAATGATTTTTGCATTTTTAAAAGG
TTACAAAGAAATACACAAATGGTTCTACCATTTGTGGGCTGCAAAGCCTAAAATATTAGC
CAGCTTTTTCTGTCTATAAAATTTAACCAGGGAGTGCTTTTGAACTTTGTTTAAATAAGT
TAATTTTTTTCTGTATCTTTTAAAGCTGGTTTATTGCAGCCTCCTGTTCGTATAGTTTCA
CAGCCACAACCAGCGCGAAGGTTAGATCCACCATCCAGATTTTCAGGGAGGAATGACAGA
GGAGATCAAGTGCCTAACAGAAAAGATGACCGAAGGTATGTTTTTAAAAGTATGCTTTTG
ATGATGGTGATAGTTGCACAATGTGAATGCACTTAATAAAAGTGGTTAAAATGGGGGGCC
AGCCTGGTGGCGCAGTGGTTAAGTTCGCACATTCTGTTTCAGCGGCCCGGGGTTTGCCAG
TTCGGATCCCAGGTGCGGACATGGCACCGATTGGCCCTCCATGCTGTGGCAGGCGTCCCA
CGTATAAAGTAGAGGAAGATGGGCATGGATGTTACCTCAGGGCCGGTCTTCCTTAGCAAA
AAGAGGAGGATTGGCAGCAGATGTTAGCTCAGGGCTAATCTTCCTCAAAAAAAATGAAGA
ATCTTTGTGTTTGATGACAATCAAACGTTCTCAAACTGATTTGGTATCAACCAGTTATGA
ATACACAAATGCTTACCAAAAAAAAAGGTTAAAATTGTAAGTTTATGTTATGTATATTTT
ACCGTAGTTTTTTTTGGGGGGGTTGGTAAGATTAGCCCTGAGCTAACACCTGCTGCCAAT
CCTCCTCTTTTTGCTGAGGAAGACTGGCCTTGAGCTAACATCCATGCCGATCTTCCTCCC
CTTTATATGTGGGATGCCTACCACAGCATGGCTTTTGCCAAGCAGTGCCATGTCCATACC
CAGGATCCAAACTGGCGAACGAACCCCAGGCCGCCGAAGCATACCATACACGCTTAACCA
CTGCTCTACTGGGCCAGCCCCTTACCGTAGTTTTTAAAAAGTTGTGTAAAAACGTATACT
GTGAAATCTTGCTTGTATTGCCTATTATATTTATTTCATTAAAGAATTCTTCTGTAATGC
CACAAATAATAGTAATTTTAGAAAAATTTGCTTTAAGTCGTGAAAGGGAGAGAGAACGAC
GTCGATCCAGAGAAAGATCTCCTCAGAGAAAGCGTTCCCGGGAGAGATCTCCTCGAAGGG
AGAGAGAACGGTCACCTCGGAGAGTTCGACGTGTTGTTCCACGTTACACAGTTCAGTTTT
CAAAGTTTTCTTTAGATTGGTAAGTTCTTTTTTCTCTCATTGTTTTATTCAGTTACTAAT
TTTTCAGTTTTGTACAATTTGGTAGAATGTGTTATGTTAAGAGAGATTTTTCATGCAATT
TGAAGTTGCAGTTTAGTTTTTTACAAGGGTGCATTATTTCCATACGCTCATTAAGAATAC
CAGCTATTGGAAAAGGCAACCCCTATGTGATGAAATTGTTAAAGTGAGAATCATTTAAGA
TCCAGATTTATTGATAACTTTATTAAGTTCACGTGTAGTGCATTGTGTATGATGAAGTGA
TAGTACAGCAGTGGACCAATTATTTCACGTTAGCTGTGGCAATGTAGTATAATAGAAACA
TAGACCTGCATATATACTCACAGACATGTAACATAGACATGTGTGTATGTGTATACTTAA
ATGGATTTTCAGCCTTTGGAATCAGAGGTCATGGGCAAGTTACCAAGAGTTCCTGAGCTT
CAGTTGCAAAATGGAAATAGTTTCACCCAGCAGAATTATTACGAGGCTGAGTTCATGTAT
CTAAAGCATATAACCCGGTGTATGGCAGTTGTAGATACCCAATAATTAATAGTGATGGTG
GAAGATGGTGACTAACTAGGAAATAGCTGCGAAGTTCTAATTCATAGACAGTTGATATAT
GATGAAGGGACAGGAAGAATCATCTAAAGGCCCTGGGACAGACAATTGTGAATAAGATAA
ATTAACAGTTGGAGAAAACAAACTGACAGTAAAGTAAGAAAAATGAATTATTAGCAGCAT
TTAAAGTTGGTTAGCATAGAAACAATAACTATGTATTTCAGTATCCTGAGAGGTTATTGC
TGCATTTCAATTAAGTGTAATAATTAATATTCATAATATCTATCAGAAGTTAAAATTTCT
ATTTATTCAATTCTAGATTGAATAAACCAGTGTCCTTTATTTAAGCTACACAAAATCAAA
AAAATTTTGCTTGATAACTTTGCTTGATTGTTATGTAGTTGGTGTTCTTTTATTCTTATG
GTCAAATCAGCAACTATTCTTAATTTATACTAATTTTCTTGTTGTCTCTATTTACTTGTA
TACTTCAAAATACCTAGTCTGCGTATTTCAGAGAAACTCATTGGAACCAAAACCACTTCT
CCAGCCTCAAAGATGTTAAATAGAGCAGCTCTGCTTTATTATGGGAAGAGTTGATGCATA
GGCTATAAATTGAACATTTATCTATCTCCTTCCAAAGTTTCCATACCTCTTCTCATCTGT
AGTTTTGATAATCAAAATATTTTTACAGTAATATTATAAGAGACCGTGTGCCAAGAAGTT
ATTCATTTGTACTTCTTATCTTTTGTTTTGTTATAGATTTTACTCCTATGGGGTAAAACA
TGACTTCAGAAATTCTGGTGATGGTAAACTAGGAAAATACTGCACATACTTTCTGTTTGC
AGCACTTCTTTAAACAAAAACAAAACCCAAATATCTGTTTTTCACATTTTTACAATTTTG
ACAGCTGAATTTTATCCAAATAAGGTATAATGTTATCAACAACTGTAACTGACTATATTT
CTTACTTTTAGGCTTCACATAGAAAGACAGCCCTACCAAATATGTCAGTTCACATTTCAT
ACCCTTGTCTTTAAAAAAGACAATGTAGTTGTATTTTCATCTTAGGAATTGTTGGTGTTT
ACCACTTTTCATTATGCTTTTAACACAAATCTCTTGGCTTTTTACCAGATTCATTTACCT
TTGAGTTCTTCTTTAAAAGTTCTGCTTCTTAGGAAAAAGGAAATCTCCTTTAAAAAAAAC
AGTATGCCAGATTTAAAAGGCAAGAAACTTATTTTTCTCTTTACATAATAAGCAATCAGG
TATGGATTTCAGAGAGAGGTATAAAGGTGTGGGTAATCCGAAAATCATTTGGATTTTGTT
TTCATTGGATTTTTCTATTTAATTTTGAATGTAGGTATGTTTGATCTAGGATCTTTCTGT
AGAATAAAGGTTGTATTTTTTCTATACTGTATAAACCTAACTGAGGAACACTCATACTAA
TTTGGTACCACTCTTATCCCCTCTGTATATCCCCTCTTTATATTATATATGAACCATAAT
TTTCTCAAAAATGCAGTTTCAACTGAGGCAGAACTGCTTTTGTTCAGATCTTCTCTGGAG
CTGGGGTTGAAGTTATTTCAAAAGGTCTTCTCTAACGAGTTTTAAGCTACACACAAAAAG
TAAAGAAATAAAGGTAACACTTAGATACCAGATTTTTATTCAGCGCTGTAAGTAAACGAA
TTTGAAAATGAGATTTTCATGTGCCTCTCTGCAAGTCTATACTCATTGATAATTGACTCT
GTCCGTTTTGCATTGGCTTCAACCTATGTCAGGTTATATTTAGCTTCAGAATTAAGTGAG
TGTTTGCATAATCTTTGGTATTAAGGCTATTTATTCACTACTTATGTCTGTTTTTCAGTC
CTAGTTGTGACATGATGGAACTAAGGCGCCGTTATCAGAATTTATATATACCTAGTGACT
TTTTTGATGCTCAGTTTACATGGGTGGATGCTTTCCCTCTGTCAAGACCATTTCAACTGG
GAAATTACTGCAATTTCTATGTAATGCACAGAGAAGTAGAGTCCTTAGAAAAAAATATGG
CCATTCTTGATCCACCAGATGCTGACCACTTATACAGTGCAAAGGTTTGTATTCTCCTAG
GAGAGACAGCTAAAATTTTTGAGCATTTATTCGTATTAAGAATATATGTGGAGTTGATCT
TCAGAAAGTGATTGTTAGGTTTAAGACTCAAATAGCTATGTTTTTTTCTTATCTGCCTGA
TTCTGTTTTGGTTATTTAAGTAATTTAATTTAACCTCTCTTTCCCTTACCTCTTAAGCTA
TAAAATTATTTATTGTTTTAACATTTTAAACCTTATAAAAATATGAAGATGAAGTTGATT
TTATGGAGCTTTTTGTTATGTTTTATGACTTCCAGTAGCCCCAGATAAAACATAACGTTG
GGTGAGTGCACTGCAAGTCTTCAGGGTAACGTTCAGTATATTGCTTATGGTCAATAGTTT
TCTGCTATCTTAAAACATTGATCAAAAAGCATCCCTTGAACTACTCAGCCATAAGAAATG
ACGAAATCCAGCCATTTGTGACAACATGGATGGACCTGGAGGGTATTATGCTGAGTGAAA
TAAGTCAGAGGGAGAAAGTCAAGTACCGTATGATCTCACTCATAAGTAGAAGATAAAAAC
AATGATAAACACACACTTAGCAATGGAGATTGGATTGGTGGTTACCATAGGGGAAGGGGG
GAGGGCAAAAGGGGTGATTAGACTCACATGTGAGGGGATGGACTATAATTAGTTTTTGGG
TGGTGAACATAATATAATCTACACATAATTCAAAATATATTATGATGTACATCCGAGAGC
TATGTCACATTATAATCCAATGTTACTGCAATTAAAAAAATAAAAAGCTATATGATTAAA
ACTATATGATTATAAGGTATCTAATACCATTACTGCTATAGCATTTTATGAAAAATTTTG
GGTATCTAATATGTAAGGATAATTAGTAGTGCTTTTCATTTTTTTACGTTACTTTAGACT
TTTGACAGGATTGAATTATTTGACTATAATAGGTAATGCTGATGGCTAGCCCTAGTATGG
AAGATTTGTATCATAAGTCATGTGCTCTTGCTGAAGACCCACAAGAACTTCGAGATGGAT
TTCAGCATCCTGCTAGACTTGTTAAGGTAAAATGAAAGATTTGTTTCAACTTTAGGGGTA
TAGTCACTTTGCTTATTTCTAACTGTATGTGTGTGTATATATGTAAAACTAAAAGTACCA
CCCTTTTAATCTTGTCACTTGGTTTAATAACTGATTTTAGTATTAAGGTACTCAGAATTT
AATGATGTAGATGTTTTTTTCATTGCAGATTATGGCTGTATCTTATGTATATGTCACTAG
TTCAACTGTCATTTTGCTGTTTTACGTTTGTAGCATAGTAGAATCTTAGTGGTAATGGAT
TTAGTGTATCTTTGGATGCTGTTAAAGTTTGAATTATAGCTTTCTTTAAAAGAGCTCTTT
ATCTGAAGAAATACTTTAGAAGGATGAGTTATGATGTGTAAATCCTATTCCATTGCTGAA
ATGCAGTGTGGAACACGATGAACTGAACTCTTCCTTGACTGACAGATACCAGAGGTAGTA
AAAATGATATTGGAAAGGTTTGTACCTTTCCTTTTCACGTATTTTATTTGCAATTTGACA
AGTTGCATAATATATGTAAATGATTCTTTGTTTTGAATTAGTTTTTAGTGGGCATGAAAG
GCAAGGATGAAGCCATGGCTATTGGAGGCCACTGGTCTCCTTCGTTGGATGGACCAGACC
CAGAAAAAGACCCCTCTGTGTTGATTAAGACTGCTATTCGTTGTTGTAAGGCTCTGACAG
GCATTGATCTAAGTGTCTGCACACAATGGTAAGTACCAATTCATTTCTTGATTAGAAATG
TTTTTCTAATAGTTTATGTAGATGTTCTTGTCTATCAGCCTTCCCTCCCCCACCCTTATT
TTAGCAACCTTGATCATGCAGGTAATCTCAAAGGAAAATCCCCATTTATAGCAAAAGTTT
ATTTGGTGCCAAAATGTTTGGGGGAAAAAGGATTAAGAACTAATCAAAATAAACTGAAAA
TTTAAATGTTTTGTTATGGTGTACTTTGGAAGTTGGATGTATGTTGAAAATATTTTTCAT
TTCATGCATAGCTGGAGAAGATCGTCAAGAGAGAACTTCATTTCATTATAATTCTTTTGT
TATAAAATGATGTAGTTGCTGATTATTTTTGTTCAGCCATATTTTCTCTTGAGGCTTATT
TGTCCTGTGTATTTTAGTATATTTCCTGTGTCTTAATTCAGAATATTCTTTTTTAGCACA
TGAAATCTGAACAGCTTTCCAGCTTCTTCAGGTATTCTCTAAAATAAGGGTAGCTCTGTA
AGCAAACATGAAAATGCCTTGGGGAACATATTCTTCTTTTAACCATAAAATATTGTACAA
ATGTACCAAAAGAGGAACTATGGCTTCTATAATTTTTTTTTCTTTAGACCAACCTCAAGT
TCTTGCAGCAAAATTTCTTTACTTGATGTGCTACAAGTGAACTAGGGTCTTTTAAATGTA
TTTTAGAATTTTTTTTCCAACATGCTTCTTCCCTTGCAACAGGTACCGTTTTGCAGAGAT
TCGCTACCATCGCCCTGAGGAGACCCACAAGGGGCGTACAGTTCCAGCTCATGTGGAGAC
AGTGGTTTTATTTTTCCCGGATGTTTGGCATTGCCTTCCCACCCGCTCAGAGTGGGAAAC
CCTCTCCCGAGGATACAAGCAGCAGCTGGTCGAGAAGCTTCAGGGTGAACGCAAGGAGGC
TGATGGAGAACAGGCACTGAACGCTAATCCCTTTTTCTATTTCCGCTTCTCACAGGCACA
GGAACACAGGCACAAATGCACACCACACACTACATAACAAACACACATGGAGGAACATAA
CTGGTAACAGCGACTGGTAATCCAGCTTTCAGCAGTATAGTTGTATGTTCTTTCCTCTTA
AAAAAAAAATTTGTCTATTAAACTAACTTTAAGAGTGCTGAGACCTCAAAGGAAAATAAG
TTGTGCTTAAATTGCACAGAATTTTGTTTTTATCATAGGTCTAGTTGCTGGAATCTGGGA
CCAGTTGTTGAGCAAGAATCAGTATTAAGCCATTTTAAACATTTTGCCATTTTCTAAAAT
TTAAAAATTTTTCTCTTTCACGGTCATCAGTTCTAGTCATGGATTTTTGAAATTGGACAA
CCACAAGTCTGAGAGATTTGAAATTTCAGGCTATGTGGCATCGTCTTTGGTACATTTGAA
AGGTCTGACTAAATCAGTCTTAACTTTGGGTGGCTTGAAAATTGGGGCAAGATCACACAC
TGTGTGGTTAGTGGAGACCGGCAGTGTTTGTGCATCCCTGATATCCTTTGTGTTGTAATT
TATCACCCTTTTGTGTTTCACAGATCTGGCTTTGATTGGCTGATGAGTGTCTTTGTGATC
AGTTAAAAGTGGTAGAATGTATGTACGTGGACTTGCCTAAATAATAACTTTAGGAGAAGA
CAATCTGAAACATTTGTGACCTTGCACAGATCAGCAACAGACTTTTAAAAATAAATTACT
TTTATTTTAAGGTTTCAGAATAGTAATTATGTTCTTAACTTTGTACATCAGGATGAAGAA
GAGAAAGATGATGGTGAAGCTAAAGAAATTTCCACTCCTACCCATTGGTCTAAACTTGAT
CCAAAGACAATGAAGGTAACTTTGAAAGTGATAGTGTTTAATTTGAAATCTCTGAACAGG
AGTAGAGAATGAGGAATGTTTTTCAGATAAAACCCATTAAAAATGAAGTACACTGATTTT
ATATAAGTATTCTATATTGTACATATGCATATATGTATAAAATTTAAACATAAGGTATAT
TCATAAATCAGTTCATCCAATATTTGTTGAATGCAATATACAAGCACCTAGAGTGTGAGC
AGCATTGTTCTCTGATTTGAGAACTGACCAAGAAGGCAGAATTTCTACACGTAAGGAATT
TAAATTCTAGGAGAAGGGAAGAAACATAGGAAAAGATTATCCAATTTGTAAAATAAAATT
TGCAAGTAAAAAGTGGATTGATAATACATGTGAACTGGGAAGGAAATTATAATTTAAAGC
CTTCTTCTGAAAGTCTTTTGTTAACCTGTAGTAGTTTTTTTTTCTGCTCTCCAGGGTCTT
TGGACCTATTTTCTTTCTGCAGTTTTGCATCTCTAGGCCTGTAATTTCAATGTAAATCCA
TAGATTCTGCATACATTTATTCTACATGATCAGAAGATCAGAGGTTGATCATTACTTGGT
TTAGCAACTTATTTAGCATATAAAAGCTAATCTTTCAGTTAACGTCTTTTCTCAACAAAA
AACAGTTTTTCTTTTTTATGAAACTATTTTTCGTTATGCTGAGGAAGATTCACCCTGAGC
TAACATCTGTTCCAATCTTCCTCCTTTTTTGCTTGAGGAAGATTTGCCCTGAGCTAACAT
CTGCCAATCCTCCTCTTTTTGCTGAGGAAGACTGGCCCTGAACTAACATCTGTGCCCATC
TTCCTCTACTTTATTTGTGGGATGCCTGCCACAGCACGGCTTGCCAAGCGGTGCCATGTC
TGCACCCGGGATCCGAACTGGTGAAACCTGGGCTCCGAAGTGGAACGTGCTCACTTAACC
GCTGCACCACCGGGCCAGCCTGCTACAAGTTTCTTATTTTGAAACTCGTGTTTCTTTTGA
TTATAAATATAATGCGTGCTTATTTTAAAAATTAGTACATAACATAAAAAATAGAAGAAA
AAAATTACTCAAGCCTATCACTCAAACACAACCACTCTTAAAATTTTGATGTGTTTTCTT
CCATTATTTTCCTGGTTATAAGCTTTGTGATTGGTTGGTTGGTTCTAATTGTGTTGTATA
AAAAAAGGTGCTGTCCCATCCTTTTCAATTACTATTAGTGTTTCCTATGTAATTATTTTT
AAATGTTCTATACTCTTCCATCTAGTTGATGTAGTTCTGTTTTCCTTAGATATTACTCTT
TTATTAGATATTTAGATTCTTCACTTTCTTCAAGGGAGGGCCTAGTGTAAGGAATGTTAA
AGTTTTTTTTTTTTCCTGTGTTTAGGGTATTTCCTTAGGGTAAATTCCAAGAAATTAGAA
TTACTGGGTAAGAAAGCATTAACTTGAGGTCTGCCCCATGGGGTAGTGGTTAAGTTCGCA
TGCTCTGCTTCAGCGGCCCGGGGTTCACAGGTTTGGATCCTGGGTGTGAACCTACACACA
GCTTGTCAAGCTGTGCTGTGACAGCATTCCACATACAAGATAAAGGAAGATTGCCACAGT
GGTTAGCTCAGGTCCAATCTTCCTCACCAAAAATACATAAAAGAAAGCATTAACTGTTTT
TTTTAAGTATCTTAAAACGTGCTGCAAATTATTTTCCAAAAATAATTGTTTGTCTTAACA
AACATTTTATGAGCTGTACCAGTGTCCTTTTTTTAAAAAATAGTTTTGTTTTGGTTTCTT
TCTTTGAGGAAGATTATCCCTCAGCTAACATCTGCTACCAATCCTCCTCTTTTTGCTGAG
GAAGACTGGCCCTGAACTAACATCTGTGCCCATCTTCCTCTACTTTATATGTGGGACACC
TGCCACAGCATGGCTTGCCAAGCGGTGCCATGTCTGCACCCGGGATCTGAACTGGTGAAC
CCTGGGCCACAAAAGCGAAATGTGTACACTTAACCTCTGCGCCACCGGGCTGGCCCACCA
GTGTCCTTTTCACCAAAATTTTTAAACATCAGACAGAAGTTAATTGCACAGTATGTTCAC
TGTTTCAGTATCCTATTTTCTATTTCTGTGTTTTTATGCTCTGTATATTTAGGTAAATGA
TCTTCGAAAAGAATTAGAAAGTCGAGCTCTTAGTTCCAAAGGATTAAAATCCCAATTAAT
AGCCCGATTGACAAAACAGCTTAAGGTAGAAGAGCAAAAAGAAGAACAAAAGGAATTAGA
GAAATCTGAAAAAGAAGAGGAAGAGGAAGATGATAGGAAATCTGAAGATGATAAAGAGGT
ATATACTAAATCACTTAAATGTGCTATTAAATATATTAGTTTATAGGGAGTTCTTGGAAT
ATGTGTATGTATACTTTTATTAAGGTATAATTTACAGAACAGTAAAATTCAACCTTTTTA
GTGAACAGTTTTCAAAGTTTTGACAAATGCGTAAATAGTTGTGTTGCTTAAAAAGGGGAT
ACATTGTGGAAAATGCATCATTAGGCAATTTTGTCTTTGTGTGAATATCATAGAATGTGT
TTACACAAACCTAGATAGTGTAGCTTACTTCACACCTAGGCTGTATGTTACTAATTTTAT
GGAACCGTTGTTTTATGTGTGCTACATCGTTGATTGAAATGTCATTATCTGGCACGAGAC
TGTAGTCATGTAACCACCATCACAGTCAAGACATAGAATAGATCTGTCACTCCCTAAAAA
TCCCCTGTACCCCTCGGTAAGCATTTTCTTCTCTCACCCTGCCAGCCTCTGGGAGCCACA
GGTCTGTTTTTGTATAGTTTTGCCTTTTCCAGTATATCATTTCAATGGAACTATATAACC
TTTTGAGTCTGACTTGTCTAACTTAGCATAATGCATTAAGGAAATACCTATTATGTTGTG
TCTATCAGTAATTTGTTCCTTTTTATTGCTTTTAATAGTATTCCATAATATCAATGTATC
ACAGTTTGTTTATTCAGTCTCTATTTGAGAGACATTTGAGTTATTTCCAAGTCATGTATT
TTTAGCTTCCCTTTTAAAAATGAATAATGTTACATTTTTTTAGTAAAGAAAATTTGTTAG
AGCAAAATTAAGTTCAAAGATGGAGTTCTAGTGAAGTGCTTGTCCTAGAATTTTGCTGTT
TCTATAGCTCTGTGTTTGATTGCATTTCACTCCTGAAGATTCAGAGACTGTTTATTCAAG
CCTTTTTATGCCTCAGTGTTGTGCCCAATAGAATAACTCCTGGATGCAGAAGCCTGTCAT
TTGTTTTCTGAATTTGAAATGTAGCAATATCACAAGCGAGTTATAACACCAGTAATTGGA
CAAACCAGCATTATGTTTCCTAATGTATGCTTTATGAAGTATATGTCATTATTTATGAAG
TATTTCTGCCAAAAATGTTTTACCTTAATCTGTGGGAAAACAGATAAATTTAGAATGTAA
AAATTTCTACAAAGCAACTTGTCTGAACTTTTAAAAAATGTCCATGTAATGAAAGACAAA
AGAACAAAACTGACTTGGATTAAAGGAGGTCAGTGAGACATGATAACTGAATGTACTGAG
TGAAACTTGACTGGATCCTGGATGGGGGGAAAAAGCCGTAAAGAGTATTTTTGGGATAAT
TGGAGAAATTTGATTATGGATATGGATCTGATATTCTATAGTATCGAAGCACTGTTAAGT
TTCTTGGATGTGATAATAGTTTTGCAATTATGTAGGAGAATTACCTTGTTCTTAAGAGAT
GCATGGGTGCATGATTTCTTATTTTATTCAGAAGGTTATAAATATTTATTTTGATAGTGA
AATTGTCTTAGAGTTGGCCAGTGGGAGCCCTTTCAAGTTGGCCTCTGTGCCCTTTGACAT
ATCCTCATCATTTTTTGAGGATCCTTTTTTTGTAGCACAATACAAATGTTTCAGTCTCGC
TGTGTACTATCCCTGCCCTAGCTCTGGAATCAGCCATTTCCCCAGGAAGCCCTGGTACCT
TTGAGTGAAGATTGGTAATGGTATTTAGAAGCCAACATGTGCTCATTGTTATGCAGTTCC
CAACCCCTCTCAGGGAACAGAGCTATGGAATAGATATATATCCCTGTATATATATGCATA
CCTACATATATTTTTATATCTATATTTATTACATCTTACGTATATTGGAAGTCATGAGTT
TATACTAATATCTCCACTTCTACTCCAGTGCCACAGAGTTCATTCTAATTTTCTGCCTTT
CCATATGTCTAACTCCTTTCTCCAGTAATGAGAAACATATCGTCGTTATACTTTATATAT
TTGCTTACTTGCTCAGTTGTCCACTGCTCTCCCTCTCCCATCTGGATACCCTCCTTACTC
TACTTTGGTCTGACTCCCTACCCTATGCTGTTTCTCTGTATAGATGCCCTCTTTGCTCCA
TTTGAGTTTCATTACCTGGTAAGTGGGCAGCTCATCTGCTCTGGGCCATTGTAGCTCTCT
CTCCCTGCCAGGTTCCACCCCTTGTATAGATGTCTGCTTGTCTTGGAGGAATTGCTTTAG
AACTGAATTGTTCAGAACAGGAAGAGTAGAAAGAGAAAGAGAAAGCCAGTTTTCACTTGT
TGATGGTGGTGGCCATTGCTGCTCAAATCCTAGATCCATTGATTTGTTGGGGTTGAAAAA
TGGTGATATTATAATCATCATTTTGTTTTCACGTCTCCTCATCTGCTGTTTGGTTACCCA
GTGGTACAGTTTTACCTATTGGGAAATTCATATAGAAGAAGGCAAGATCAATTCTTGATT
CTTTTTTTTTTTTAATAGAACGCTTCATGAATTTGCATCATTATTGTGCAAAGGCCATGC
TACTCTTCTCTGTATCATTTTAATTTTAGAATATGTGCTTCTAAAGCAAGGACTGTTTTG
TTTTTGTTTATCTAGTTGTCAAGATAATGAATTGGTTCCCTAGCATCTTAAGATGTTGTT
TTTGTTTTTAAACATCCTTATATATTTATGGATTTAAACATATTTGATGGATTTCAGTCC
TTTGCAGTTCTTATCCTTATTGAAGCTCAAATTGTCCTCTTTATTTTTTTGTTTTTTGGC
CAGTGGATGGAAATACGTATATATATATACACACAGTACTAGTATGAGTACCATCACCAA
CCAATATTATTGCTGAAACTAGTTTAAAAATATTTTTACATTTTCTATCCCTATTTTCTC
CCCATTGTTTTTATGTTGTACTGTCAATATGATGTCCTAGCATGTAGCCTTATATTGCTG
TACTCTCTTTTAATCCTCATTTAATCTAGGTTCTACAAGTATATTTCTAATGCCAACCAC
TAGTCCTTTTGTCATTATCTCTGAAGCTCGCCTCTAGTAGATTGCTCAATTCATAGTAGC
AGTATTTAAGTTCTTGTATGTTTTATAACAGTTTGACTGTGCCCTTTAAACTTGAAAGTC
AGTTATGCTGAATGTAAAATCTTTGGCTCACATTTATTTTCCTTGAATATCTTAAATATG
TTACTCTTTCTTTTTTTTTTTTTTTAAGATTGGCACCTGAGCTAACATCTCTTGCCAATC
TTCTTTAACTCTTCTTCTCCCCAAAGCCCCCCCAGTACATAGTTGTATATTCTAGTTGTA
GGTCCTTCTGACTGTGCTATGTGGGACACTGTCTCAGTGTGGCCTTATGAGTGGTGCCAT
GTCTGCGCCCAGGATTAGAACCGGTGAAACCCTGGGCTGCCAAAGCAGAGTGCGTGAACT
TAACCACTCAGCCACGGAGCTGGCTCCGTTATTCTTGTTTTTTGATATAAAGTTTTACTT
TCAAAAAATGATGATAATGCAGTTTGCTTTCTCCTACAGTCCCTTGCTATTTTGCCTAGA
TCCACAAAATTTCTAATTTTATTAGAAATGTTATTTGATACTAGTCATTCTCATGGTGTG
CTCTTTCAGTATGTAGTTTCAGATTTTTTTTTCCCCAGGAAAGTTTCTCATCATCAAAAT
TTTTTTGTGTGTGGTAAAATGTACATAAGTAAAAACTACCATTATATCATTGCTTAGTGT
ACAATTCAGTGGCATTAAGTACATTCACAGTATTGTACAGCCATCATTACTGTACATTTC
CAGAAGTTTATCATCATCCCAAACAGTAGTTTTACTTACTAAACAGTAACTCCCCACACT
CCTCTCCCTGTCTCCTGGTAACCTCTATTCTACTTTCTGTCTGAATTTGCCTATACTCGA
TATCTCATGTAAGTGAAATCATACAGTATTTGTCCTTTTGTGTCTGGTTTCTCTCACTTA
GTATGATATTTTCAAGGATCATCCACGCTGTAGCATGTATCAGGACTTCATTTCTTTGTA
AAGCCAAATAATATTCCATTGTGTGTGTATATTACATTTTTTTATTCATCTGTTGATGGA
CAGTTGGTTGTTTTCATCTCTTGGCTATTCTGAATAATACTGCTATGAACAAGCAAATTT
TCTTAAATAATAGTGTTTTGTATTTGTTCTGTTCCCTTTCTTTTGTTTTCTTTAATTCTG
TTATCTCATGTAGAACCTTTTTGCTTCCTCAATATTAGTCACCCTTTTTTTTTTTCTTGT
AAGGAAGATGGTGTCTGAGGTAACATCTGTGCCAGTCTTCCTCTGTTTTGTATGTGGGAT
GCTGCCACAGCATGGCTTGGTGAGTGGTGTGTAGGTCCGTGCCTGGGCCCCAAACCTGCA
AACCCCAGGATGCCAAAGTGGAGCACGTGAACTTAACTACTGTGCCACCAGGCTGGCCCT
AGTCACACTTTTTTGAATCTTTTTCCTCTTCCTTTCTTTTTAATTTTTACGTTTTCCCCA
TTACATTTGTCCTCTTAAGGCATTATCTCTTGAGTTTGCTTTTGTATTCCTTCTAGTTTA
TTCTTAAGTTTCTGAAACTATCTTTTCTTTCTGTTTCCTGAACTCTATCACTTTATTTTT
TACTTTTTAAATTCTTATGCTGTTCATTCATATCTTGTACAGTTTTCTTGTGCACTTATG
GTAAGTTAACATTTTTATCTATCTTGTGGCCAAGTCTTTTTGGCTCACTTTTGTTGTCTG
CAGGGATGTAATTCTGCTCCTTGTTGTCTCTCTCTCTCTTTTTTATTTTTTGGTGAGGAA
CAATGGCCCTGAGCTAACATCTGTGCCAGTCTTCCTCTGTTTTGTATGTGGAAGCTGCCT
CAGCATGGCTTGATGAGCGGTGTGTATGTCTGCACCTGGCATTCCAAACCCACAAACCCT
GGGCTGCCAAAGTGGAGTGTGCGAACTTAACCACTGTGCCACTGGGCTGGCCCCTTGTTC
TCTTTTTATAAAAATAGTAACTTTCTATGGGATTTGACCTCAATCCTTTACTGTTCCTCT
TTTTTTTTTAAAGATTTTATTTTATTCCTTTTTCTCCCCAAAGCCCCCTGGTACGTAGTT
GTATTTTCTTAGTTGTGGGTCCTTCTAGTTGTGGCACGTGGGATGCCACCTCAGCATGGC
TTGATGAGTGGTGCCGTGTGAACTCCCGGAATCCAAACGGGTGAAACCCTGGACCACTGC
AGCGGAGCACGCAAACTTAACCACTTGGCCATGGGGCCGACCCCTCTGTTCCTCATTTTT
ATGTGAATTTCGTTTGCCTAAAACTTTGTTAGAAAGAGGTTGCCTCAGATAGCTTTTCTA
ACTATACAGAGCTCTGTGTTTTGTTGTTCTCTTGTCTTGTCAAAACATATGGTGGCTTAC
TTTCTGAGATTCCTATCTCTATTGCCATCTCTCACTTTTATCTGGACCTCCTCCTCCCAT
GTCTCTGTTCCTGTCCTGATTGCTGTTGATTGTACTCCCAGAAGTTTCTCCTCAGTGTGG
GTGCCCGTGCTGGAAGCATGACCGGATAAATCAACTTTGTAAGTTCATAGGCTAGAATGT
TCTAGGCCCTTTCAGATCGTAACACGGACCCCTTGTCCTCATTATTTTTAGGGGTAAAAC
CTTGCCTAATTTCACCTACTGTTCTTAAATTGACCTGCTGTACTTTCGAGTGAATGTCTA
GTGACTGTTCTGTGGTTTTCCTGTTCTTGGGTCCATCAGACAACTCCATTACTTCCTTCT
GCTTTCTCCCCACAGAGACACAAGTAACACATAGATCTTTTGGTTCTTGTGGCTTGTCCC
CACCCACTTGTATGTTGGGATGTTTTGGGACTACCTTGTCACCTCGTTTTGTTGTGAATG
TACATGGATTTTGGTTTTGGATTCTGGATTGTTCTGTCTCTTTTTAATGTGGTGATTCAG
GGGGATCCAAAAACGATGCTACCACCACTATTTTCCCAGAATCCCGTGACTTACATAACG
TTAATATAGGTGGTGGTTTGTTTTTTCTCCTCTTTAGAATGCGGTTTCTTATGCTTGGAA
ATCCAAAAGAAAGAATTAGGAGCCATAAAACTAGCATCCTCTATAGTAAATTTGAATTTT
CCTCCCTTCCCAGGTCCCGTGGTTGGTATAATCACCGTAAGGAGTCATGGAAATATTTTC
CTATTTTCTTTACATGGTATACATTTGATTTACATACATAGTGTACATGGAAGTTTAAAC
ATAAAATTTCAAATATATAGGAAGAAGAAAGAAAACGTCAAGAAGAAATGGAACGCCAGC
GTCGGGAAAGAAGATATATTTTGCCTGATGAACCAGCCATCATTGTACATCCCAACTGGG
CTGCAAAAAGTGGCAAGTTTGATTGTAGCATCATGTCTTTGAGTGTACTTTTGGACTACA
GATTAGAGGATAATAAAGAACATTCATTTGAGGTAATGTTTTAAGTTTGAATGGGAAGCC
AGATAAGGTCCACACATTTTGACTGATTAATGTATCTCTTAAATCTCTTTTGAGTGCCTT
TTTCACTGCTTTTGGTTTTTTTTCTTGCAGTTTAATTTTTTGAGAAAAAACAACCAGGTG
ATTTTTCCAGTAGACTCACTTTTTTTTTTTTTTTAAAGATTGGTGCCTGAGCTAACAACT
CTTGCCAATCTTTTTTTTTTTCCCTCCCCAAATACCCCCAGTACATAGTTGCTTATTTTT
TAGTTGTGGGTCCTTCTAGTTGTAGCATGTGGGACACTGCCTCAGTGTGGCCTGATGAGG
GGTGCCATGTCCGCCCCCAAGATCCAAATCAGCGAAACCCTGGGCCACCGAAGTGGAGCT
GGCAAACTTAACCACTCAGCCATGGGGCCAGCCCCAGTTGACTCAGTTTTGCTGATTGCA
TTCCTATGGTGTGGTTTAAATTTTCTGCTGTCCTCTATTTCCTGTAAATTGATAGTTAGA
TCTAGAGTCTTAATTACGTTCAGGTTCAGTTAATTTTTTTTCCTGAAACTATCTCATAAG
TAGTGGTATGTTATTAGGTTTCAGGAGACACATGATATATAATGTCTAATTGTTTTTCTT
GGGATATCTGATAACACTTTATTATTTACTCTAGAATTAAAATGCCATTTAATGGAATTG
AAAAGTTTACCTCTGGTGATTGAGGTGTAATGTAACATCATTGATATTTATCTTTGCAAC
CTGAATCTATTTCTTTTTACCATTAATTTAGAGCAGTGTTTATAACATCATAGTGTCATT
TTCAAAATAGTTGAAGACTTTTATCTTAAATAAATGATTGCTTCATTCTTTAAATAAAAC
AATGTAAAATATCTCAAATTATTAATTTTGTAATAGCTTGTACAAAATTATAATTGTGTT
CAATTGTATTTTATCAACATATCTCACATTGTTTTATTTTATAAATTATATTGGAAAAAT
TAGTCATACTTACTTGATCCAAGAGATTATTGTCCACCAAATGATAAGATGAAAATGAAG
TGAAGTGACTTACTTAGACTTCAGACATTTGCAAACAAATATAGAGGAGTACTGAGCCAA
TTACGAAACACAAAATGCATGCTTATTGTTCTTGATATTAAATGTTAGAAATATTTACAA
TTTTTGAATAATTCCAGTAAGCCAGTGTCCTTAAATATTATATACGGTTTTATTTTTATT
ACCAGTTACCATAAATTAAACTCTTAATACTGCCTATCATCTAGTAGTCATTCAAGAAAT
AAGTAAGTGGGAAAAATAGTCTTTGGTATTACTTACTACTTATAAAGTACATACTGTATA
TCTAACCAATGCTGTAAGAGGATCTCAGTGCTCCTCCAGTGGAAACAAAGTGATTTGTGA
AACAGCCCTTTGCTAGCAAAATAATCCTTTATTTTTTCCTCTCCACCTAACATATCCCCT
TGGTTAGTTTCCTTTTAATCTGTTATTAGAATTCAGAAGTCATTTTGGTACATGAATTTA
AAAGAAATTATTTTGTAACTAAGGAAAACCATGTATCATCATAAAATTATAACTCTTTCG
CTGATTTAATATTAATGCTAGTGGTATCTGTGTCTTTCAGTGCCTGTAGATGAAGAGATA
TGTAGAATTAATTCTGCTCTTCTAGTTAACTATTCTAGGCTTCTTCCAATCTAACACATT
TTAGTAAGTTTTTTATCTCTAAGTAATAGAAAACTCTAAGGAAAAGATATGCCTTTTGCT
ATTTGCTTACACAAATTGAGATTTTGTTTAGTTTAATAGTTAAGAGAAAGTGGAATTTTC
AGCATATTAATGGTCATTTTACTAATGGATTTATTTAAAACATATAAAGACTGGGTATGA
ATAAAAAATAGATTATAAAATCAATTATAATTTTAATACATTTGTATTATCCTTTATGAT
CAGGAAAATAGTCTGATTAAAGTGTTTCATCAAATATACAGAACAGAATGCTAAAGATAA
CATATTTTAGAGCTTTGGTCAACCCTTTGAAGTTCTAGCCTCTTAATCTGTTGAAAGCAA
TTATCCTCAGAAATATTTACATAGAGAATTTAGTTTATAATTGCAGGTTTATGAGTATGT
TGAAGATCAGTATCCATGGATCCCTGCATAGTAATAATGCATTCGCCCTACTCTGAATTT
TGAATTGGTTTTTCCTGCCTGGAATGCTCTTCTGGATAGCAGTCTGGCGCATTCTCTTGC
TACCTTCAGGTCACTTTTCACCTGTCACCTGATCAAAGAGGCCTTCTCTGACTATACTCT
CTTATTACTCTCAGAACTTTTTTCTGCTTTCTTCACTGCTGTGTCCCTAATGCCTAGAAC
AGTCCCTGGTACATAGTAGACATTTCATACAAATGTGTTGAGTAAATGAATAAAGTACAT
TAACATGAAGATTAATTATTGTGTAAGGTAGTAGAAATCCTTGTTTCCTGCTTATTTTCA
AATTTTCTGTAGTATGGTTATTTTTTATAATATTTGACCAAAAGTATACTAAACATAGTA
TTTATATCTTCAGAAGGGTCTTTGAGGATTTTGAGGCTCTTCAACATCATTGACGTCAGT
TATTACAACTCTATTGTTAGTGCACATTGTTAGATGTGGCAAGTTATTATTTGATAAATT
ACTGTGATGTGGTTTTATTCAATATTTCTATTAAAGTTTGCTGGTTACTATTGATATCTT
TCTATAGGTCTCATTGTTTGCAGAACTTTTCAATGAAATGCTTCAAAGAGATTTTGGTGT
CAGGATATACAAATCATTATTATCTCTTCCTGAGAAAGAGGACAAAAAAGAAAAGGAGAA
GAAAAGCAAAAAAGATGAGAGAAAAGATAAGAAAGAAGAAAGAGATGATGAAACTGATGA
GCCGAAACCCAAACGGAGAAAATCAGGCGATGATAAAGATAAAAAAGAAGATAGAGATGA
AAGGAAGGTCTGTAAATATTTCCATGACCAGCAGCCTGATTTAGAAGTTTTCTGGTAGTC
TTCCAGAGTGTAACAAATGATGATGAATTCCATCAGAAGAGTGAAGCATAAAGGCCAAAT
TTGAAAGATTTTACTGTATTATTAGAAATTTAAGTCTTTGAATTGAGCCTATATAAACAT
CTATAACTAGTTTTCATTTTTTTTAAGTTTAAGGCATACAAGATGATGATTTGATTTACA
TATATTGTGAATGGTAGTTTAGTAAAGTGTATTGTTTTAAGAAATTTATAATGTGATACT
ATTTCAAATAAATTTAGTGGCTGTAATGTTTTTTGATTTTAGTCATTTAATGTTTGATGA
GATGTGTTGCTTAATTAAAAGACATTTTAAATTGCAGAAAGAAGATAAAAGAAAAGATGA
TTCTAAAGATGATGATGAAACTGAGGAAGATAATATTCAAGATGAATATGATCCAATGGA
AGCAGAAGAAGCTGAGGATGAGGAGGATGGTATGATTCAAATTGATTTATTTCTCCTTAG
GATGAAAAATACATTTTTTGTTTGGCAACTTTGTATCACTGAAATCTATAATTTTAATAT
TTTTTAGAATAGAAAGAGTAAAATATTCTCCAATGAAAATCTGTTTGTATTAAGTAATTT
TTAGATGACAGGATTATTTTAAGACATGTTTACTTTTATTTATTTTTGGTGACGAAGATC
GGCCCTGAGCTAATATCTGTTGCCAATCCACCTCTTTTTGCTTGAAAAAGATTGTTGCTG
AACTAACATCTGTGTCATTCTTGCTCTATTTTGTATGTGGGACAGTGCCACAGCATGGCT
TGACGAGTGGTGTGTAGGTCTGTGCCTGGGATCCAAACCTCTGAACCCCAGGGCCACCGA
AGCGGAGTGCGCGAACTTAACCAGTACACCACCAGACTGGCCCCAAGACATGTTTATTTT
TGATTATCATATGTCCCATATATAATTAACATTTATTCAACTTGAGAAAAAAAATTCCCT
GAACATGGTACTTACACTTTGTCATAAATAGTGTAATGGTCTCATTGTTTCTTAGAATAT
ATTCTTCTTTAGAAAACTAATTTTAGCATTTTTTTAAATTACAAAGACTATCATACATGC
AAAGGAGCGCATATAACATTTAGGTGGAGCTTAACCATTTAAGCACTATGCCACCAGGCC
GGCCTCACAAGTTTTGAATAAGAAACTTTTACCAATAGGAATGATACTCAAAATACTTTA
TAATACATGTCCTGATCAGTCAAAGATGCCAACTATAAAGTACCTGAAAAGCTCCAACTG
AGTGAGTGTCAGTCTCCTTGTAGATTTTTTTTTTAAATCTTTTTCTGAGATGAGATTTTT
TAATTTTACATATCTCAGATTGTTATTACTTAAGGCATTTTTGGTTTGCCTCTACATTTT
CTTCTTTCGACCACTGCATTTTATTTTTTTTCTCATTGATGAAAACATTCAAACGTGAAA
GAAGTTGAAAGAATACTGCATTGAACACCATGTATCCCACAATTGATTCATTTGTTAATA
TTTTGTCTTATTTGTGTTGTCTGTGTGTTTGTATGTGTGTGTTTCTGATCCATTTGAATG
TAGGAATTCTTCAACTTGCCTAGGACAAGACATTCTGTTAACCACAATTTTCATAATCAC
ACCTAAGAAAATGAACAATAGTGTCATATACCATCTATTAATACCATCTAATATCTGGTC
TAATAACATCAATAACAGTGATATAATATGCATGTATCAATATTCCTTCATTTATCTTCA
TTACGTGCTTTGCTCAATGAAGATTCATCCCTATTACAGTCCTATTTTCTCTCCCCTGTC
TTCTCAGTATTTTTTTTTTTTTTTTAAAGATTTTATTTTTTCCTTTTTCTCCCCAAAGCC
CCCCGGTACATAGTTGTGTATTCTTCGTTGTGGGTTCTTCTAGTTGTGGCATGTGGGACG
CTGCCTCAGCGTGGTCTGATGAGCAGTGCCATGTCCGCGCCCAGGATTCGAACTAACGAA
ACACCGGGCCGCCTGCAGCAGAGCGCGCGAACTTAACCGCTCGGCCACGGGGCCAGCCCC
ACTCAGTATTGTTTTATCACTGCTTTGGTTAAATCACTAAACAGTGTTCTCATTATTTTG
TCTATTAGAATGTCCTAGCTCTCATCCCTTAGTTGTTGTCTTTATTCTTTTGTAATATTT
AATTCCCTTGGTGGTGGTCTCATCCATTCTCCTGGCTTTAGGTACTGTCTATATATTGAC
AGTTCTCAAATTTGTATCTCAAGTCAGACCTTTCTCCTATTCTCCCTTATCACCTGCCTA
CTTAACATCTCCCTTAAGTTATCTGACATTTCAAAATAAACAAGTCTAAAACTGAACTCC
TGCCTTTCTTGACCAAAAAGAACAAAAATTGTCCGTCACCCTCATCGTTCTCCAGCTCAT
GTGATGGTAACTCCATCCTTGTAGTTATTCAACCTAAAACCTAGGAGTCATTCTTGAGGC
TTGTTTTTGTCATATCCCATTTCTAATCTTTCAGGAAGTAATATTGCCTTCAACTTCAAA
ACATATCTCAGAGCAGACCATTTCTCACCAGCTACACTGAACTAATCGTAATCCAAGCCA
TGTTGTCTCTTGCCTAGATTACTTAATACCCTCCCCACTAGTTTCCCTGCTTACCCCCTT
CTCTGAAGTCTCTTCTCAATAGTTGCCAGAATAACCTTTGTAAAATTCAAGTCATTTTGG
GGCCGGCCCAGTGGCACGGGTGGTTAAGTTCACACATTCCACTTCAGCAGCCCATGGTTT
GCCGGTTTGGATCCTAGTTGTGGACCTATGCACCGCTTACCAAGCCATGCTGTGGCAGGC
ATACCGCATATAAAGTAGAGGGAGATGGGCATGGTTGTTAGCTCAGGGCCAGTCTTCCTC
AGCAAAAAGAGGAGGATTGGCAGCAGATGTTGGCTCTGGGCTAATCTTCCTCAAAAAAAA
GAATTTAAGTCATTTCATTTGTTCACATTTTTACAGTGGCTCTCCATTTCACTGTGAAAA
AAAGCCAAAGTGTTTACAGTGACCTATAAGGTGTTGCGTCATCAAGTCTCTAATTTCATC
TCTTTTTACTCTTTCCACTTACTCATTGCACCTCAGGTACCTGGGCTTCCTTGAACCCAT
AACGTATTCTCCTATGTTAGGACCTTTGCATTGGCAGTTCCTTCTCCTGCACACTGTTAC
CTGGAGATCCACCTTCCTGACTCCTTCATGCTTGAAGTCTTTGTTCAGCTGTCATTTTCT
CACTAGGGCCTACTCTGTACCCTACCCTGTTTAAAATTGCAGTCCTCCCCATTAATACAC
ATTTCTAATCCCTCCTTATCCTTCTCTACTTATAGAATGTATAACCTACTCTACTATACT
ATTTACTTATTTTATTTACTGTTTATCTGCCTCCCACCTGAATATAAGCTCTTTAGTAAG
AAATAGAGGGATTTTTTTCTAGTTCCATTGCTGATGTATATTGCAGGTTCCTTGAACAGT
CTAAATATCCAAATAGGTTCTAAATAGATATTTGGGGTTTTTTTTTTTTTTAAAGATTGG
TACCTGAGCTAACATCTGTTGCCAGTCTTTTTTCTTCTTCTTCTTCCTCTTCTCCCCAAA
GCCCCCCAGTACATAGTTGTAGATTCTAGTTGTAGGTCCTTCTGGTTGTGCTATGTGGGA
TGCCACCTCAGCATGGCCTGATGAGCGGTGCCATGTCCGCACTGGCAAAACACCAGGCTG
CTGAAGCAGAGCGTGTGAACTTAACCACTTGGTCATGGGGCCGGACCCTTGGCCACCTCC
TCATCTCAGGACTTTTGGTTTCCTTGTTTCCAATTGCTGCTTGCTTGTGTTATCATGGTT
GTTTGTTTCATAGTTTACTTTGTATTTCATTATTCTATCAAGTCTCTGGAAGACCACTCT
TTTTCCATTGGAAAAGTAGAATTGATGGTTAAAAAAATGAAAATATAGTGCCAGTTAATG
TCTAAAATGGTGTGGCATCATCTTATTAATCAGAGGGGCAAATAACAAGTCTATTTTTTA
CCTATCAAATTGATGAAAATTAAGTTTTTAAATAAAAGGTAACGTCAGTTTAACAAGGGT
AAAGAGAAGAGTATTTTCATCATTCTTGGGATCAGTTTAAATTGTTGTGCTTTTTCTGGA
CAGAAGTTTGGAAATGAGAATTAACCATGTCCTTTATAATAACATGGATGTTCATTGCAT
AATTATTATAAAACAAAATATTAGAATCCATCTTAATATTCAATAAGAGGGAATTAGTTA
AATGCATTTTGATATAGACATGCAGTTAAATTTTGTGCAGCCATTGAAAAAGATGTTGGA
GGAGGATAGTGACATGGAAAATATGGCAAAATAGTTTTTATAGACAGCTTATTCCATTAA
ATGGGTTTCATCTGCATTAGGTGTGTGTGTTGGGAGGGAGAAATAAAAGCACATGATACC
TGCCATAATTTAGTGTATCTTTGTATGATGGTATTTATTTATATTCTAAGATGAGCAAGT
ATTACTTGGATTTTAAAAATATAAGTTCAAGGAGAGACAAAGTTTTAAAAGTGACGTCTT
CCAAGTTAAATACCCAAATAAGGTGAATCAAGTCTATAGAGTGTGAATAAATGAAAGGAA
AAGGGATTCAACCTTTGTGTAGTATATGGTACACTCTTGATAAAAATGTTATTATTTAAT
CCTCACAATTATATTCAGAGGCTATTATATTTTCCATTTAATTGAGGAAACTGAGGGTAT
TAGCAATAAATTAATTTACCCAAGAGAATAAAGCTGCATAGTGGCTGAGCCACTCTACTA
TTTTATATATAATAAAAATAATTAGATTCCAAGGATACATTCTCTGGGTTTTTTTAAACA
GTTTGTTGAGGTGCCCATACATAGCAGAAAGCTCACCTGTGTTAAGTGTAGAATTAATAA
TTCTTAGTAACTATAAAATTGTGAACCTATCATCACAGTCCAGTTTTAGAACATTTCTCT
ATTTCCTTTCTTTAGTAGGTTTATTGAGATATGATTCACATACTATACAATTCACCCAAT
TAAAAATGTACAACTCACTGGTTTTTAAGTATTCACAGAGTTGTACAACCATTACCACAA
TCAATTTTAGAACATTTTTGTTTATCTCAAAAAGAAAGCCTGTACTCATTAGCAGTGTCT
CTCATTTCCCTCCAACTGCTTCAGCCCTGGACAGCCGTTAGTCAGCTTTCTATTTCTATA
GATATTCTGGACAGTTCATATAGATGGAATCATACAATATGTGATCTTTTGTGACTGGCT
TCTTTTCACTTAGCATGTTTTCGAGGTTTGTGCCTGTTTTAGCATGCATATTCTCTTTAC
TAAAGTTTTCACTATATTGTTGACACTTAAATACACTAAAGCAGTGTTTCCCAGAGTGTC
CCAAGATATTAATAGGTATTAAGCTTAATAAAGTATACTGGAGCCAGATAAATTTGGGAA
ACTTGGGTTAAGCAAAGTTCGGCATGTTTTACCACAGAATACATTAGCTTCTTATGTGTG
TTGTGGATGTACAAAGAGGAAATAGAGTATGAAATATTTATGAATATATATGCTTTGTAG
TATTTCAAAGACTATTTAACTCCTAGTGTTTACTATATTTCATGTGTTTTACCAACAAAC
CATTTGTTACTCTGAGCTTTTTGATGGAGATCCGTTTGAGGGAGCCAAGAAGCTTCTAGA
ACCAAAATTTCTCTTTTAAAATTGTCCTTGGATCATTAAATAACTGCAAAAAAGATCTTT
AGTATTTGCATATAATTCATGAAAGGATGATGTATAGTTCACTAGGGCTACTTAAAAAGT
ACCCCACAGGGCTGGCCAGGTGGTGCAGTGGTTAAGTTCCTACCTTCCAATTCAACGGCC
CGGGGTTCACTGGTTGGGATTCCAGGTGTGGACCTATGCACTGCTTGTCAAGCCACTCTG
TGGCAGGTATCCCACATATAAAGTAGGGGAAGATGGGCACAGATGTTAGCTCAGGGCTAG
TCTTCCTCAGCAAAAAGAGGAGGATTGGCAGCAGATGGTAGCTCAAGGATAATCTTCCTA
AAAAAAAAAAAGTACCTCAGACTGGGTGGCTTAAACAATAGAAATTTATTGTCTTTCAGT
TCTCAGAGGCTAAAAGTCTGAGATCAAGAAGTTGGCAGGGTTGGTTCCTTCTAAGAGCTG
TGAGGAGAGGATCTGTTCCATGCAGCTTTCCTTGGCTTATAAATGGCCATCTTCTCCCTG
TGTCTTCACCTCATCTTCTATCTGTGCATGTCTGTGTCGAAATTTTCCCTTTCTCTCAAG
ACACCAGTCATTGGATTAGAGCTTACCCTAATGACCTCATTTTAACTTGATTACCTCTGT
ATAGACCCTTTCTCCAAATAGGTAACATTCTGAGATACTGGGGCTTAAGACATTAGCTTA
TGAATTTTAGGGGATACAGTTCAACCCATAGCTGATTAATTCTTTAATATTAGTTCTGTA
ACAGGCTGGTAATGATGGTTGACCTGAGGGTGATGGCTGAGGTCTTGGAGAACTGGGTAG
CCTAGGGATAGGTAAGGAAAAGAAGTTTCCTTTCTGCCAGTTGCTCTTTGTGTATTTTGA
ATTTTGCACAAGGTGCATTATATTTTCAAAAAAACTTTTAATGATAACAAAAGATATTAT
TCTAATCTAGAAAATAAGTGTCATGACTTGTCTAAATTGCTCAAGTATTCCTTTTGATAT
TTGAATTTTATTAAGACTACTTACCTAGAGTACAGATTTCAAGTCATATGTTCCACAGTT
GCAGATTTACCTTACTGTACTAGTTTTTTGTTTGTTTTTTAAGATTTATCCAAGTTACCA
TCTTTTATCATGGGACACATATGTTAGTGCTAGCAAATCTGGATACTAACACTATTCGTT
CTTAGTTATCTTTAGAACCTCTCAGTTTCTTGTATGTAGTTTTATTTTGCAATAATCTAT
TTGCACTTAATTTTAGTACATTGGCTGTTCTTCCTTTTAGCTTTTAGAAAATACAGTTTG
TTTAAGTTGGTGTTAATACTCTTCAATTTCATGTATAAAATTAATTCATTTATTTGAACT
TTGTCCTCGAAATATTTATGGAATTAAGTCCTTTTATTTGATTCAATAAAGTCAACTTAT
TTCCCTCTCTAGTGTCTTTGTAAATTGCTTCCTCCTCTTATTCTTTATAATTGTTTCTTA
TAAAATCCAAACTATTTTTATTCATATAATACTTCTTTGCTATTGTGTATTTTGAAAACT
GACCAGTAATAGGAAAGTATTTTCAGTCTCTACAATAATTGAAAATATCTGTATTGCTGA
AGTTTTTGCTGTTGTATTTATTTTATAGATCGAGATGAGGAAGAAATAAACAAACGAGAT
GACAAAAGAGATGTCAACAAGTACTGCAAGGAGAGGCCCTCTAAAGATAAGGTATTTATC
AAATACTGTATTTTTTATAATGTGTTAATTTCCATTTCTTATATAATCCAGATTTCTTAA
ATATAACACGGTCATGAAGTTTGTTGGTACTTGTATATCTATATATTACTACTCAGAGCT
AACTTCAGCCATTCGTGTTTTGATATTTGTGATTATGTCAGATAACCAGTATGTCTTACT
ATTTTCTCCCATACACATAAACCAGATCAACTCATTTTTGCTGAGACGAGGCAAAGGTCT
TTTAACATTTCACTATTATATGGACACGGTTTCAATTTCTCATTTTTCAAGGGTAAAAAT
TTTATACTATCTTCTGCATTTTCTTTAGGAAAAAGAAAAGACTCAGATGATAACAATTAA
CAGAGATCTGTTAATGGCATTTGTTTATTTTGATCAAAGCCATTGTGGTTACCTCCTTGA
AAAGGATCTGGAAGAAATACTTTATACTCTTGGACTACATCTTTCTCGGGCTCAGGTAGT
CTATCTTCTGAATATTTAAAGTGAAAAGCATTTTTAAGTAACTTTATCTTTTAGTCTTTG
TTGACTTTTGGAAATGTAAGAGCAGTACAGGCTAGTTTAGTAATACAGTCAAGCAATACT
GAAATGTATAAAGTAACAGAAAGTTCAAAGTCCCCTCTCCCTCTAGTGCTACTCTGGTCT
AATATATAACCTACTAGATCTTTTCGTAAGCAATTCGTGTGTGTGTGTGTGTGTGTGTGT
ATACATATATGATCAGTTTTTTAAGTAACACATGAAATCATTCTATACATATTAATACAC
AGCTTTTTTTCATTTAACAATACAGTGTCATGGGCATTCTAACGTGAAAATAGATACCCA
CTTCTTTTTTTTTATGACTGCATAGTATTCCATGGTATAGATGTACCATAATAGTCTCAG
TAGCTGAGTGGTTTTCACTTTTTGGAATTACAAACTATACTGTAATAAACATCTTTGTGC
ATATACTTTAATGTATGTGTTAAGTGTTTCTATCAATGTTAGACATTTTTTCAAATGATA
ATTTTGATTTTAGTTGTATAGAGAACATAGTTAAGAGAGCATAAGTGGTCTGAGTGGGAG
TAGATACCTGAGAAAACAAGATGCCACTGATATCCATCGTATGTGAAAATTAGGACACAG
TTGTTCAAGGAGAATCAAAAACTTATTTTCATCTTTTGAATTTGTTTACTTGCCTGCATA
ACAGGTAAAGAAACTTCTTAATAAAGTGGTACTCCGTGAATCTTGCTTTTACCGGAAATT
AACAGATACCTCAAAAGATGAAGAAAACCATGAAGAGTCTGAAGCCTTGCAGGAAGATAT
GCTAGGTTTGAGTATATTATTTTAAGATTGTGACATTTTGTAACTTTATTGTTAATTAAA
GAGGAAAAAAAATAACAATAAAATATGGTATCTTCTTTATTATAGGAAACAGGTTGTTAC
TTCCAACACCAGTAGTAAAACAGGAATCGAAGGATGTGGAAGAAAATGTTGGCCTTATCG
TGTACAATGGTGCAATGGTAGATGTAGGAAGCCTCTTGCAAAAATTGGAAAAGAGTGAAA
AAGTAAGAGCTGAAGTAGAACAGAAGCTGCAGTTACTAGAAGAAAAAACAGGTAAGTAAC
AGCATTGGATATGTCAGTACTTTTAACACCCTATTGGAGTATATATGTGTACATACGTGT
GTATGTACCTATACACACATGCGTAGCCATACCTTGCATTTTAGTCTGGGCAATAATGTA
ACTTTAATTTTGACCATTTCTGTTAAAAGTTATAAAATTGCTTAGCTTTCTAAGAATTAA
TCTTAGATTTTTATGTTCTCAGGTTCGTTTGTTGTTCTGTTGCATCCTTTTAATCCTCCC
CTGGTTCCACTTAGTTTTCTCCAGTTTCTGCTACTTTCTCTAGTCTGTACAATCGTCTGA
AAATGAAACATTGGTTTAGAAGTAATACTTAGGTAAAACTTAATTTAAATGAAATGAGTA
TTACAGTGTTATTTATAACTATTGAAATTGACATTTGTGGCCATTAAGGAATTATATCTG
CTTTTTATTTTGCTAGTGGAAATATTTTTAACCTCAGAATTAAATTGGATATTTTAAGGG
GTAAGATGGTGAGTTTTTCTGTTTTCTTTTAAACAGATGAAGATGAAAAAACCATATTAA
ATTTGGAGAATTCCAACAAAAGCCTTTCTGGTGAACTCAGAGAAGTTAAAAAGGACCTTA
GTCAGTTACAAGAGAACTTAAAGATTTCAGAAAACATGAATTTGCAATTTGAAAACCAAC
TGAATAAGACAATCAGAAACTTATCCACAGTAATGGATGAAATCCACACTGTTCTCAAGA
AGGTTAGCAGTTTTGTACTTTCAACATTTTCATAGTTTATTTCAATTTTTATATCTTTAT
GGCAATTTTAACGTTATTAAGCTCATAGTGGTTTTTCTAGGAGCAAATGATGGTGGCATT
CTGTTCTTCATCAGATTAGTCAAAAGCAATTCCCACAGGATTGTATTTCCCTAGAACTTT
GATGGGATGTCAACATGGTTTGTATGTACAGAATTCTTAAAGCAAATTTTGTATTTCTTT
CAGAACCAGAGAGTGAGTTTGAACTTGAGGAAGATAAAACCTTTCACTTTCTTTTCATAC
CCATTTATTGTGGGCAGAGTCGAGAAACTTTGGCACTATCATAATTAATTTATTAGGATT
CTTTGTCACTAAAGAAAAATTTAGTAACTCAATGCCATTATAAACTAACTTCAGTAATTG
AGAGATCTTCCACATCCTGGGTCTCACTCACAGAAGAAAAAAATCTGCAGTGCAAGGAAT
AACTACTGTTATTCTAATTTCTCAGAACTCAGATGGCTTTCTCAAATACTCTAAGCCATT
CTGCATAGAATTGAGAGATGGATTTCTTTCATAATTGACCCCAGGGTCAGTTTTCCACAG
ATGGTAAAATGCGCTATCTGTAGTATTTCTGTTTAGCAGTGTTTATTATTTTTAAAGTTA
CATTTAAGAGAATCTAATAAACTATAGTTTTTCCTTGTCTGTTGTTTTATAGGATAATGT
GAAGAATGAAGACAAAGATCAGAAATCCAAGGAGATTGGTACAAGTGTATGATAAAATAC
GTGTAGTGATGAGGAATGGTGTTAAATAATGTAATATATAAAATCATGATACAAGAATGT
TTGAAAGTGATGCATGTTTGATTTTAGTAGTATAAATATCTGTTAGTTCAAATGATGTAT
AAAGTTTTACGAATGTGAGAGTCTCTGCTTTTGAAAATTGCTTGTAATTCCTGGCATTCA
AATTATTAAACACTCCTTGAGTGAAATAATTTTGCATTGCAAAATGTTTTAGGATGAACT
TTGTTATAGTTTTAACCCCAATAAAGTTCATCAACTTAATTGACAGTAGTATTTAATTAC
CAAATGTCTTTTATTAAAATATCTAGAAAATTGTAATTTTATTTATAGAATTATCATTTT
TAGGTTTAAAAATTTTTTTTAGTCTTTTAAAATTTCATTATAAATCATAAAATAGCATGC
TGCTTAATTTTTGCAAGTTTTTGAACCAGACATTTTTTTACTCACCATAAAAAAAAAAAC
CCTCTAATTATCAGTCTCTGAAAGCATTCATTAAAAATTCAATTCATCCAAAAGACAATA
CATCAAAAACTAAGAAATAGACAATTAGCATTGTTACTGTATACGTGAGGCTTTACATAA
AACTAATAATTCTGATGTTAATGTTACTATTCAACTGATTAATTGTTCAACTTTCCCAGA
ATAGCAGCTACATTACTTTTAATTTTGAGGAGTTTTTAAAAAATGCAGTATATGTCAAAT
GTACAGTTAAGTACCAAGCCAGTAGATGTCAGTATGTTGCCTTTTAAGTTAAGCCTTCTT
GAATTAAAAATAATTTTTTTCTTAGTCTGTGTACTTCCTTCAGAATTTTAGTGGATACAT
AAGAGTTGATTAACTGTTGAATGAAAAAAGTAGGCAATGTGGTATACTCTTAAAGCTGTG
GTTCTCAACAGGGGTGAATTTGCCCCCACAAGACAGTTAGCAATGTCTGGAGACATTTCT
ACTTGTCGCATCTGGGTGAGTGCTACTTGTGTCTAGTTGGTAAAGGCTAAGGATTTTTTT
AAACATCCTATGTTGCATATAACCACCCCCCACAACAAAGAATTATCCAGCCCCAAATGT
CAGTAGTGCCCAGGGTGAGAAACTCGAGTCTAAAGGAATATAGGGTTAAATGACATGTCC
TTCAGATAACACTGGTGAAAACTGAAGAGCATCTTGAGCAGATGATTAGTGTTCTGTATT
TAAATAACCCTTCCTGGAACATTTCACTGTCACAGAAATCTATGCTATATTAGGGTTATT
TTATTTCATTTTGCCAAAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1069, 2224..2345, 12340..12512, 12922..12966, 15476..15508, 17271..17464, 18334..18448, 18555..18747, 22465..22594, 23437..23598, 26038..26263, 27212..27325, 27881..28047, 28782..28963, 29110..29138, 29811..29894, 32032..32217, 38480..38671, 41407..41646, 42037..42148, 49048..49130, 49468..49614, 50344..50464, 50565..50750, 51276..51481, 52192..52538
2273..2345, 12340..12512, 12922..12966, 15476..15508, 17271..17464, 18334..18448, 18555..18747, 22465..22594, 23437..23598, 26038..26263, 27212..27325, 27881..28047, 28782..28963, 29110..29138, 29811..29894, 32032..32217, 38480..38671, 41407..41646, 42037..42148, 49048..49130, 49468..49614, 50344..50464, 50565..50750, 51276..51481, 52192..52248
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved