Equus_caballus Locus ENSECAG00000015521
snOPY snoRNA Orthological Gene Database
Equus_caballus ENSECAG00000015521
Equus_caballus
ENSECAG00000015521
1
SNORA11
16236..16365
36681
TTGTTCTTCTTTTTCTAGTTCTGTTAGGTGTCGTTTGAGGTTGCTTACGTGAGCTTTTT
CTTGTTTAGTGAGGTGAGCCTGTATTACGATGAATTTCCCTCTTAGGACTGCTTTTGCTG
CATAGACATGATTCTAATAGGCCAAGTTAAAAATACTGTTTTCTAAGAAATATAGAATTC
ACACTCAAAAAATTCAAATGGTACAGAAATATGATGCAAACCTCTTCTTACAGTCCCCTT
CTCTAAATTTAAACCTCTGTTACAGTTTTTCTATATGAATTGACATTATTGCTGATTGTA
ATTTTCTTTCCAATTTACAAAGTTTAGGTCTTTTAAAACATACTATTTTTGCAACTTGCT
TTTTTAACTTAATGGGTGAAATCTTAGATTTTTCCCAGTGTTTGTAAATATCATTGTTTT
TATACCTTTATTGTATTCCACTATATAAACATCCCCTAATTAAACTTACTACTTCTTGGC
AGATATTAAGGGTGTTTCTCTCTCTCTTTTTTCTTTTGATATTACAAATAAATGTAACAA
GGAACATTTTTCTGTGTATTTGCATTATAAATACGTAATTGTGCGAGTGTATAGTAGAAT
AAATTCTTAGCAGTGCAGTTGCTGGGCTCAATTTTTATACGATTCTGAGGCCAAGCTTTT
AAGATGTATTGCTCTTGGATAAATTCTAATTTTGCACCTCAATTATTATGGTTTTTTTTT
TTAAAGCAGGAGATAGGAGAATAAATATGACCCACATCTTAAAATATCTTTTTCCTCCTC
TGATTCTTAGAGGAAGAATGAATTAGTTAGGATCAGAAAGAAAGGAACAAATTAAATTCC
AGGGCCTATTGTCCTAGACTTTAATCATTAAAGCTACCAAAACCTTGTCAAGATTCATTG
TTCTGAATTGAAAAAAAAAAATCAAATTATTAAAAATAGCTCCTCCTTGCCCCTCTGCAA
TTCTGTAAGGCTTTGGGTCTAATAATCTTATTCCTTCCACAGATCGAGTTATACAAAAAG
ACAAAGGCCCATATTATACACACCTTGGGGCAGGACCAAGTGTTGCTGCTGTCAGGGAAA
TCATGGAGAATAGGTGAGGAGATGTGCTTCCCTGTTAAATCATTCATGATTGCGGATCTG
ACTCAATGCAGAGAATTGTCTCTGGAACAAACATGAGATGAATGGCCTTCAGGAGTATGA
GTTGGATGTTTCTTAGGGCCCAGGAAAAGCTTAGTGTCCTGGTGCCCCTGCTGAGTCACC
CATCACGTGAGCCATTGGGCACTCAACAGGACACAAAGTAAGGCTGTCTTTGTTAAATTC
AGAAATACTTATTTTAATATTGTTGTATGTAGTAGAATAGTTCGAATTATCTTTGTCAAC
ACCGCATTCACATTCCTTTTGCTTGTTTTGGAGCCAGGCCATTTTTTTAACAGTGATCTT
AAAGATAAGTAAACAGAACTGGATAACAAATAAAAATAACTGCCACGCAAAATAAATTTT
TAACAAAAGTAAATTATGAGGAGTATTTGATTTTTGTACTTCTATAAATCTATGTCATAT
GCACATTAAGATGTTAAAAGTGTATGTTGCAATTATTTTCCATTCACTGTGTTTTGTACT
CAGGTATGGTCAAAAAGGAAACGCAGTAAGGATAGAAATAGTAGTGTATACTGGAAAAGA
AGGAAAGAGCTCTCATGGGTGTCCAATTGCTAAGTGGGTAAGTATTTCGTATTTATACAT
TTTTCAAAAGGGATTTATTCTACCTATAAAATAAATAAATTTTTTTCCCATGAAAATGTG
AACTAAAAAAATACCCACTCTTATTATCCCAGGGGAATAATAAGGAAGCTATCTGTCTTA
GCCTGGGCTTTCTATGTTAAATGAACAAAAGGGTATAGCCCTTTCCAGTTGTTACCCAGT
CATCTTCTTCGTCTTCCCAAGGTCACCTCTTTTACCAGTTTCTTGGGTACTTTTAGAGAT
CATTCGATACATTTTATAGTTAGATAGCATAAATAAATGGTACTAACATACAGCTTTGAT
ATCTTACTTTTATCAGTTACTGTATTTTGAAGTTCTTTCTAATTTAGTATGCGTAGGTCT
GGCTTAATGAGGATCAAGTAATATTGAAAGCAAAACCAAATTTTTTACCACATATTCCCA
AAATTGTTCCTGTAACTACTTTGAATTTTCTAAAAATGCAGAGGTATAAGAAGAGAGAAC
TGGATTTGGCTTCCTCAGGAAGTTCTCAACTGAAAAACAGATTAATAGCCAAATGTATAT
TTTCACTAGGATATTCACACCCACAGTTTATTTGGAATTCTTGAGATCCCTGTGATATTA
TTTATTAATAATTATGATGGTCATAATAATAATAAAATAATAAGAATAACAATTGCCTTC
TGTTATATATCAAGCACTATGTTAAGAACTTGACATACATTGGCTCATAAATCCTCACAG
AAGGACTCTATTATGATTCTGGAAAAGGTAAAAGTCATTATTTTCATACCCCTTTCCAAG
AAATTAAAAGCATTAAATGCAAAATGGAGATAGGGCTTGAACACAGGTACTCCTAAAGTA
AGACAATTGCCAGACCCTTGGCTACTGTAGTAGACTAGATGTCTTGGTTACTTTTCCACC
TATCTCCTTTTGCCCTGCATTTATAGAACATGGATTTAATGGCTGAAGTGCCAACAACCA
TCTGGAACCACAAATTGACTTGATAGTGGAAGATGTGTACTAGGTTGGTGGGAAGAAAGA
TAGGAACCTGAGTCCTGATTATTCCAATGGAGTTGTCATGCCAACCCAGGTCTTCTTATA
TCTGGATCTCTTTTTTTTATTTTTTTATTTTTTAGATTGAGAGGGAGAGCTGAAGGGTAG
GGAAGGATCACAATCTGGGTTTTTTTGTTTGGTTTTGGTTTTGCTGAGGAAGACTCCCCC
TGAGCTAACATCTGTTGCCGATCTTCCTCTTTTGGTGTGTGAGCCTCTGCCACAGCATGG
CTGCTGATGAGTGGGATAGGTCCACACCTGGGAACTGAACCCAGGCCGCCACAGCAGAGT
GTGCCAAACTTGACCACTAGGTCACCAAGGCTGGCCCAGATCTGGATTTTTTTAACATGA
GAGACAATTCTTTTTTTATTTGTTTAAAACCTATTACTGGGGTTTTCTGTTATGTGTAGT
AGAATCAAGTCCCAACTAAGATACCTGTCTTCACTTTTTTACGATGTGGGTGAATTTGGG
ATGGAAAAAAAACTATTTCAGAATGAGAAAGGTAAGTGAAGGAACTCATGCTTATTGAGG
TACTTTCCAGTGCCAGGCCCTGGGCTGCATCCTGAGGATACAAACATGGATTACGATCGC
CAATCATTTCATTTTGTGAATGGGAAGAAACAGGCCCAGAGTCACATTAGCCATCTCAGA
CACATTTGAGACTAGGCTTCCTGGCTACAGTTCACTTCGTCCTCTAGTAACGCTAACGTT
TGCTGGGGTCACCTTGCCTCCCAAGAACTAAAGAAAACTTCCTAAAATGCTCCCATAGAC
CTCTAAAACTTTCCCTAAAATTTCTATTGTGTGAATTATTGGGGCAGTTGGGGCATGGTG
GTTGTGAACGGTTGTTTTGTCACTTCCTGGATCACCTTCTTGTCCTGCTATGCGCTGATT
TTCACACTGCCAACTCAGCTGTGAAAGTTGCATACTTTCCTCCATTGCCACAAAACACTC
ACTTGTACAAGTCAATCTCCATGTGTAAGAGTTTTGGTGAAGATACGTTTTAAACAGTAG
CCAGAGTGATCTTTATATTTATATTAATATTTTATTTACTCTTTTGAAAAAGTAATAGTT
GATTCAAAACTTTTTCAAGTAGGAAATTATATAAGGACCACCCATTTTTCTATTAGATTA
TTAGTCTTCTATTGATCTTGTAGGAGCTCCTTTAGAAAATTGACCATTTGTGATAAAAGT
TGCAAATATATTTCCTCAGTTTGTCATTATTTGTGATGTTCATAGTTTTTAAATGAAATT
TTAAATTTCTTAAAAAATTGAAAATATGGAAAATGTCTTCATCTTTTATGGCTTTAGTGT
ATTGTATCTTAATTAGAAAAATATTTACAGCTTCACCTTATAAGTAATTTTCCCATTTTT
CTTTTGGTAGCATTTTAATGATTTCATTTTTCCTGAGTTTGACCATTTTGTGTGTAAAAT
CTTAGTGACAACATATTTCTCCAGATGACGACCAAGTGATCCAATACCACTTACTTAATT
GTTCATCTTTTCCCTACTGATTTATGTTAGTTCATACTAGTAGATTTTCTAATCTGTTAT
GTCAGTGTTACATCTCTCCTCTATCAGCATCAAATTACTCTATTTAGGTTTTATAATATG
TTTTAATATCTGATAGAGCTAATTCCTCCTCCTTTTAGTTTTTCAGAAATTTCCTGACTA
CTCTTGCCTTGTTTATGTTTCCATATGAGTTTATGATCACCTTGTCTAATTGAAGAATAA
AGTCCTGTTGGTATTTTTATTGGAATCATATTACACAGAGAATTTGGAGAATTTATGTAT
TTTTGATGTTAGTCTTCCTATCCTGCTTTCTATACCTTTCTGTTTGCTAAGACTTCTTTT
GTCCCACAGGGGTGCTTAAAATTTTCTTCCCATGGAGTTTACATGTTTCTTGTTTTCCAG
TATAGTTTTCTTGTATATATCAGATGTACAGTCATGTAATCTGTAGTGATGAATTCATAT
TCTCTTTTCCAAATTTTATGCTATTAATTCCTTCCTTTCATTTACTACAGTTAGTCTAAC
AGACAAACCCCAATTTTATACTGCTTTCAGTATGGCCACCTTATCTTGTTTCTCTTTAGT
GAGAACCTTCCAGGGTTTTCTCATTATGAATGGGTCATCAGGGAAGGCCTCTCTGGAAAG
GGAACATTTAGGCTAACAACAGGGTGACCAAAAGGAGCCGAGTATGCCAAGAATAGCCCC
AAGAATGCAGGGAAGAGCCTTCCTAAGCAGAGAAAACAGCAAGTACAAAGTTCAAGGAAG
AGAGTATATACTTTAATGATCTAAGAGGAGTTCAGGGGCCGGCCCTGTGGCACAACAGTT
AAGTTCGCATGTTCCGCTTCTCGGCGGCCCGGGGTTCACCGGTTCGGATCGCGGGTGGGG
ACATGGCACCACTTGGCAAGCCATGCTGTGGTAGGCGGCCCACATATAAAGTAGAGGAAG
ATGGGCACGGAAATTCGCTCAGGGCCAGTCTTCCTCAGCAAAAAAGAGGAGGACTGGCAG
TTAGCTGAGGGCTAATCTTCCTCAAAAGAAAACATAGAGGAGTCCAGTGAAGTTGAGGAA
GTAGAGGGTGGAACCGTGTAAAAAGGTAGGCAGAAACCAGAGCGTGTGTGTCTTTGTAGG
CCATGGTGAGGAGTTTGGGTTTACTCCATGAACAACATGAAGCCTTTGAAGTATTTTAAT
TAGGGATGTGTTATCTATCTTGTTTATGTTTTATAAAGAGCATTCTGAGGAATTAAATGA
TAAAATCTGTATTAGTTACCTGTTGTTACTTAAAAAGTTACTCCAAAATTTAGTAGCTTT
GAAAAACAAACATTTATTATCTCATAGAGTTTTCGTGGGTCTGGAATCTGACAGTTGCTT
CGTAGGGTGCTTCTGGAAGAGGGTCTCTCATGAGGTTGCAGTCATCTGAAGACTTGACTG
GGAACAGTAGGGTGGGGCTGGAGGGTCCACTTCGCAGGGCATATGTAGGAGGTTTTAGTT
CCTCCATGGCTGTTTGCTGGAGGCCTCGCTTCCTTGTCATAGGAATTCTTAAGTGTTTTC
TCATGTCATGGTACGTTGGTTTCCCCCAGAGTGAGTCAATCAAAAGAAAACCAGGAGGAA
GCTACAATGTCTTTTATGATATATTAACCTTGGAAGTTGCTACAAGTGAGCCCTATTCAT
TGTAGGAGGGGGCATGAACATGGCCGCTGGCTTCCCTAGAGTGGGTGATCCAAAAAAGAG
CAAGGTAGCTGGGTTAAATGGTGGGATTTTTGATAATTCTTCCTTCCTGCCTTTCAAACT
TTCCCTCACGTAATAATAATAATTACACTGATAAAATTTTGGTATATACTTCTATTTTTT
TATGAAGACAAATATGAAGTCTGCAACTTAAGGATTTCAGTAGCAACTTTCTGTTAAAGT
CCTATTATTGGTTTAAGTCTTCTTTAAGTGTTCTTAGATACAAAGAAGAGTATTTAACAT
TTTCCATGAAGCAGCTGTAGCAAAATTACTTTTTTATTTTCCCTTTTGCAATATTTCTTT
CAGAATAAATAGAACATTTCAATATATAGTGATATATAGCTGACATTTTTCACAAATACA
AAAACAATCCAGAGATAAGGAATGAAATAAAGCACAGTTGCTAAGCAACTTAACAAAAAT
TTTGATATCTACTAATGACAATTAAGAAGCGTAATCTAGGGGCCGGACCCCTGGGGTGAG
TGGTTAAGTTCACACGCTGTGCTTCGGCCGCCCAGGGTTTTGCCGGTTTGGATCCTGGGC
GCGGACATGGCACCGCTCGTCAGGCCACACTGAGGTGGCGTCCCACATGTCACAACCAGA
GACACTCATAACTAGAATCTACAACTATGTACTGGGGAGCTTTGGGGAGAAGAATTAAAA
AAAAAAGAAAGTGTAATCTCAATAACAAAACCAAGAATTGATCCTTTATATCTGTAAAAA
AGATATCAGTCTCATAAATGATTATATATATTTAAAAAATCATGCTAAAGTTTATTCTTG
CAAACTTTCCAAGTTACCTTATTTAAAATAGTAATGTTGTTCATTAGTGCCTGGAGCAAT
GCCCAGCATATAGTCAGCACTCAATAAATTTTTCTTGAGTGAATGCACATGGAGCTTAAA
TAAGACTATTTTAGAATAGTGAATATTTTGAGTTTGAACTGGTGTCTTGCAAAAGTATTG
CTGTGGTATTCATTGTTCGCTCTTTTCTCAGACATGGGAAACTTTGAGTATTAGAACTAA
TAGTCTGCTAAAGTTGTCCAACCCAAACTTGAACTTTCGATAGAGATTAAATGAAGAGTG
AAAGGATTAGGTCTGTCTATAGTCTACATAGTTTTTAGGACCTCACAAGCAGATTATTTT
GAATGACACTAGGGCAATTAAGTCTTATATATGGATGCTTTATGCAGGAATGAAGTAAAA
GAAGGGCGGGGGAGGAAATGGAGACCATTCATTTTAACCAAGGAATCTAATAAACATTCA
GCCAGTGGAGTGCATTGCTCCAAATTTACTTTTCATCTTGCATGGTGAAAATTTGTCATG
TATTTAATATTAAACATAAATCTAGATCAAACATTGTGTGATTTTATGTACATTTTTTCT
CTCTGTGTGCAGTCTTATGTTTGTTAATAGTGGTTGAATTCTATCCTATTTTCATTGTGC
TGCACTGGCCTCCTTTTCTTGAACGAGAAGTTTATTGCTGCTGTTTTTAATGGTCACACA
CAAAAAAGCTTAACAGCAAATTCTGACTGGGCAGCACCACTTTCTGAGCCGTTCTATTAT
TGTCTTGAAATGTTTCTTGGCCAGGTGGTCATTAGCACCCCCCCCCCCCCAAAATTGTTA
GCCTTTGGCAGGTGTTTCTGACTCTTCTCTGCTGTCACTTTGGATCCTGTCAGGGACTGG
TTGTCTTGTTCTTCCGTCAATTTTGGTGGAAAGGGGGATGGAGTTTCTCAGATGCGCTAG
GCTCTAGTAACCCCCTATACTACTGCCCTCCCCGTGCCCCATTATGTCTTTGGCGTGATG
GTGGGAGGAGGGAGAAGGATTTAAACAACAGGCTGCGGAGGGGCTGGCCTGGTGACATAG
TGGTTAAGTTCATGTGCTCTGCTTCAGCGGCTGGGGGTTGGCATTTTCAGATCCTGGGCA
TGGACCTACACACCGTTCATCAAGCCGTGCTTTGGCTGTGTCCCACATACAAAACAGAGG
GAGATTGGCACAGATATTAGCTCAGTGACAATCTTCCTCAAGCACAATGAGGAAGATTGG
CAACAGATGTTACTTCAGGGCCAGTCTTCCTCACTAGAAAAAGAGAAAAACCAGGTTGCC
TGGATAGCTCCAGTGCCTGACCAATTCATACCAGACACCAGTTCCTGGGTTCCTCTCTGT
AGGACAGTTTATTAATCAGTAGGATAGGTGTGGCAGTGAATAGATACAAGTGAATGTTTT
ATTGCCTCCTATGGTCTGATGTGACCAGAATTTTGGAATGAGGTGTCAACTAAGCTGAAG
TATCCAAAAGTTTTCAAACCATCTCGCCTGGATTTATATAATCTTCAAAAACTTTACTTT
TTTGGTTCCTTTGTTCCACAGTTCTGCCTAATATTTGCCTTGGTTGTCTTTGGGCTGTGT
CCTGGTGCTGGTTATTTCTGTGCCTAAGTTAGGCACCTCTTGTATATTACCATGTCCACC
TACTAATGGGAGTGGGTGGGGCCCTGGGCAGCTTGACTGGTGTCTGCAGTATCTTGCTAA
TGTGAGAAACCATTCTATGCTTCAGGGATCAAAATTAGTTTTTGTTCGTTTATGCACTTA
AAGAGTTCATTTTTTACGGGAATTTTTTATTCAACTATAATATACACAAAGAAAAGTAGG
CAAGTCATAAGTGGACAGCCCAGTGAGGTCTTAGAAAGTGAACACACCCATGTAACCACC
ACCCAGATCAAAAAATAAATTCTTACCAACACTCCAGAACATCCCCCGCCACTTATGTAC
CAAGTCTTTACCTCCCTCCAAAGGTGGAAATTCGTTTTGTTATAATACATAGGTAGCTTT
AAATGATCTTAATTGATGGGTGACTTTTTGTTTTGGTTGGCCACCATCATTTTCTGTTGA
AAATTTAACTCTGCTTTGTCTCTCCCATGATGATTGATAAACTCAAAAGTAATCTCTCTT
TGGTTATATGCCGCACACTTGGTCTGAATGTTGCTTCTGGTTGTGATTCTGTCTGGTCCA
CATCTTGTGGAGCTGATATAGGACCCTGGTAACTATGGCATCATTACAACTAAGGTTGTA
TTACAAGGACTTTTTTTTTTTTTAATAATATAGTTCTGTAATGTTTATATAATTATTAAA
TCTAAATTTTAATTTAACTTGAGTTAAAATTAAATTAAAAATTAAATCAAACTGAAGTAT
CCAAGCTGAAGGTTAAAGCCCTATATTAAATCAAAATTAAATGTTAAATACCTGTTACTT
TCAAATTTACAAAATCTATCTTAATTTTACCCTCTGAGGTAATGATGTTTAGCAGTTTTA
GGTATACCCAAACCAAGAGTTAGCGTGTTAGAACTTTCAATCAAAAGTGATGGACAACCA
CGGAAGCATGTTAAGTAGAAGAGTGACGAGGTCAATATTTTTTGTGGTAAAAACTAATTA
TTCTACAAATTACTAAATTTCAAGAAAGTTTGATTAAATAAACTTTTGACTGTTTTGGAG
CAGAATCTGCTCAAGAGCGTTTGCTCCTCCTGGCAGACTGAAATGGAATAGATAGTGCCA
TTCTTCGTAGGTGGTTTGGACCCAACATTAGAAAGTATACAGAAGGCATCCAAGAACTTG
CTTAATGTAAAAAGGCTGAACAAAGATAAATTCTTGCAAATTCTTAATTTATAATACTTG
GGTTAACAAATCTTTTCATTGTCGTTAAAATTTTTTTTTTAAAGATTGGCACCTGGACTA
ACAACTGTTGCCAATCTTCCTCTTTTTTTTTTTTTAAGGATTGACACCTGGGCTAACAAC
TGTTGGCAATCTTTTTTTTTTTTTTCTTTTCTGCTTTAGCTCCCCAACCCCGCCCTGTAC
ACAGTTGTATATCTTAGTTGCAGGTCCTGCTAGTTGTGGGATGTGGGACGCTGCCTCAAC
GTGGCCTGATGAGCAGTGCCATGTCCGCGCCCAGGATCCGAACCCTGGGCTGCTGCAGCG
GAGCGGGGGAACTTAACCACTCGGCCACGGAGGTGGCCCCTAAAATTTAAATAATCTTAT
GGTGAAATCTACTTTGTTATTGTAAACCTAATAAGTAAAAATTGATATCTTGATTGAACT
TCCTTTTAATGAGTAAAGTTGGTTTTCTTTGTATATTTATTAACCATTTGTATTTCTTCC
ATGAATTCACTCTTCATAACCATTTTTTTGTTTAGGTTAGCTTTTACTTTTGTAAAGAAG
ACTTCCATCATATAGTCTGCCTTTGTCTAATACTGGATTTTCTTTTGACCTTTGTGCTTG
TCTGTTATCTTTGTACAGAAGCTTGAAATTCTTAGCAGGTTAAATCTATGTCACTTCCTA
TATTTCTTCAGAGGTTTTTCATCCTAATAAGGAAGGCTTTCCCATCCTAATATTATAAAA
ATAGTGTTTCCCCAAGTTTTTATAATTTTAGGTATAAATCCAGTAGTTAATTTGAAATAT
TTTTCATTGATTTAAAATTCCACTCCATTTTCCACATGTCCATTTTTGTTGAAATTGTTC
ATTAACCCATTAGAGTAGAATGTTGCTAGGCTAGAACTACATTTTTTTGCTGTAGCTTTA
AAGAAAAATTTTATTATTAATTAATTAATTAATTAATTTTTTTGAGGAAGACTAGCCCTG
AGCTAACATCTGCTGCCAATCCTCCTCTTTTTGCTGAGGAAGACTGGCCCTAAGCTAACA
TCCATGCCCATCTTCCTCTACTTTATATGCAGGACACCTACCACAGCATGGCTTTTGTCA
AGCGGTGCCATGTCCGCGCCCGGGATCCGAACCAACGAGCCCCGGGCCACCAAATCAGAA
CGTGAGCACTTAACCGATGCGCCACCAGGCTGGCCCCTAAGGAAAAAATTTTAAATTTAG
AACGACAATTCCCTCTTGTTTGTTTAAAACATATTTTCCTTTTTTTTTTTATTGAGTTCA
TGATAGTCTACATCATTGTGAAATTTCAGTTGTACGTATTCCTTGTCTGTCACCACAGAA
GTGCTCCTTCACCCCCTGTGCCCAAGCCCCACCCCCCTTCCCTTGGTAACCATTGAACTC
TTTTCTTTTCTTTTCTTTTTTTAAAGATTGACACCTGAGCTAACAACTGTTGCCAATCTT
CCTTTTTTTCTTTTCCTGCTTTTTCTCCCCAAATCCCCCCAATACATAGTTATATATTTT
AATTATGGATCCTTCTAGTTGTGGCATGTGGGACGCTGCCTCAGCATGGCTTGATGAGTG
GTGCCATGTCCAGGCCCAGGATCCGAACCAGCAAAACCCTGGGCCGCTGAAGCAGAGGAT
GTGAACTTAACCACTCAGCCATGGGGCCGGCCCCTGAACTCTTTTCTTTGTCCATGTGTT
TGTTTATATTCCACATATGAGTGAAATCATCTGGTGTTTGTCTTTCTCAGTCTGGCTTAT
TTTTACTTAGCGTAATTCCCTCCAGCTCCATCCATGTGGTTGCAAATGGGATGATTTTGT
CTTTTTTTATGGCTGACTAGTATTCCATTGTGTATATATACCACATCTTCTTTATCCAAT
CATCACATGATGGGCACTTGGATTGTTTCCATGTCTTGACTATTGTGAATAGTGCTGCAA
TGAACATAGGGGTACATATGTTACTTTAGATTGTTGAAAAAAATCTTTTTCTTGATTTGA
TATTCGTTTGCTCTTCAATATGAACCTCAGAAACAAGCTAAATATGTAGAATGGGGTATA
TGCTGCTGGCTAGAATCAATATCTTTTAAACATGTCTAGCCTTTCATCTAGGAACACTAT
TATGTTCCTCCAACTGTGCTTTCTTCTATATCTTTCTTTTCATATTTTTTATAGTTTTAT
TGTGTGTTTTACATCTTTCTTTTTTTAACAGCTTTGTTGAGATGTTAGTTACATGCACTT
TCCTTAAGATAATCCTTACTGCTATGTTTAAATTCAAGCTTTAAACCAAATTTCTATTTA
GTTATTGCTGGTATATATTAAAGCTGTTGAGTCTTCGATATTTATAAGGAACCACCTGTT
TTACTCTCTTTAAAAATTTAGTCGATCTTTCTTTGATTCTCTTGAATTTTCTAGAGAAAC
TATTATGTCTTTAAAAAATAGTTGTGTCTTCCAATTTTAATACCACTTGTTTATTTTTTA
ATCACATTGTCTTTTGGATCTAAATTCTCACCTTTCCTCCTAGTATTCAAAAACAATAGT
TTGATTAGCCTTTCCATGGTTCGTATATCTGCAGGTACCAGCAAACATCAAAGTAGTAAT
TCTGATCCAACAAACAAAATGCTGTGTTTCCAAAGGAACAATTAGAAAGTCTATATACTA
GCAGGGGAAATTAGTGATTACAGTGGAAAAATAATGAAATGCCAGTGTAGTATTCATTGG
CACTATGAATCGTTTGTTTTGAACAAACAAAACAAGAATGTATATACATCTAAGATTCTT
CTCTGATTTTTGGAAGTGGGGGTATTCGAACGCTGTTTAAATACTTCATTTTTCTATTGC
CTACATAAATATAATATAACTAGAAGCCAAATTTGCCTGATGTAGTAGAAACCTCTCTTG
GTCTTTGAGTTTTTTCTTTCCATGCCCTAAGAATATAAAAATACTATTACCCACAGTTGC
CTCCTTATAAATTGCATTAGTAACTTTGTTTCTCAGAACAATCTTCTCTTCTCTCTCCAC
CAGTTTTTATATGCTTAGTAATGAGTGGCCTTAAAGCACTCTAGACTGCCAGAGGTTATT
TGGAATATCCCAAGTTATCACTCTTGATCCTGGTCTCACTTGCCTTAAGAACTCCCCATG
GGGAATTTCAATAGGTTATTCCATCCAGACCAGGTTATCAGAAATAGTTTAGAATTTACT
TTTCAGAACTATTCATAAACAGGCTGTTGAAGGAGAATAATTTATAACCCAGGATAAGGA
GACTGTCACAGAATTGCTAGAAAATCTTTTCCTAATGATCATCAGATTGATCTGTCTTCT
ATCTTCAATTTTTCTCTGAAAGTCCTATTCTAACAGTCACCAATATCGCAACTGCCAAAG
AGAAGTTTAGGTCCTGATACCCTTTCCTCAGCAGTTGAAATTATTGGTTACGCTACCTCT
TCTGGAAAGTCCATTTTTTCCTTGGCTTCTGTAACGCAACTTTCCCCCATCACTCCTCAG
CTCTTCAGTTAGCCTGTCTGTAATATGCCTTCCTAGGTGAGCTTATTCATGGTCACACCT
TGAGCAGTCACCAATGTGCTAGCTACTGTGAAACCCTACCATTTGCCTGCTTGAGAATGG
CACACAGAGGGAGCATGGAGGAAAACAAGAATAACGTTTGGAGATGTGAGGATCCGGGAG
GGGCTCTGGGGAGATCTTGACCTTTGAGCTACATCTTAAAAACAGAGCAAGCATTATCTT
TATGTCAGAGATCCCAGAAATAGAACCACCTGTGTATAATAATTAAAGAAATAGAATTTT
ATAATCACAGAAGCCATCTTGTCAACTGTTCATACAATTGGCCGAAATTCTTCCTTAAGT
AGGATCCTTGCTTCATGAAGCTTATTTTCCAAAAACCTCAGAATTACCTTTGTACTGTCT
GTTCTCTGGTGGCAAACTCTTGTTTCAGTCCCTTAAGAAGGGTCTCCTCTGTGAAGCCTT
CCCACTCTCTCCAAACAAGGAGTCTGGCCCTACTTTGTACCCTTATTCATACAAACCCAT
CCCAAATTTCTTATATTTCCCCCAACAAAATTACAATAGAAAAATGCATTGCTAATATTT
TCCCCATTACTGTACATTCAATTTAGTGTTTGTGTCATTTCACTTAGAGTATTACTTAAT
CAGCTTCCCAGGGGATTACAAACAATTTGTGGCATATCATAATTAGAAAAAATGTCTCTT
TGCCAACTTGACAGTATTTTGGGCTTGGCTACTAATTACTTTATCAAAATTCAATTCTTA
TTAATGTACATTAATTCATTTCAGATGTTAGCTAAGCCTTAATATACACTGAATATTTGT
TGTCCTACAGATTGAGTTTAACTGAAGAGAGAGACTTTTTCTTTTTAAAATTTCCCCATT
GTTCATTCCTCAGGTTATGCAAGGACTTACTCTTTGCTCTTCTTACATTGTTTCTGACAG
TGGCCTGTTTCTTAAATCTCTGGAGTTGGTACTTTCCATCCAGAGATCTGCCTGGAGCTG
GTCTCCTGAGCTGTGACCCCACCGATCCAGTGAGGCTTCCATTACTGAGGGCCGTGAGCA
CTTGAGTCCCAAGCTTGCACTGAGAATAAAATACATTGTGTCCCAAAACTTGGCCAAGTT
TTAGTCAATCATGTTTTCTTTCGCCCTTTATTTTTTTTAAATTAGCGAGTTATAATTAAC
ATGGAATGAAATATACTGTTAGCAAGTACACAGTTGGATCAGTTTTGACAAATAAGGGTG
TCATTGGCTAACGCTGATGGTTCTTGGGCTCTGCTTTCCGTATATTTGTTAAATATCTCA
TGTTAAGTTTCACTGGAACTCATCACCTGATTGTTTTATTCCATCCCCATGGGACAATTA
TTACCCATGAATTTTGAAGTGTTGTCTTACTTCTGCACAAAATAGAAGACTTTTCTACAA
ACAGATTTGCTGCTTCTCCTCAAATTGGTGCTGAAACCAGGCTCTTTTGACACTTTTTGC
TCATTAATTATCAGCTACTTTCAAACTTGAAAGAATAAGATCTTCATTTCTCTGAATTTG
GTTGCAGCCGTATTTTTTTCCCCTCATATTTGCTTGTTGTTTATTTCTCTAGAAATTATA
GGAGGGAGATATGACTAGATATCACCTTAATATCTACCCAGAACTCTTCTGTTCAAATAA
TTTTAATGATAGATTGAGTGAAAATAGCAGAAAGCAGTATTTAAATGTTGCAAGAAATGT
AGAAATATTAAGAATGATAGTGATACAATGGACTTAAAAATTTTTTTGGAGTAGAGATTT
TAATCAGAACAGTTATATCTAAAACCTTAATTAATGACAATGACTTATTTTCTGTTGTTG
AAATCCAGCCTCATTTTCTCTGTGATTTGGAGTATTAGAGTGTAGTGGACACAGGAATAA
ATATTAAGTAGTTTCTCAGCATCATCTCTAAATTTATGAGTGTCCTGTCTTCAGTTAACA
GTACATGGATATGTTGGAATAGCCAAAACAATCTTGAGAAAAAAGAATAAAGTTGGAGGA
CTCACACTGCTCAATTTTAAAATGTATTACAGTGGGCCGGCCCCATGGCCGAGTGGTTAA
GTTCAAGCGCTCTGCTTCAGCGGGCCAGGGTTTCACCAGTGCAGATCCTGGGCGTGGACA
TGGCAACACTCATCAGGCCATGCTGAGGCGGCATCCCACATGGCACAACCAGAGGCACTC
ACAACCAGAATATACAACTATGTACTGGGGTCTTTGGGGAGAAGAAGAAAAAAAAAGGAT
TTGCAACAGATGTTAGCTCAGGTGCCAATCTTTACAAAAATTAAATTAAATTAAAATGTA
CTACAAAGCTACAGTAATCAAGAAAGTGTAGCTCTTGCATAAGACTAGATATACAGATCA
TTGGAATAGAACTGTGTGTCAAGAAATAAGCCCTCACACTTATGTGTGGTCAATTGATTT
TCAACAAGAATTCTAAGACTATTCCTTGGGGAAAGAATAGTCTATTCAGCAAAAGGTGCT
GGGACAACTGGGTAGCAACATACAAAAGAGTGAAACTGGACCCCTACCACATACAAAAAT
TAATTCAAAATGGATCATTGATCCAAATATCAGAGTTAAAACTATGAAATTTTTAGACAA
AAACATAGCTGTAAATCTTCGTGAGTTTGGATTACACATTTTTTTTCTTAGATAAAACAC
AAGCACAAAAGAAAAAAAGATAAATTGGAGTTCATCAAAATTTAAAACTTTTGCTTCAAA
AGGCTCTATCAAGAAAGGTTAGAGAGGGGCTGGCCTCATGGCCGAGTGGTTAAGTTCATG
CATTCCACTGCGGTGGCCCAGGGTTTTGCCGGTTCAGATCCTGGGTGCAGACATGGCACC
GCTCATCAGGCCACGCTGAGGCAGCATCCAACATGCCACAACTAGATGGACCCACAACTA
AGAATATACAACTATGTACCGGGGGACTTTGGGGAGAAAAAGGAAAAAAAAAATCTTTAA
AGAAGAAAGATTAGAGAAAGCCAAGAAAGGGAGAAAATACTTGCTAATCAAATATCTGTT
AAGGGGCTTATATGTGGAATATAAAAAGAACTCATAGGGGTGTGCTCAGAGCAGGGGGCC
TGAAGAAATGACTCCTCTGTTTAAAACACACCCAACAGGAATCTGGGTTCATTGTGACAA
GGGTCACAAATCTTGTGGTCTCCCTATGAACAAATGCCCTACACATAGAAAAAAAAAAAA
AGAACTCCTCTATTTTAATAATAAAAGGACAATCCAAACTGAAAATTGACAGTGTATTTG
AATAGACCTTTTCCAGACAAGATATACAGATGACCAATAAGCACATGAAATTATGTGCAA
CATTATTAGTCATTAGGAAAACGCAAATCAAAATCAGAGTGAGATACCACTTTACACTAG
GATGGCTAAAACCAAAAGGATAGACAATAGCAAGTATTGACAAGGATGTAGAGAAATTAG
AATCCTGTACATTCCTAGAGGGAATGTAAAATGTTTCCTCTGCTTTGGAAGACAGTCTGG
TAGTTCCCTAAAAGGATAAACATAGTTATCATACAACAAAGCAATTCCACTCCTAGGTAT
ATACCTAAGAGAAATGAAAACATGTCTACCAGAAACTTGTTACATGAATGTTCATAGCAG
CATCAATCATAGCAAAAGTGGAAACAATCCCAATGGTAATCAACCAAAGAAAGGCTAAAC
ATACAGTGGTATGTCCACGCACTGGAATTTTATTTGGCAATAAAATGGAATGAAGTTACT
GATAAGTGCTACAAATATAAATTAACATTATGCTGAGTAAAAGAAGCCAGACACAAAAGG
CCGCATGTTATAGGATTCCATTTGTATGAAATGTCCCAAATAAGCAAAATACATGAGAGG
TGGAAATATATAAAATACAAAATACATAAAAGATAGAAAGGTGGGTTAGTGAGTGATGGG
AGCTGAGAAGAAGGAGAAATGTGGCATGACGGCTAATAATAGGATTTTCTTTTGGGCAAT
GAAAATATTTTAAAATCATACAGTGGTAATTGTAGGCCATATCTGTGACTATGCTAATAA
CCACTGAATTGCGTATGTTAAAAGAATGAATTTTATGATATTTAAATTCTATTTCAGTAA
AGCTGATATCAAAAGACAAAAGCATTGTATTTGTGAAAACCATTTGTTTTTCATTCCAGC
ATTATTCAATTTGGGGTATGTTTTTAGCACAGATACTAAAAGAATGTCTGTATGATTTTT
CATAGGATATAACAACCTCATAATATGTAATATAAATTATTAGAATAATATTTAAAAACG
ACAGGACATTAGTCATGAATATTACTCACACAAGTTTGGGTACACCATTTACCATCTAAA
GTGACTGCCATGTGGCCCCAGGTTCAACAGCTTACAAATTAATGCATCCTTCCAGTTACA
AAATAATGTGATTCTTGACACAAGTTTTAAAATTTGGAATATTTGTACCATTTAAAATCT
GTTTCTGAAATAGGATTTTACCTCTTATTAATAGTGTAACTTGTAGTTTGTGAAATGTTC
ATAAAATGCAACCACATTGGGTTTTTGTGGTTTTCAACCATTCATTCAACAAATATTTGA
TGAGAACCTCCCATGAACTGAGTTCTGTGCTCAGGAGCCAAGTTTGCAGTAATAAAGCAA
GAGACATAATATAGTGGCTAAACTTAGATCCTTGCTCTGTGCTACTATAGAAAGGTTAAG
AAACTTGCTAAAATGTCCTGAGCCAGTAAATGACTAACCAGTTTCTATTTTTTGTTCTTG
GTATAGATTAAGGTGTACTTTTTGTTTAACTATAACATATGTGCAGAAGACTACAGAAAT
CCTAAGCTGGCAAAATTTTTCTATAGGGAACACACTCGTAACCAGCATCCAATATTAGTA
GCACCTCAGTATCATCCTTGTTTTTTTTTTTTTGGTGAGGAGGATTAGCCTTGATCTAAC
ATCTGTGCCAGTATTCCTCTATTTTGTATGTGGGTCACTGCCACAGCATGCCTTGAAAGG
TGGTATAGGTCCACACCCCAGATCCGGGCCACAAACCCTGGCTGCCAAAGCAGAGCATGC
TGGACCTAACCACTGTGCTGTGAGGCTGGCCCGGTCGCACTCTTCTTACCCCCTTTCAGT
CACTAGCTACCCCCAAAAGTAACTGCTCTCCTGCCTTGTAACATTACAGACTAATCTTGC
CTGATTTGAAATTTATATAAATGCAGTCTTACAGTATATATTCTTTTATTTTCTTTTTCA
TTTTAGACATCCTACTGGATGTGTAGTGCTTTTTTTAAGACCTTTTCCTGTTTTTTTTTT
TCACTTTAAAATAACAGTAATATAAAGTTTACTGTGTTAACCTTTTTTTTTTTTTTTTTT
TGAGGAAGATTAGCCCTGAGCTAACTGCTGCCAACCCTCTTTTCGCTGAGGAAGACTGGC
CCTGAGCTAACATCTGTGCCCATCTTCCTCTACTTTCTATGTGGGATGCCTACCACAGCA
TGGCATGCCAAGTGGTGACATGTCCGTACCCAAGATCCCAACCAGCGAACCATGGGCCAC
CGAAGCGGAACGTGCACACTTAACTGCTGTGCCACTGGGCTGGCCCCCCCATCTTAACCC
TTTTAAGTGTACAGTTCAATAATGTTACGTATTTTCACATTGCTGTGAAACAGATCTCTA
GAACTTTTTTTTCTTGCACATCTTTAACTCTATACCCATTAAATATCTCCTCATTTTCCC
ATCTCCCCAGCCCCTGGTAACTAGCATTCTACTTAAGTTTCTAGAATTTGACTACTTTAG
GCACGTTGTATAAGTGGAATCATTCTCTTTTTGAGATTAGCCTATTTTACTTAGCATGTG
TCCTCAAGGTTCATCCATGTTGTAGCATATGGCAAGATTTCCTTCCTTTTTAAGGCTGCA
TAATATTCCCTTGTGTGTATTTGTCACATTTTGTTTATCCATTCATATGTCAGTGGACAT
TTGGATTGCTTCCACATCTTGGCTATTGTGAATAGTGATGCTGTGAATGTGGATCTGCAA
ATATCTGTTCAAGATCCTGCTTTCAATTCTTTTGCATAAGTATGTATTCAGAATTGAGAT
TGCTGGATCATATGGTAGCTCTATTTTTAATGTTTTGAGGAACTTGTGTACTATTTTCCA
TAGCAGTTGCACCATTTTATAACCCCACCAACATTTGTAGTGTTTAAAATTATTTTTTAC
TTTGCTAGATGACTAATAATGTTGAGCATATTTTCATATGCTCATCATCTGTTTAGATAC
TCCCTTGTGTTGAGCCTATTCACGTTTTTTTGGCCAACTTTCTGTTGTGTTTTTATTACT
TATTTGCAGAAGTTCTTTATATATTTTGGGTAAGAATATTTTGCCAATTCTATGTATTGC
AAATATTTCTCCCACTGTATTCTTGCCTTTAAGTACTTTCTTAATGTTTTGCTGGTTAAC
GTTTTTGATGAATAGAGTTCTTAATTTTAATATAATCCAACTTAACTTTTTCCCTTATAA
TTATTAAACTTGGTAATCTACTTTAAAGAGTATTACCAGCTCTGAGGTCATGAAGATGTT
TTCTTCTGAAAACTTATTATTTTATCTTTCGTATTTATATCTACAATACAACTCAAATTA
CTTGTATGAAGTAGGAATCAGGATTCATTTTTTTTCCATATGGATATCTACACAGTACCA
TTTATTGAAAAGACTACTTTTTGCATTGCACTGCAATGTCAACTTTGTCACAAGTCAGGT
GACCATATTCATATGGATCTGCACTGTCTATTCTATTTCATTGATCTCTTTTTTTCCGAG
GAAGACTGGCCCTGAGCTAAGATCCGTGCCCATCCTCCTCCCCTTTATACGTGGGATGCC
TACCACAGCATGGCGTACCAAGCAGTGCCATGTCTGTACCCGGGATCCGAACCGGCGAAC
CCCAGGCCGCCAAAGTGAAACGTGCGCCCTTAACTGCTGCACCACCGGGCCAGCCCCCTC
ATTGATCTCTTTATTATTGCACCAATACTAGACTATTCTTAATCACTATAGCTTTCCAAT
AGATCTTGATATCTGGTAAATCACTTTCTCTGTCTTTATTCCTTTTCTTGCCTCTTCTTG
TTCCTTTGTGTTTCCATATAAACTTTGGTTCAAGTCTGTCAATTTCCACCTAAAAGAACA
CAAACTCTGCTAGGATTTTGATTGGGATTGCATCAAATCTAGAAATCAATTGGGAAAATT
GACATCATTATAATAATGACTATTCTGTGAACATGATATCTTTCTCCATTTATTTAGGTC
TTCTTTAATTTCTGTCAATAATGTTTTTATGGTTTTCAGAGGTCTTGCACGGGTTTAATA
CTTGTCTTACTGCATTTAGACTGCTGTGAGAAAATACCAGACTCGCTGACTTATTAACAA
AAGAAATTTTTTTCTCCCAGTTCTGAAGTTTGGAAATCTGAGATCAGGGTGCCAGCATGC
TCAGGTGGGGGCCCTGTTTTCTTGTGTCTTCACTTGGTAGAAGAGACTAGCAAGCTCTAT
GGGGTCTCTTATAAAAACATTAATCCAAATCAATTGTACTTCCCCATTGTGAACGAATCA
TCTCCCAAAGGCCCCACCTGCTAATACCATCGCATTGGGATTTAGAATTTAATCTATGAA
TTTTGGGTGGACACAAATATCCATGTCTTAGCAATGCTTAAGCAGCTTTTTGAACCTGGA
ACTGAATTTAGAGACTCGTCATGCTTAATTTTCTATTGTTCACTGAAGGAAATTTGGAAA
ATCTGGAAAAACAAATACTATGAATAAACAGCATTTTAACATTTCCCGTACAAAAACTGG
ATCAATACAACTCTGTTGTTGGTTTGACAACTTGGACATTATCTTGCATAACTTTACTTG
ATACAATATATATCATTTTGTATTTGAGCTTATTTGAAAGCAAAATGTATTCTTATTTGG
CTGTAAAAGGACATATAAATATAGAAAAAGATTTTAATATAAATAATTGTGTTTAGGGGG
AAGGTCCTAAAGCCAACTCTACTCAAGGGATGCCTGGGTAGCAATGAGTGTTAACCATCT
GGAGTGACTGAAGAAAGTGATATTGGGTAACTAACATCTTAAGAAGTTTCGTCTCAAGTT
TATGTAATTATTGTAGCATCAAAAATGGAACATTAATTATGCTATTGGTTGCTCCATTTT
GGTCACAGGGTGGGCAGTTTTATAATTTACTAATTATGTACTGATTAATGTGGTCAGGCT
CTCTGCTTTGTAAATTTGTGATACATGGAAGGAGTTTTAAACAGAGTTGGATAGTTTTAT
GTGGTATCAACGGTTTTATGTAATTTTTAAAATAAATACCAGGACCACTGTGCAATATTT
TAAATACTTTTGAAGACTTTTTAGCACTCTATCCGTATGATTCAGTATAAGATAAATGGA
TAAATATTCAAAATTAATTGTTGTGTTTTGCATTCACCATGTCAGCTGGACCACCTTAAT
CTTAGGATAAAGTGGGTATGAGAAATCCTGTGATAGCATGGAAAAATCACAGGAATTGCA
GGAATATTGCTTTATATATTAATTATTCTCTGTAGTAAAACCATTTGCCCAAGGAAAAGA
TCCATAACTTTCCTCAGATGCTAAATTTCAGTGCTCAAGTTTATTTTGAATGTTGGGAGT
CCTTGGTTATTTCCATGTAGCTGGATTTGTCCTATTGTGACATTTGTTGAAGGGCAGAGC
AGTTAGCTAGGCTCTTTTCCACGAGATCCTCTGTTGTCTATTTTGCAATGCTGTCTCAAC
AGTGAAATTAAACACAGACTACTTTTACAAATAATAAGCACATACCACAGATTTCTGTTC
AGCCTGTTGTTTCTTGGTCAAGTAAACTGGGATACTCTGTGATGAGTTGTGTGAAGGCAG
CTAGTCTGACATATGAAGGTCCTATAGGCTTCAACCCTTTGAGAAATAATAATTTTTTAA
AAAGTAAAATGGAATGATACAGAGCTTTAAAAGCAATATCCATTGCATTTGACTTTAGGT
TTCTTGTTTTCCATAAATGAATGCATTCTGCTTTTGCAGGTTTTAAGAAGAAGCAGTGAT
GAGGAGAAAGTTCTTTGTCTGGTTCGGCAGCGTACAGGTCACCACTGTCCCACTGCCGTG
ATGGTGGTGCTCATCATGGTATGGGATGGCATTCCTCTCCCGATGGCTGACAGATTGTAC
ACGGAGCTTACTGAAAATCTAAAGTCATACAATGGTCATCCCACAGACCGAAGATGCACT
CTCAATGAAAAGTAATCAGATCTGTTTTGTACTGCTTTGCTGTTCCAACTTCTATTATAT
AATATTAAATTGTTGATTTTTAACTGCCAACAACTACATATAGTACATGGTGAACAGGAT
TTTAGGTATTGTGCAACTAAAAAGCATGAACATTTCTTTAAAGAGAGATTTGGCTTCATG
GTGAGTTAGGACCATCCTAGCATATTTTCCTTTAGGATGTTCGTTTTTTGCTTGTTTGAT
GCTTGATCCCACTCACCCCTAGAGTCTAGAGCAAAGGGATTTTTCTGTAAGGGAAAAGCT
CCTACACAGGGAATTGTAGCATTTTGCATTCATCTAGCAATGTAAGAGAATATCTGTTTT
TCTGTGGTTTTGCCAGTGAATATGTTGTCAAACTTGAGCTTTTGCCTAATTAGCGATAAA
TGGCATCATTTTACTTTTGATTTGCATTTTTCATATTAAGAGTGAGAGTATTTTTTCATA
TGCTTATGAGCCATTTGCTATTCTTTTTTGGTTTTTCGTCAGCCATCTGTTAATTATTCT
AGCCCATATTTTTAAAAGATTGTTCACCTTTTTTTACCTTACATATTGGGGCTGTTAACC
CTTTGTGATATAATTTCTAAATGCTTTTGACAGTTTGATATTTATCTTTTTACTTTTGCT
ATGTCATCTTTGCAAAAGTTTTCTTTTTTAATGTAATTAATTATATCTATCTTCCCACTT
ATTTGTGTCTGGGTTTTGAGTAGTATTTAAGAACATTTTCTCTCCTGCAAGTTATAGAGT
AATTCACCTGTGTTTTCTTTTAGTACTTGTTGAAATTGTAAATTTTTGAAAACAGAAATC
TCTGATGTATTTAAAATTTATGCTTGTCAGGGGCCGGCCTGGTGACGGCTGGTGACACAT
CGGTTAAGTTCGCACGTTCCACTTGTCGGTGGCCTGGGGTTTGTGGGTTCGGATCCTGGG
TGCGGACATGGCACTGCATGGCTTTTGCCATGCTTTGCTAGGCGTCCCACATATAAAGTA
GAGGAAGATTGGCATGAATGTTAGCTCAGGGCCAGTCTTCCTCAGCAAAAAGAGGAGGAT
TGACAGTAGTTAGTTCAGGGCTAATCTTCCTCAAAAAAAACCAAAAAAATTTATGCTGGT
CAATAGTGGGAAGAGGAGATCCATTTCTATCCTTTCTTCCATTTATTCCAACACTGCTTG
GTAAAGAGTACTTCTTTTCCTCTTAATCTGGAATACTACTTAACTGTTCACAAAAATTAT
ATATGTAAGTGATTCCTCTCTTATATTTGAATTCTGTATCATCTTCCTGGCTTTTCAGGC
ACTAGAACCTCATTTTTTCAATTAAAGGGGCTTTATAATTTATTTTAATATTTGGTGAGG
CTAACTGGCCATTCTTGTTTTTTTCCAAGTCTTTCTTTGTTATTCTTTTTTGTTCATGCT
TCCAAATAAACTTTATAATCAATTTATCTAGTTTTAAGATAAACCTAATGATATTTTTAA
TGGGATTGCATTAAATTATCTTATAATGACCTGGTGTCTTTAAGATATTGGGTCTTTCTA
TCCCATAACACGTCTTTTTTCTATTTGTTCAAGTGTAGTTTTCCTCATATAGGTTTCTCT
TTTTTTCAAGAAATGTCGTTATACAAAATATAACAAAAATATATTTCATCTCCTCTCTAG
TCTGCACATAAGATTAATTTGTATACCTTCCAGAGCATTCCTTTATGCTTAGAATACCAT
TTCATTGTATTTTTCTTATCTTTCCAATGCCAGAAAGTGTGTATACATCATTTTTAAAGT
CTGCTAATTATTTTATGTGGATGCACAATAATAATAATACCTCTTGTATGAAGACATTAC
AGGATATCCATATATTATCTTATTTAATCTTCCCAAGAATCTAATAACTTGTTTTAATGT
TTCATCAAGGTAGATCTAGCATAGGCTTTTTTTTAAAGTTCCTATCTACAGAAAAGATGC
AAGAATACTTCAGTGAACTCTTATATACACGTTACCTAGATTCCACAGTTGTTAACACTG
TTACGTTTGCATTTCTAGACATAGTCACACATACATACAAACTTACATATTATTGCGTTT
TTATTTTTTTCTTTCTGGATTATTTGTGAGATAGTTGCAGACTTTGTCTTTTTCCCCTAA
ATACTACTTCGGATGGTATTTTCTAAGAATCAGGACATTCTATTACATAACTCCAGTACA
ATGATCAAAGTCAAGAAATTTAACTTTGATAAAGTGCTATTATCTAATCTATAATTCATA
TTCAGATATCATCTATTTCCTAATACTATACTTTATAGTAATTTTCCTCCACCCAGGATT
CGATGGGTTGTGTTGTTTTGTCCTTTTGTTCTCCTAATCCTTTTATCTCAATCTTTGTCT
TTCATGGCATTGACATTTCTGAAGGGAACAGGATAATTTTGGAGATTGTAACTCAATTTT
GGTTTGTCTGATTGTTTTTTCCTGATTCCACTCAGTTCTAGCAATTATTGGCAGGAACAC
TACACTGAGTCCATGGCATTAGGACATGTTTTAGGTCCATTTGTCCCATTATCAGTGATA
TTAACAGTTTAAGATACTCTGCGGGAGGTCTTTTAGTTCTCACAATTTTTCTCCTTTCCT
ATGTGTTTAATTTTTTAAATAACTGTCCATAGTTAAACTACATTTTTCGCTTTCCCATGT
ATTATTTCAACGACATAAATAAATTACTAATTTTTCTATTTCTTTGACAACTTTAATTTC
CTTCTGCAATTTCAAATTTAACTCCTTTGATCCCATTTGCATCCCATTTTTCTTCTCCAT
CAACTTATTGTAATATTTTGCCCTTTAAAACATATATTCCATCTTTTTCAGAAGATTTAT
AGGGAGTTAGAATATTTGAACTATCCCTCCTCCCTTTTTCTTCCTTCATAGTATCTTGAA
TGATCCTTTTGTATTCAATGTTATCTTACATATCAAGCATTTTCCAGACTTTCACAATTA
AAAAAAACTAATAGTTTTGATCTCTAAATTTCTGTTCTTTTCATTTACTATTTTTTTAAA
ATGTGAGATTTTATTCATATTTTTAAGTCATTACATAAGTACTTCATACATAGAATTAGA
AATTTTGAGCATTAATGTAGTCACCAGAAGAGCAGACTTATTTCCTTGGTTTCATATCTT
TGTGTATATATTCTAATCATCATCATCTTCACTTAGAGTCTATTTAGGGCCTCAGAAATG
CCCCCCAAGTGATAAAATTATCAAGTTACCGATTGAAACAGGTTTTCTGATCAATTTTTT
CTCTTGTGACGTTCATAAAGACTTTCTTTAAAATTGACAAAGTGAGGGACTGGCCCAGTG
GCATAGTGATTGAGTTCATGTGCTCTGTTTTGGCAGCCCAGGGTTTGCAGGTTTAGATCC
TGGGTGCAGACCCTGCTCTGCTTGTCAAGCCACGCTATGGCAGCATCCCACATTAAAAAA
AAATAGAGGAAGATTGGCACAGATGTTAGCTTAGTGCCAGTCTTCCTCACACACACACAC
AAAAGTCACGAAAAAGTTGACCTATCTCATGCAATATATATTATCCTTTATCAATTCTCA
GAAGATTGTATCAATGTCATTTTACTGATGAAGCAGCTGAAGTCCAAAGAGGTAATGAGG
TGCTCTAATTTTTCTTGCTAATAGGGAACAGATCCAGGATTTAAAATCCAGACCCTTTTT
TCCCCTCCTTGGACATCTCCAAATCCAACAAGGTCATGGAGATTTCAGATCTGTATAGTT
TATTGCCATTTATTTGGATTTACAGTTGTGAACAAACATTTTAGTTAAAAATTTAGTTAT
ATTCAAGTACAGTGAGCCTTGTGTTAACATAACACTACTTTAGATAATATAAGTAATAAG
ATAGATATGTTAAAATCACTTCCTGAAATGTTCTGTCTGAGGTATTGTCTGCTTTATCAG
TTCATTCCTTGCAATTACCATCTTACAGTCGTACCTGTACATGTCAAGGAATTGATCCAG
AGACTTGTGGAGCTTCATTCTCTTTTGGCTGTTCATGGAGTATGTATTTCAATGGCTGCA
AATTTGGTAGAAGCCCAAGCCCTAGAAGATTTAGAATTGATCCGAGCTCTCCCTTACACG
TAAGTGTCCTTTTTACTTTTGAATTACACAATAAGTATATAAGTACATTCCTTTAAAATT
TTTTAAATAGTAAAAAACATTAAATATTAAAAAGTAGTGACAAAATAGTAAAACTATATA
TATAAGTAAATAGTTTAAAATTCTAAATAAATTAGGTAAAGTCTTCAACTATCAACCCAG
ATTCCGATTGTCCCTGGCTCCTTCCTCCTCCTCCCCTAACCCCAGAGAGAATCATTGTTA
AAGGAAACTAGAATTTTATACCCAGCCAAAGTAGGAAGAATAAATAAACGAATTTGCCAA
CATTTCAAAGACTCAGAAAGTTTACTACCCACAGAACTACTATGAAAGAATTACTAAAGG
ACGTAATCCAGAAAGAAGATATATGAAACCGGAACCAATCTGTCCGGGACACGAGGCCAT
GGTGAGCAAAGAAATTAGTCAACCTTACTGTTAAGTTTAAATAAGTTGAGTACTTACATT
TTTTAATTAAAATAACAACCTATAAGTGTAATTCCTTACTCTTATCAACTCAGGGGTGGG
TAGGCAATGGGAGGAGGTGGGGCACCTACAGGAACTAAGTGTGGTGATGTTTTATGCTTT
GTTTGGAGTGGGGAGAATTTAGATACTGATTATCTCTAAGATCAGTGTTTTTCAAACTTT
GAACTGTGACCAAAAGTAAGAAACATTTTATATTACAAACCACTAAACGGATAGATGTAT
ACAAGTAACTAATTAAAACAAAACTATCAGAAAGTAATACTTAGCTTTATTATACATAAC
AAAGATAATATTAAAATATTAACAAGTTAATATGCAATATACTTATTGCTAAGGATCACT
GTGATATAGTATAATGTTTTTTATAAAATTTCATTTCTTTTTTAAATGCTAATTGTGACC
TACTAAACTGATTTCATGGCCCACTAATGAGTCATGACCCACAGCTTGGAAGACACTGCT
CTAGATTTTGTCAGAAAAACATATATTTGAGAAGGTATATGTTTAAAATTTTTTTAGGTG
AATACAAATAGAATTTATAGCTTTTGAACTACTTGTGGGAAAAACTCTTTACCAAGAAAA
CAATCCATAAGTCAACAAAGGGAATTTAAAAAATCATTAGAGTATAGGATAAATAGAAAA
TAAAAAATGAAACAGCAGAAATTAATCCAACTGTATCTGAATATAGTGACTATAACATCT
TTCAAAGAAGCTTAGAATTAATAATGGTCCCTTGAAAGAGGTAATCAAAGTTATTTAGTA
TTTTCTAGAGTTCCCATATACTGCAATAAAACAAAGAAATTACTTGAGAGAGAGAACTAT
GATTTGCAGATAAAGTACCTTTGAAGCAGTCTAACAGGAAGTTTATTAGACCTTTAGGGA
AAACATAAAAATTTAATAAAGGACATATAAAATACTTGAAAATGGAAAGGTACCATGTTC
AAAGATCAGAACTCTTGATGATGTGTCAGTTTCTTCCTTAAAATTAACCGGTTAAGTTTT
CTTTCCAAATATTATATGATGAAACTGTCACTATATAAATATATTAGCAATATTGACATT
ACTGTTAAATTCTTATCCTATAACAATAATACTATTATATAATTAATGAATGTGAAATCA
CTTTTTGCTTATGGTTATTATTAATAATCAGTAACGTTTATATAGTGCTTATAATACAGG
GAGAAGCATTGCTCATTCCAGGAACTGACAGAAGGCCAGTATGAAGCTCAGCAGGCAAGG
GAGAGTGAGGCACATGCTGCGGCCTTGTAAGCTATGTCAAGAATTTTGGAAGATCATTAA
GAGTTTTAAGGAAGAGAGTGATATAATTACACTTGCCTTTTAAAGAAATCTTTCTGGGGC
CTGGCCCAGTGGTGCAGCAATTAAGTGTGCACACTCCATTTTGGCAGCCCGGGGTTCGCC
AGTTTGGATCACACGCGCCAACCCACACACTGCTTATCAAGCCATGCTGTGGCAGGCGTC
CCGCATATAAAATAGAGGAAGATGAGCACAGATGTTAGCTCAGGGCCAGTCTTCCTCAGC
AGAAAGAGGAGGATTGGCAGCAGATGTTAGCTCAAGCCTAATAAAAAAATAAATTCCTTT
GGCTGCTCTTTGAATAATGAATTGGAGTTGGCCAAGAGTGGGTTTAGCAAGATAAGCTAG
TTATGAAAATAGTTCAGGGAAGGGATAATAGTGACTTGGATTATGGTTGTGATAGATTAA
ATGCTGAGCATTGGGTGGTCTGGGAAGATTTTAAAAATTATTGGTGCTATTCCTTGATGT
AGGGTACACTGAAATAGGACCAGGTTTGTAGAGGGCAGATTATGAATTCAGTTTGGACAC
ATTGGGTTGGAGATTCCTAAAGGAAATCCAAGTTGTGATGTTAACTCAACAATAATAAGA
ATGTGAAGCTCAAGGGGTGATCTGTCGTCCAGGTGGTAATTATAGCCATGCCTGTGGATA
TGATGGTCCTAGAGATCAAGAATAGGTTGAGAAGAGCAGAGAGATGTATGCTTGAGCCCC
AGTAAGTAAAGATCCGATAATAAGAAACCTCTATATCTGACACACACATTCATTCTAATG
AAACAATTAGAAAGTCAGGATTTTTACAATGTGAATATGAGCCTTACGTTTGTAAAATGA
TACCAATAGTCAGCTAATCAAGTTTTATTTTATTTGTTTCTATTTGCCTACTTTATTTCA
ACATTTCCACACAATGAATGAGACATTTCATAAGATGTCAAATTACTCAATCTGACTTGT
GACACTGGATGGTTCATAATATTCTACTAGCAATAAAACACAATTACCCATCCCACCCAA
TATTTCAAGTGTTAGAAAACATAATAAAAATCATTTAAACAGGTATTTAAATCATAATTC
TAAAGTTTTCCTGAAATAAATGGAACAATTAATGTGTGCGTATAGCCAGGAAGTGTTTTT
AAAGTAGAGTCCTGACTTTCCTGACTATACTTAGTAAGTTAAATTAAGTAACAGAAACCT
AAGTGGACAGATGAATGGAATAAAGTAATCTAGATATAGACCCTTTATGCGTGAATTTCT
TTTTCGATGAAAGCATCAACATAAATCAGTAGGAAACCAAAAATCACTGATGCTTTACAG
TTGCCAAGATTGAGGCTTGTTGAAAGCACTCAAGAATTAACTTTCTTATGTCTGCATTGC
TATGTGGGTTTGGCTTTTGTAATCTGATACACACCAGAGGTGAACTGATCCACACGAAGC
TCTTCTTTCTGTGTTCTTGGCATCTACCAAATCTCAATGAGGCAGAAATCTCAAACCTTA
AGTCCCTCCATCCTTGCTTTCAGTTCCCCTTCAATTGTCTTTCTTTGATGTGACTCATCA
TTTATCAACTCTGTGAGTTGATTTATGACATAATCATCTCTAAAATATCATAGCGGTCTT
TCAACTATTGTTTAAAAGTCTCCCTTCTCTGCTTCATACTTCGTACTGTCATCAGTGACA
TTTCTAATAGGGACTCTTATCATGACAGTTATCCTTTGAAGAAGTCTTACATGTTTCTAC
TACTATCAGTAGCAATCCAGATTCTTAATATGGTGTTAATCCTTGTCACAGTCCTACCCA
GTCTTCTTCAAGGTGTAGCCATTATGTTGCAGAAAAGAAAACACTGGTTTTAAACAACCT
GTTGCCCACTTATTACCTCTGAAGCTCTTAGCACAGGATTTGGTGCATAGTAGGTGCCTT
GTGTGTGTTGCCCTCCCATTTCTGTTATAGAAGCTTGTTGCTCTGTGTCAAAATTCCTGG
CCAGCAGGAACCTTGTCTTGATTTACTTCCAAGTGCTCAGTACTATTGAATAAGTATAAA
ATATGGTTCTCATTTTTAACAACATAAGCAGTTTTACAACTTACCCCTAATACCATTAGA
TAACATAGAGTTTTAATTTCAAAAGACTTAATTAAAGCATAACAATGACTAATACTTTAG
ATTTTTAAAAAAAATCCGGGGGCTGGCTTGATCGCGCAGCAGTTAGGTGTGCACGTTCTG
CTTCGGTGGCCTGGGGTCTGCCATTTCGGATCCCAGGTGCGGACATGGCACCACTTGGCA
AGCCATGCTGTGGTAGGCGTCCCACATATGAAGTAGAGGAAAATGATCATGAATGTTAGC
TCAAGGCTAGGCTTTCTCAGCAAAAAGAGGAGGATTGGCAGCAGTTAGCTCAGGGCTAAT
CTTCCTCAAAACAAACTCCATGTTATTTTCTATGGTAGCTCTTTTATCGGGGTAAGTATG
AATTGTACGCCTCGACCACACATCAGCAATGATTTATGATTCATTTTCATGCTTTAAACT
CATGTCATTATGAAACAACTTTTATGGACTGTCTTTTCCTGTAGGAAAAAAACCTTGAAG
ATAATTTGCAGAGTTTGGCTACACGATTAGCTCCAATTTATAAGCAGTATGCTCCAGTTG
CGTATCAAAACCAGGTATGTTTTGGGACCATATACAATGCTCTTAAAAATGGCTGAAATT
TCTATATAAACAAAATCATTGTTAATAGACACCCTTTCAAATTTGATCTTTAATGTATCT
CCATTTTTATTAGACAGCTTTAAAAATTATCTAGTCTTTTTTTAAAAAGTCTTCTGTTTT
GGCAATTGAATTAAAACTCCAGAGTGACAGAATTATGGTTATTTCTAGAAATACAACTTA
TAAAAGCAGAAATACATGATTCAACTCATGATGAATCAATGTAATATACCATATTAATAG
AACAAAGGACAAAAACCACGTGATATCTCTATAGATGCAGAAAGTCATTTGACAAAATTC
AAAACTCTTTCATGATAAAAACACTCAGCAAACTAGCAATAGAAGGGAATTGCTTCAGCC
TGATAAAGGACATCTGTGAAAAACCCACGGCTAACATCAAAATTAATAATAAAAGACTAC
AAGCTTTTTGTCTAATTCTGGAACAAGAAAAGAATGTCTACTCGTGCCACTTCTATTAAA
TATTTTTCTGGAGGTTCTAGTCAGGGCAATTAGGCAAGTAAAAGAAATCCAGACTAAAAA
ATAAGAGATAAAACTGTCTCTGCTAGCCAATGTTATGATCCTGTATGTAGAAAATAGCAA
GGAGTTCATACACGTGTGTGCACACAAACACACACAAACTACTAGAGCTAATCAAGTTCA
GCAAGGTTTCAGGATACAAGATCAGTATGCAAAAATCATTGTATTTCTATACACTAACAG
TAGACAATCAAAAAATGAAATGAAGAAAAAGTAGATTGTCAAAATTAAGAATTTTGTCTT
TCAAAGGACATCATCAAGAATGTAAGTGAGGGCTGGGGGAAATAGGGAGATTGGTTAAGA
AGTACAAACTCCCAGCTATAAGATAAATAATTTCTGGAGATCTAATACACAAGATGGTGA
CTATAATTAATACTGTGTTATATACTCAAAAGTTTTTAAAATGTTTTAAATGTTTTCACT
ACATACACAAAATAACCGTAGTTGGGTGAAGGGATTGAGATAGTAACTAACCTTATTGTT
GTAATCATTTTGCAATACATTCACGTATCTAATCACATTGCATGCCTTCAACTTACATGT
TATATATCGGTAATATCTCAATAAAGCTGGTGGGGGGACACATTTTTTAAAAAAGAAAAG
AAAAAGGCAATCACAGAATGGGAGAAAAGATTTGCAAATCATATATCAGACAAAGTAGAA
AATATGGGAATATTTTTTAATTTTAAACATAACCAGAGGTCCATATTTTCCAAATCTTTA
GCTTACTTGTATTATCATGAATGACATGTTCTTTGTTAAATTCCAACTTTCCATTTTAAG
CAGAGTCATAAATTCACCTTCTATACTGGTTCATGAATATGTATTTATGTATCTACTTTT
TTTAGACACTGAACACTCTGCCTATGTGATTAATACACTGTATTAGTCTTTCTTCCTAAT
GGAATAATTTAGGCTACTCGACTTGTTTATCCACCACCAGCAGGTATTAGTGTCCTCTCC
CTGCCCTAAGTCATAGGCAGTGATTGTCATTTTACTCCATGTATTCTCAAACTCTTTATC
CTAAATGTTACTGAGCTCCGTATTCACTACAGTAATACACGGTAGTGTCAGAAGTCTCTG
AAATTGCAAAGTGTAATTAATTTAAGAACTTTGTTGGGAATTGATTTGTTGCTGTTTAGT
GCAGATGATCTTTCTGTCTCTTGAAACTGTGTGTCATGTTTTCTTCCTTAGGTGGAATAT
GAACATGTTGCCCGAGAATGTCGTCTTGGCAGCAAAGAAGGTCGTCCTTTCTCTGGGGTC
ACTGCTTGCCTAGACTTCTGTGCTCATCCCCACAGGGACATTCACAACATGAATAATGGA
AGCACTGTGGTATGTGCCTGGCTGGCTTTTGATCCTGAAAGCTCGATCAGTATATGCTTA
GGCTGAGGTCCTTAAATATGATTGTCGTGACGAAGCATGTTTTATGTTCTGTTCCTCGTA
GTATATGTATCAATAGTATTTATTTAAGTAATTATTGAAGTACTTCCAAAAATTTATAGC
ACCAACCTTAAACAAATATTTTTGTTGAAAGTCATAAATTATATATTTAATTATGGTATG
TTTGCTGGGAGTTAGGAGTCCATGATTATTCAGGGAAACAATTTTGTGCTATCAAATTGG
TAGGTAGCAAGTGAAGCAACTTAATGTTTCTTTTTGCCATCTTTTCCTTGGGGTTTTTGT
GAGGGGAACTGTGCCAAATTTATTGTCCTTTTTTTTCGTATTGTTTCTTAATGCCAGTAT
GTATAAAGTTACATTAATATTCCAAAATTATCAGAAATATTTGCATTTAGATATGTATAC
TATGTTTATAGCCATGAAAAGACTCACATACCCTTAGCATGGAGTCAATCAAAAGATACT
TAAATTAGGTAGAAGACCCCAGGAAAAATCATGCAATAGTCCTTTTGTAAGGGAAATGAG
TTTGCTTCATGTAATGATCTTCTTCTCACTTAGTACAACAGAGATTAATAGCGAGTGATT
GCCTCTATTTCTGTACTACACCACTTTGTTTGGTTGGCCCCATATAAGACACAGCTATAG
GCTCTTACAGTGTGATTGGAAGTGCACTGTCTGATCCATCAGAAGTCAGCCTTTCTTCCT
TGTTTGTGAAGTCTATCAGTGATAGATTAAGGAGCCAAAATAACTTTTTTGCATATCACT
CCTCTCCACTGATGTTGACTGTAGTCTTTGAGACCAACGTTACTTCCAAATGTTGAAATT
GTGTAAATCCATCCAGATGAGTCTTAGCCAGAGAGTAATTCATCATCGTTGGTTGGCTAG
TACATTGGACCTGAATTGCCTCATTATAGAATATCTATGTTCAGGCTGGATTAGGATCAG
AGTCAAATTAAATTTTAGTTCTGCTTCTCTTGTGTATCATTCAGCACTCGTTCTTCTCCA
CTGCTCTTGTTCCTTATGCAAGGAGGCTTGTACCTAGAACTTGGCATAGCTCCAGATTTC
CCCATCTCTGAACACCCACGCTCTTGAAATTTCACTGCCAACTCTCCTTTCACCCTGTCT
GTTTCCCCAGTCTTTCTAGTTGTGCTCCTATGTCTAGTTCTTGTCCCCTTCTTAGTCTCC
TTGTGGGCAAATAAATTGATTTAAGTAAATATTTATTGGTGGAAGATTCTAATTTTTAAC
ATGATTATTTAAAACTTAACAAATAACACCCAAGAGATTTCAATATGTCAAGCCTTGCTG
GTAAACAGGACCATAGATATTGAGAAAATAGTGTGATTTAAAACCTTTTAGTTAAGTTTT
TTGACCTTCTGTATCCACCAAGTTCTATCAACCTTGAAAGTCAAATCTGGCAATTTCATT
TATTTTCACTCTTATAACATCTCTACTGTCTTAGAAAGAGCTCTTAGCTGTAGGAGAAAT
GTGTTTAATAAAAAAATAATGAAACTGATATATTTTTGATGAATCTTTAATGACATTTGA
AAAGTAATTATCATTAAAATATTAATTTATGAAGAAGCATACTAATATTAGGTATCAAAG
ATCAGAAATTTCCTGTATATACTTCTGTATTTTCATTTCTCTACAATGCATAAAAATAAC
TGTTAAAGTAAGGAGAAGGGCTGAGATAGGTTATAGTCGAGACAGAATTTTCTTAAGATG
TCCTATTTCCCATCCAAAAGAAAGACAGGCAAACTGATTGATATGCTCCTAACTAGCATA
GAAGCAAAATGGAGGAGAAAGAGAAAATTTATCCAGATAAAATGTTTTTGTTAATTTTTT
TAAACTATTAGAATATAAGTCCTGCTAGAGAGAGAAATCTCTTGTGCTTCTTCTTTTCTT
CATTAATATCATCAGTTTATTTAGTGAATAAAATTAAAATCACCCTGACAAAAAGGGCAA
AAAGAATCTATAGATAAATTCCACTTACAGGCAGAAGTGAAAAATCCTAGATGACAACAT
AGCAAATTAGAAAATTCATGATAATTAATTCCTCTCTACCCAAGGAATGTGAAATTATTT
GAATATTAAGAAGTAGGGTGATGTATAGGCTAAAATAATACCATTCTTAATAGTTAATAT
GAAGGCAGTGAGCAATTCACTAACCATTCCTTAACTTAAGCAATGAAATAAGATGCTATG
TAACAAAAAGAATATTTAAAATATTACAAAATACATAAACATGTATAATATCATTTACTT
ATAAAATCAACTCAAAATTATACTGGTCTGCTTACAAACAATTGTTAACTTACTAGAATT
GAATAGTGTTGGGTGGCTTGATATATACAATATTTATCCAAAATTAATATACCAGCAGTA
AGCAATTGAAAACAAAATGGAAATGCAGGTCCCTTTCACAATGGCAACAGTAAGAAGCTA
GGAATAACTTGACCAATATGCAGGACCTATATTTTCCATCTCATGTTTTCTTCCTATTAG
GTTTGTACTTTAACTCGAGAAGATAACCGTTCATTGGGTGTTATTCCTCAAGATGAGCAG
CTTCATGTGCTGCCCCTGTATAAACTTTCAGACACAGATGAGTTTGGCTCAAGGGAAGGA
ATGGAAGCCAAAATCAAATCTGGAGCCATCGAGGTGCTCACACCCCGCCGCAAAAAAAGA
ACACGTTTTACTCAGCCAGTTCCTCGTTCGGGAAAGAAGAGAGCAGCAATGATGACAGAG
GTTCTTGCTCATAAGATCAGGGCAGTGGAGAAGAAATTCATTCCTCGGATCAAGCGGAAG
AATAACTCAATGACAAACAGCAGTAAGACTTCCTCGCTGCCACTTTTAGGTGAGGCCAAT
GGACACCACCAATTTTCTGTGCACAACTTTCATTGGCAGAAGAGTTTGGACTTTCCTTTG
CATCTTATTTTTCTTCTCCTTTATCTTTGCTATTCTGTCAGGAATGAGGCATTATGAAAA
GAAAAAGTTTAGATCAGACATCACTTAATCAATTAACTTAGTTAGTTGTTCCTAAATCTT
ATTGTTTATGATATAGTTTGCTTAGAGTTCAAAGTAAGACGTTGAATGTATTTCTACATG
CTTGCCAAAACTAAAAGGCAATGAAAAAGTGACCCATCAGAATTTCTTGGTATTTTTTTC
TACTCATACTTTTTTCAAAAAAAAAAAAAAATATGTTCTTGTCATTTGTGCCCCATCTAT
TTTGAAGCTCTACTCCTTCTTCTTGGCATACATGAGGTGACAATGACTTCCTTGAAGTCT
TCCTAGATCACCTTTAGCATCAATTTAAGTAATCCAGTTGACAAATATTACCGAGCACTG
CTTTCTAGGTATTGGAAATGTAGCAGTCAAAAAGAGAGGAGACAGTGCTCTGAAAGAATT
CCATTTAAATAGGGTTGTCAAAGAAGGATTCACTGAGAGTGAGGCATTTCAGTAAAGACC
TAAAAGAAATAAGAATCAGCAATGTTTTTATTTGGAGAAATAGCATTCCAAGCAGAGGAA
ATGGCCAAGTGCAAAGGTCAGGAGGCAGGAATTTACCTTGACTCTTTGTTGCAAGCAAGG
AGGCCAGTGTGGCTGGAGCAGAGTGTGGAACATGGGGAATAGTAGGAGACGAGATCAGAG
AGGTAAGGAGGCGTCTGAGCAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1092, 1623..1716, 22239..22450, 26428..26578, 30944..31033, 32811..32948, 35520..35681
1001..1092, 1623..1716, 22239..22450, 26428..26578, 30944..31033, 32811..32948, 35520..35681
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved