Equus_caballus Locus CWF19L1
snOPY snoRNA Orthological Gene Database
Equus_caballus CWF19L1
Equus_caballus
CWF19L1
1
SNORA12
23542..23687
28390
ATTTATCCATTTATCTCTCTGTGGAAACTTAGGTTATTTCCATGTGTTGGCTACTGTGA
ATAATGCTGGAATGAACATGGGGGTGCAGAAACCTCTTTGAGATAGTGATTGTATTGCCT
TTGGCTGTATACCCTGAGTAGGATTGCTGGATCATATGGTTGTTCTATTTTTAATTTTTT
GAGGAATCTCTTTACTGTTTTTCATAGTGGCTATCCCAATTTACATTCCCACCAACAGTT
CCCTTTTCTCCACATCCTCACCAGCACTTGTTACCTCGTCTGTTTGCTAATAGCCATTCT
AATAGGTGTGAGGTGATGACTCACTGGTTTTGATTTGCATTTCCCTGATGATTAGTGATG
TTGAGCACATTTTTATGTACTTATTGGCCAATTGTATGACTTCTTTGGAAAAATGTGTAT
TCGAGTTCTTTGCCCATTTTTCAACTGGATTATTTGCTTTTTTGCTATTGAGTTGTTTGA
GTTCCTTATATATTTTGGATATTAACCCTTTATCAGATAGATGCTTGTGCACCTTGAAAG
AGACACAAAGAGCGCAGGAGTAAATTTGGCAACATGCTGATACTTACCGAATCCAAGTGA
TGGCCACTTTTCCTTTAATTTTTTGATAGGTTAAAAACTGATGGAATATATGTATGGAGG
AGTCCGTCTTGGCCACTAGAGTGTTAGGTTAGGCTGGGGCCGAACATTGTGCCGGGAACT
TTCTAGCATCTCGTTAACTTCAATTGCCCCGAAATAAAAAATCATAATTGGAATCCTTTT
TGTCATTTCCTCTTTTCTCTACGGCTGTCCTTCCTTGATTCATCCTTGAGGCCAAACGAC
CTGAGGGTGGCTTCTGACCCTCGGCGCTCTCCGTAGAAAAGTGAGCCCTCATTGGCTGGC
GTGCGCTGACGTCTTATTGTAGTGCGGCCGCAGTTTTCTGAGGAGCGCGGGTTCGGAGTC
CTTATATTTGGTGGTCGTCACAACCCAGGCTGTTGGGACGGATGGCTCAGAAACCGCTGC
GCCTGTGAGTGAGCCCGAATCGCAGGTCTCCCTTCCTGTCCCTCCCTCTCTCTTTCTCTC
TCCGCGCGTGCGCTGGCGGGGGTCTTTCTCCGGACTGGAAGGGAAGAGGAAAGGCGGGGG
TGGGGGTGGGAGCAGGGGCGGCGGCTGCTGAGCTCCGATCACGTCTTTGCCTGGCCGGTC
CGGCATCTTTCGCTTCTGAGCGACCCTCGCTGGGAGAGGCGGAAACTCCCAGCATCAGAC
CTCCATTTTAAGCCGTCCTGGCCTCTGACACATAATTTCCTCTTTATTTCTCCCCACACC
ACACACTTAATTATTAACAAACATTTCCATGCATGGGATTCATTGATTGGTCCTGGTCAG
TGGTGGACTGGATGGCTTGGTAGGGCTCCTGCCTTGGCGCACTTTTTTGGGAGAAGGGGG
CGCTGGGGTGGTGAAGAGAGGACTTCCATTCGTTTCATTCAACAAATATTTATTGAACAG
TTGCAGTGTGCCAGGCCCCGTGCTAGGCGTTGCATAGATGGAGTTCCTGCCTTAATGGAG
TTTTAGCCTAGAGAAACATCGAATAATCCAGTCAATCGAATAGAGAAAAATCGAAGAATC
CAGATCAATGTAAAATTACGATAGTGATGAATGTTGGAATAAAAAGTTCACGGGTCTGAG
AGGGTGTATAATAGAGGTATTTGGCTTAATGTGAGGAATCAGGGGAGTGAGGATTGTGCC
TTGAATAATATTTTTGTCTTTATCCTAAAAGTCATCCAGGAGCCGGCCTAGTGATGTAGT
GGTTAAGTTCGCGGGCTCCTCTTCCTCGGTCGGCCGGGGTTCCGGCTTCAGATGCTGGGC
GTGGACCTACATGCCGCCAGTGAAGCCCTGCTGTGGTGGCATCTCACATACAAAATAGAG
GAAGTTTGGCACAGTTGTTAGCTAAAGGACAATCTTCTTCACCAAAATTTTCTTTGAAAG
GTCATTGAAATGTTTAAGAAGGTTTTGGCATGATCAAATTTCGTTTTGGGAGGTGATTGT
GGCTGCAATGTGAACAAATTAGAGCCAAATAGAGGACAACTAGAATTAGGTAGTCTAATG
ACAGAAGAAAAGACCAGGGACTCGAGGTTTGTTAAGGAGATAAAATCAACAGGGCTTGGA
GATGGTTTGGTCGTGAGTGAGAAGGATTTGACATTGTTGGGGTCCTATATTTCTGTCTTT
CTTCAGTGGGATAGGAAACACTGGAAAAGGGCCCGTATTAGGAGGAAATGAATTTTGAGC
TGTCCCATGAAGTGCAAACTGGACGATGGCTCTCCCAGAAATGATGAAAACTCCATGTGA
CAAGTTCTATGATAGAGAAAGTGCAGGATCCTGTGGGGGCACCAGGAATCATGACTGATA
GGGCCTGGAGAGCTTCCTAGAAGATGTGGTGCTCAGAAGATAAATAAAAATGCCTAAAAG
TTTATTACCGAGCTTGCTCTGAAATGCTATATGGGTTTCTGAAGTTTTGAGAAGAGAGTG
ACTTTCTGAACCAATCAGGGAAGCTTTAGAGATATGCTAGGCTTTTAAGGATGTGAAAAA
TTTAGACTCAGGATGGATAGAGTGGGATTGTTAGAAGTAACTACCCAGGGAATAGCAGAG
GCAAGAAGTGATCAGATTGACAGTGGAGAAGGCTTCTGTTAGGGAAACTTGGAGAAAGCA
GTGGGAAGAGAGATGAGGGATTTGTGGAAGGCGAGTTCTGCAGGTAGTAGAGTTCTCTTA
ATGTTTTTGAGGAAAGAAGATTAAGCTGTTGGCTTTATGTAGGATGGATAGAAGAAGAGA
AGGCATTAGAGGAAATTTAAGTGTGCTGTCTACTTTGTATCCAATATCAGATTCATTACA
TTTCTCTCTGATTCTGCCTCTGCCATATCATAGGACCCTCAGTTGCTCAGCCTTGCAGCT
ATCCTCCATTCCTCCTTCTCCATCATTTCCCATCCTACTTCTCTACTCCAATTTGTGTTT
GTGTTCGGAATTCTGAATTTCTCATCTGTTTCTCTCCTCCTTCATTTGGCATTGCTCTTT
TTGCTCATAGTCATTTGTTCCTCCAGACCATCTTTCACTCTGTTACTAAAATAATCTTTC
TAAAACAGATATGATCATGTCACTCCCCAGCTTGAAAATCTTCAGTGATATGAATGACAA
CAGAACACCAGAGAGACATGCTGACGAAACAATAAGAACTAGAATATTTCAAGATGAGTT
AAAAGACATTAAGAAAATGATATGAGAGGCCGGCCTGGTGGCACAGCAGTTAAGTGTGCA
TGCTCTGCTTCAGTGGCCTGGGATTCACTGGTTCGGATCCCAGGTGCGGACGTATGCACT
GCTTATCAAGCCATGCTGTGGCAGGCATTCCACATGTAAAGTAGAGGAAGATGGGCCTGG
ATGTTAGCTCAGGGCCAATCTTGTTCAGCAAAAAAAACCCCAAAAACTCAGAAGTAAGAG
AATGGAAGAAATTACTACAAATTAGGGCCAGTCTGTCTTACGAATCTTGGCTCTTGGCAC
TTTCTCTTTGCCCCATAACACTTCATGTGTATCTCCTGTTGTAGCCCTTTTCATATATAT
TTATAACTGTCAGAGTATCTCTCCTTCCCTGATTGTGAATTTTTTGAGGCTTGAACTGAG
TCTTCCTCTTCTTTGTGCTCCTACTGTGTACTTTGCATAGGACTCGGCATATTGCCCCTG
GCATATTGTAGGTGTCCAGTATGTGTTTGTTGAATGGGTGATTGAAGCCCTACACTAAGA
GAATGACAGTGGGAATAACAAGCATGGAATGGATGTGTAAGATGTTTGGATTGATGGGAC
TTAGTGACCGGATGGGAGATTTTTGACTCTTGGTGACTAAGTTGGTGATAGACCTATCCA
CAACACTTGGGAATTGAGGAGAAGAAGCTCGTTCAGTTTTGGAGGAAATGATAAGCTGAA
TTTTAGGTATGGTGAGTTGAAGGTGTTGGTAAGACCTTTAGGGGGAGCTGCCCAGTTGTC
AGACATAGTTTATGTGCACTGAACCTCTCAGGTAACCTCAGAGAGATGGACCACACATCT
TCCTGATGCAGGAACACTAGTATAAACCAAACCTGGCAGGCTGGTTCGTGTTTCCTGAAT
TGCCTCAACGCTTGTCTCTTGTTTGCAGCTTGGCTTGTGGAGATGTTGAAGGAAAGTTTG
ACGTTTTGTTCAATCGAGTTCGAGCAATTCAGAAGAAAAGTGGAAACTTTGACGTAAGAT
GTTTCTTTTTACTAAATTTAATTTTACTGTTGTAGTCAAACATACTAAAATAGAGTTGTG
GCTCCTTTATTCATTCCTTGGTTGAACACGTCCTCTCCTTTTTTGTTAGGTTGAGTTCCT
TTTGTGAGCCTAGGAACTTAGTCGCTGCTGAGTGGTGGGGAAAGGGAGACCTGTTTACCT
TTTTATACTTCTTTTTTTTAAGGTTGGCACTTGAGCTAACAACTGTTGCCAGCCTTCTTT
TTTCTTCTTCTTCTTCTTCTTCTCCCCAAAGCCCACCAGCACACAGCTATACATTCTAGC
TGTAGGTCCTTTTGGTTGTGCTATGTGGGATGACTCCTCAGCATGGCTCGACAAGCAGTG
CCATGTCCGTGCCTGGGATCCAAATGGGCAAAACCCTAGGCTGCCGAAGCAGAATGTGCG
TGCAAACCCAACCACTCAGCTACCAGGCCAGCCCCAGTCTTTTTATGCTTTTTGAATTTG
AATCTTGTTACTTTATTGCTGTAGCCAAAATTGAAAACAGACTAGCAAAACCTCCGTGAG
TGATTCTGACCACTGGCTTTGGGAAGTGCAGATCTATTTCGTGGGTGTATGGTATGGATT
AAATCAGATAACATGTGCAAATGCTTCACAAACTAAAGAGCTCTATATAAATGTTATGTG
TGGTTGCCAAGTAGACTGTAAACTCCTAGAATACAGAAGAGTATTCTAGGTGTGGGGATA
ATCTGTTTATTGGGTTAAAGGTTAAGTAAAGGGGCCGGCTTGGTGGCGCAGTGGTTAAGT
GCGCACGTTCTGCTTCAGTGGCCTGGGGTTCACTGGTTCGGATCCCGGGTGCGGACGTGG
CACCACTTGGCAAGCCATGCTGTGGTAGGCCACATATAAAGTAGAGGAAGATGGGCACAG
ATGTTAGTTCAGGGCCAGCCTTCCTCAGCGAAAATAGGAGGATTGGCAGCAGTTAGCTCA
GGGCTGATCTTCCTCAAAAAACAAAAAAGGTTGAGTAAAGACAATAGGCAGGAAATGTGT
CTTTTATGTCCTGTATCTCTCAGGGTATCTACTATTTAAAGTTTTATATTTCACAGAGGG
ATTCTCTAAGGTCCATTTCTCCATCTTTCCCTGACTCCCTCTTCCCAAACCCCAATATGA
ATTTGACAGCCAATGAGCCAAAATTTAGTAATTTATAGAATCAGAGTAACTACAATTGCT
GCTAAAGAATTATGTATTGAAATTCTGTAAATTGATTAAGGGAAACACCTGGTTTGAGAC
CTCTAAGTAGGATAATTAGCTGAATAATGTTGCTATCAATTATGTACGACTTGATATTAA
AAAAACTCATATCTGTTTAAAAAACTCATTTTAGCTGCTGTTGTGTGTAGGAAATTTCTT
TGGCTCCACTCCGGATGCTGAATGGGAGGAGTATAAAACTGGCATCAAGAAAGGTATAGA
TACTATTTTTATTTAACAAATAATGACATCTAACAAAGTTTCAAGGCTACACAGTTCTTT
CTGGGTTGTTTTTTACATGTGTTAGTTATTTAAGACTTTCTCTTTTAGCTCTACATTGAG
CTGGGCAGAATGCCAGTGCATCTAAATGTTTACTTTTTGAATTTGGTTGGATTTAGTTCC
AGAAAAATAGTTCTAAGTAGGCAGGAATTGAATAAATGCAACCATATGTTCCCTTTCCTT
TTTCCGGTTTTAGTGTTCTCTTTATCAAGTTCTTTAGGGTCTATGTTTTCGTAATTATAC
ATTGACTGTCCTCTCTAAGATGTCAGTTCATCAGCCTTAGTGATATCAGTTGATAGGCCA
CAAAGTTGGGTATAGGATATCCTATGTGGTGAGCATATTCCACATATAGGATTGTAGACT
CTTTACTTTGGCTTGAGTATTTTTCTTATGAGGAAGCATTTTTCAAGTTCCAAAGCAGAT
CTGGTAACTATGTGGTGTCATGTATGTTTCTCTCACTAGCTCCTATTCAGACCTATGTGC
TGGGTGCAAATAACCAGGAAACAGTAAAATATTTCCAAGATGCTGATGGGTGTGAATTAG
CTGAAAACATTACTTATCTGGGTAAGTTGATATTTTTTGTGTTTGTAATGAACATAATAA
AGTGTCCCCAGGAATTAGTCTCCCTGGAGATTTCTGGCTGGATTCTTCTGCCATTACTGC
CTGAGAGAATGGGGGTCAAGGGGTTCTTTACTAAAGTCTGTCTATACCCTTAAGACTATG
GCATTTTTTCCTTTGTTGTGTCTCGCACCTCTTCTCCAATCTTGTATTCCCACAACCAAA
TATATACTCTTTCAGCCAACTAGAGGATAAACTACTTGACTACAGTGTATGGAGTACTTA
AAGTATAAATTATGATAAAAAAAAATTCCATGTATGTGTTCTCACCATATAACATTGCTA
GATACATACAACTTACTTGTTAGTTAGACTCCTAACTAGCTATAGCTCTAGGTTTCACTA
AGGTTTTGGAAACTCATTTTTAGTACTGATCCTTGAATTTTTCACTCCCGTTGTCCTTTT
CTGGTTCCAGATCCACTTTCCAATTCCAGGTTAAAGTTGTTACCTCCACAAGCCCCTGAA
TCTCTTTTAGTGGTTCTTTCAATGTCTGGCCATTTTGAAAACCAGTATCAAATTGTGCTT
TTGTTGCCCAGCCACCCCCTGTTGTCGGTCTCCTGCATCTTGGATCATTCAACTTACTCT
TTTCTAAAATGGCTCTTCTGCTCGGCACATTTCCTCTCTCTTGTTCTTTCATTTCTCTAG
GAAGCTTCTGCATTTCCTTTGCTGTAAATGCCCTCCCATTCCCTCCTTACCTTAGTCCAT
CTTGGCCTTTATTCTCTACATCTGGCTGTGGCCCTCATGTAAGCAGTCTCATCTCATCTT
ACTTCACTCATATGAGGCCCTTTAGGCAAAAAACTGAGGGATGGATTTTTGTTGTTTTTA
ACCACAGTTGTGAACTATAAATTTTGAAATTCTCTTCTTGTAGATGGGCCTGACCTATGT
CAATTCTCACTGTAGTTAATAAATTTGGATTATGACCACTACTGTAGATATTTGAGAGCC
ATTTTACCATATGAATTTAGTGTCAGGAGTGGAAAGAGCAGCCAAGGTATTGGGGTTGTT
TCTGTGGAAGATTTTTTGAGATCCAGTAGGAGGCGCAGACAATCAACTTGATAGTAAATG
TGATAGTGAGCTGGTAGTGCCAGCAGAACATCCGCCTTATAGATGGAAGTGATAGTTCTT
TCTAGAATATGTAAACAAGATTGTTTGAATCTTGTGTTGAAGAGTGTGTGTTTTGGGGAC
TTGGTCCCATAAAGATGAAAAATAAAGCTGAGGATCAAATTGTTAAGGAAGAAATATGAG
AAGGGAAGCAGGCAGATTATAGTTCCCTGTGGTGGGGGCATGTATATCTTCATCTAGAGG
CTGTGCAGAGGGAGGTGAAAGTGATTAGAGGTGTGTTTGGGGAGGTAAAAAGATACTGTC
AAGTTCATAGAATCTAAGTGAAGAGAGCGTAGTTTCAGGAGAAGAGACCTTTGGCAAGTA
TATAGGGTGATTAATGACCTTAAGAGAATAGTGGCAGAGGGAAACTAGGTTGCAGTGGGT
TAAGGAACTAATTAAGAGGTAAACACTTAGCATGGACTGCTCTTTTGAGAAACTTGAAAC
TGAAGAGGACGTTTCTTTATTAGTTAGTATGTGTGTGACTCCACTGCTCTTCATAGTTTC
TCTGTCTTCATCTTTCATTTCTCTAGAAAGCTACATTTCCTTTGCAGTAAATGCTCCTTT
ATTAGTTTTTTATTAGTATGTGTGTCTCTCTTTTTTTTTTTTTTGAGGAAGATTAGCCCT
GAGCTAACATCTGCTGCCAATCATCCTCTTTTTGCTGAGGAAGATTGGCCCTGAGCTAAC
ATCCATGCCCATCTTCCTCCACTTCACACGTGGGACGCCCGCCACAGCATGGCCTGCCAA
GCAGTGCCATGTCTGCACCTGGGACCTAAACTGGTGAACCCCAGGCCGCCGAAGCAGAAC
ATGTGCACTTAACCACTGTGCCACCGACCCGGCCCTTATGTGTCTCTTTTTATTAGTTAG
TCTGTACATTCCTTTATTACTTTTTTTTTAATTTTTATTTTTAAAGTCTATTTTTTTTTA
AAGATTTTATTTTTCCTTCTTCTCCCAAAGCCCCCCCGGTACATCGTTGTGTATTTTTAG
TTGTGGGTCCTTCTAGTTGTGGCATGTGGGACGCTGCCTCAGTATGGCTTGATGAGCGGT
GCCATGTCTGCGCCCAGGATCCCAACCAGCGAAACCCTGGGCCGCCAAAGCAGAGCACAC
AAACTTAACCACTCGGCCACGGGGCTAGCCCCGCCTTTATTACTTTATTATTCTTTGTTA
GTATACGTCTTCCTTTATTAGTTAGTCTGTGTGGTTATTAGTTAGTATGTGGAAAGAGTC
ATTTGAGAAGAAGAGACTCACTAGATGAAAAGGAGGTGAAAACTGATGGAGCAAGGTATT
GGAGGCAGCCAGAAGGAACAGAATAAAGGGCACAAGCCAGGAGTAAATTTAGAAGAGGGT
CGAGTCTCTCAATTTTTTCCCAAGCAGTTGCTCTTTCCAAATGTTTTCCATTTGGAAGCT
GCTGCCTGCCTGAAGGGTACATCTTTCTAGACTATAGCTTTCTTAGAACTGCTGTTTTTT
TTCCTCATTACCTCTTCCTGTGTTCAGGTGTCTGGATTTCTTTTAGTCCATGTAGAGTCT
CTAGAAGGCAGAAAGCCTTTTTCTTAATCCGTGCTTCCCAACTTTTTTCATTTGTAAGGC
ACCTGGGGTAAACAGACTGGCCTGTGTGCTCCAGCAGCCTCCACATATGGGCTGCTCTTA
CTGAACAGGAGTACTGTTGTAGCCATCCAACACTGAGACCTAGTAGCCAGAAGTGGGGCT
TGAGGAGGGTTTTCACTCATCCAGACACGTAGAATGGCTGGGACATAGGAGAGTCATGGC
ATGGGGGGAGAGAGAGATTTATCACCATAACAACATTTCATCATTCTGCAGTTTTAACTA
CAACTTATCCATTTTTCTTTGAACCCAGGTCGTAAAGGTATCTTCACTGGAAGCTCGGGG
CTGCAGATTGTGTACCTCAGTGGGACAGAGTCCTTAAATGAGCCGGTCCCAGGTTACAGT
TTTAGTCCCAAGGATGTGTCTTCCCTGAGAACAATGCTCTGTTCAACATCCCAGTTTAAA
GGTGTTGATATCTTGCTCACATCCCCGTGGCCCAAGTATGTGGGGAACTTTGGGAATTCT
TCTGTGAGTAGTGCTTGTTCAGTTGGAATTTCTAAAAGTAAATTGCACTGGCTTAATCTG
GGCTTTCTTTGTTCTTTATATTGAGTATTTTAGTTCTTAATACCTTTCAGTAGACGTCTT
TTGTGAATTTCTTCAGAATACTTAAAGCTGTATCAACTGACCAAAGCAAAAGTTGATCTT
AAGAAAGCACAATTCACAAAGGAGATTGCTAAAATTTTAATTATAAATGAATGGTAATTT
AAATTATATTCTCTGCTTCAAGTGGCCTCTCTCAAGTTTCCTCTTAATATGTTTTGACTG
TTCACTAATTTTCAGTGCAAAGATTTATATCTAGTGGCAGCTCTGCAATTGTATTTCCCC
CTTTTCATTCCAGATTATAGCTTTTTGGATCAAAATTTTTTTTTATGGAATCATTATGGG
ATCAAAGATAGTGATCTAAAGATGTAAAGATGGGAAATGAGATGTTGAAAACTTGGTACT
TCTCTAATATGAAAGGTTTAGTATGAATGCATTGGAGCTCACCATTGCATTTGATCTGAA
TATTTTTATAAGCTGTCTAGACGAGGATGTACACCAGGGTGATGAATGATGGCTATCATG
GGTTGTGAAATACTACACTGGTGGTAATAAACCTAATGAAACTTGAAAGGTTGCATGTGA
CGGCAGAAAGTGTCAGGTGAGCTTCAGTGAAGGGAAATGGAAGAATGCATTTAGGGACAA
ATATCAATTAATAGATGTAGAAGTATCAGCAATGATCCAGAAAAAGGCCTTTTAGACCAC
TCTCTGTCAACTTCAGCACAGTGACTAAAATGGCCAAGAAGATACCAGGCATTGTCAGAG
AGGATGTTGAAAGGAAAAATGCTCTCTTCTCCTTCCACAAACCCATGGTTCTTCACCCAG
AATACAATGGGCAGTGCTGGTTACAGAATAGAGAAGATATAGCAAAGCAAGGGGAGATCC
AGAGGACTATTAAAGTGATGATGGAAGGGAGAAAGACACTGATGCTCTGTAAGGAAGGAT
GAGAAGAATGAGGCCCCTTCATTTTGGGGGGCTAAAAGAGGATTTTGATTAAAGTTTATA
AACAACCATACAAGATATTTGTAGGGGAGAAAACAGTATAGTTCACCACTCCCTTTGGTA
CTACAGCTGACCTCAAGGCCAATTCTCTGCCCTTCAGCAGAAACCTGAAGGAGGCACGCA
TAAGACAAAAGGAAGTTCTTGCTTTACTTAGTGGGAAGTTAACTTTGGTAATTTCTTTAT
TTCCAGCTAATACCTTCTTTTAGAATAAAGTACATAAATAACGTTATGGAGGGGCTGGCC
CCGTGGCCGAGTGGTTAAGTTCGTGCACTCCGTTTCAGCGGTCCAGGGTTTCGCCGGGTT
CAGATCCTGGGTGCGGACATGGCACTCTCATCAGGCCACACTGAGGTGGCGTTCCCACAT
AGCACAAGTAGAAGGACTCACAACTAAAAATACACAACTGTGTACTTGGGGGACCTTGGG
GAGAAAAAGGAAAAATAAGATCTTTAAAAAAAAAAAAATGTCATGGATGAGAGAGCACGT
AATTTGTTGTTAATGGAAGCTGGGGATGTTCTGGGAACAAGCCTAACTTTTGACAAACCA
TGTTACAGACTTTGTAACAAGGGTGTGATTGTGCCCTTCAACAAACCACACTTTTCTTGA
CTGAAGCAAAATAAAAGATTGCATGCTTACGTGAGGAAGCCCTTCAATATTCCATACAAA
ATAGTCTGTGGATCCTAGAGGCCCTGAAAGCTAGCTTTTAATGGTTATTTTCCACATTGT
CTTTGACTGTCTGCATTGTCAGAACTGCAGGTGCACAATAGGGCAAATTCTAGAAGCACA
GTTTGCGGGCTCCTGAGAGGGAGCTTAATTTCCAAAAACGATTTTAATAAACCTATTTTG
GGTATTAGTATGGAAAACTTACCTTTTAACCTCTGGCTTCCAGCAACTGTTCCTATTTCA
GCATTCATAATAACCCAGTTCCCCTTATGTGTTTGTGCTTTCTCTGACTGCCGTAAGTGT
GGAATTCACTATGCAAATCCTACTACCCACATCTGTATCCACATATAAATTTCAGTTGAT
ATATTTTAGGGACAAATATCAGTTCAAAGTGTCTTGTTATTTCTTTGCATTTCTTGATAG
CTCTTACATCTTGTGTGATGACTGAGTTTCTGTTTACTAGGGAGAAGTGGATACCAAAAA
ATGTGGCTCTGCTTTGGTCTCCAGTCTTGCCACAGGCTTGAAACCAAGATACCATTTTGC
TGCTTTAGAAAAGACCTATTATGAGAGGCTTCCATATCGGTGAGTAGCGTTTTGTTCTTT
TGGCTTTTTAAAGAGTTTAACTGGCATCTTCTGTGTAAACTGCTCATGTTCATTTTAGCC
GTATAACATCTTGGTTCCTTTTAGTTACTCAGGCACTGAAATTAGTGACTCTCAAATCGT
TCAACTTCTCTGAATTTTTTTTTCTAATTTGGAATACAAGGTATTGGACTATAAAGAACC
CCTTAGAGGTTTGAGGTTCTGAGGTAACAATATTGTTTAATCATCATAGCTCAATGTAGC
ACAGTAAGTGCTGTTTTGATCAGGCCAAACAGTACTCTTTGTAAACTCTTAAACTCAGTA
TATGGGCCGGCCCCGTGGCCAAGTGGTTAAGTTCATGCTCTCCGCTTCCGTGGCCCAGGG
TTTTGCCGGTTTGGATCCTGGACATAGACACAGCACCACTCATCAGGCCATGATGAAGCG
GCATCCCACACGCCACAACTAGAAGGACCTACAACTACAATATACAACTGTGTACTGCTG
AGCTTTGGGGAGGAGAAGAAGAAGAAAAAAGAAAATATTGGCAACAGATGTTAGCTCAGG
TGCCAATCTTTAAAAAGAAAAAAAAGAAAACTTAGTATAATCACTTTAGAAGTATTTCAA
TTTGGGAATCAAGAACTCGTATCAGGGGGCCGACCCCGTGGTTGAGTGGTTAAGTTCACA
CACTACACTTTGGCGGCCCCCAGGGTTTTGCCGGTTTGGATCCTGGGTGCGGACATGGCA
CCGCTCATCAAGCCACACTGAGGCAGCGTCCCACATGCCACAACTAGAGGGACCCACAAC
TAAAATATGTACAACTATGTACTGGGGGGATTTGGGGGAGAAAAATCAGGGAAGGAAAAA
AGGAAGATTGGCAACAGTTGTTAGCTCAGGTGCCAATCTTTAAAAAAAAAGAAAGAAAGA
ACTCATATCAATTTTTTTTCTTTTGTATGAGTTTGGAGGTGGAAGTTTTAAAGGATATAT
TGCAGAGAAAAAGAGAAAATAAAACGAGTGTTTTGTAAATGGTAGAGTTAACTGAATTAT
CTTCTCTGATAAAGGGCATGAATAATCTTTAAAATAATGGGTAAAAACTTTTTTTTTAAC
ACAGACGTAGTAGATGTAGATGTTGAAAGTTCCAAAAATATAGGCGAGCGAAAAGAAGAA
AATAGCTTGCCCTTCCCTCACAATACCATGGCCTCAGGTATAGCCACAGGTAATGCAGAC
TCTTCTGTTATGTCTCCGTGTGTGCATTCCAGAAAAACCTCTTGCACTAAAACCACGCAC
TAAAAACAGAGGTTAGAGAAACAAGCCACTCAAAACCTGTTTAACTTTTAGGGATCTGCA
TACATAACTTCTCTGAAGAACATATACCAGTGGCCAATAGGCACATGAGAAGATGCTCTT
TCTTTAGCATGATCATTATTAGCCGTTAGGGTAATCCAAATCAAAACCACAATGAGATAC
CACTTCATACCCACTAGGATGGCTGTCATCAGAAAGACAAATTATAATACGTGTTGGCAA
GAATATGAAGGAATTAGATCCTCATGTGTTGCTGGTGGGAATATAAAATGGTGCAGCCGC
TTGCACAACTGTTTGGCAGTTCCTCAAAAGGTTAAACATGGTTACCATATGACCCAGCAT
TGCCACTCCTATTCCAAATGAAATGAAAACATAGCTCCCCCCAAAACTTGTACACAAATG
ATCATAATAGCATTATTCATAATAGCCAGAAAGTGGAAACAACCCAAATGTCCATCAGCT
GATGAATGGGTAAATAAAAAGTGTCCTATCCATACTATGGAATGTGACTCAGCAAGAAAA
AGGAAGTACTGATACCTGCTACAACATGGGTGACCCTTTAAAACATTGTGCTGAATGAAA
GAAGCCGGACCAAAGGACTATATACTGTGTGATTCCATTTGTATGAAATGTTCAGAATAA
GCAAATCCATAGAAATAGAAAGTAGATTAATGTTTGCCGGGGGCTAGTTAGAAGGAAATG
GGGAGTGACTGCTAATAGGTATAGGGTTTCTTTTTCAGCTGACAAAAATTTTCTAAAATT
AGGTTGTGGTGGTGGTTGCACAACTGTGAATATACTAAAAACTATTGAATTGTATGGTTT
AAATGAGTGAATTGTATGGAATTTGAATTAGAGCTTAATAAAACTTAAATAAAACAAAAA
ACCCTCTGCAACTTTTTAACTAGAGCTGTAACAAAAATTCTATCATAGGGGCAAGCCCGG
TGGCGCAGTAGTTAAGTGTGCACGTTCCGCTTTGGCGGCCCGGGGTTGGCTGGTTCAGAT
CCCGGGTGCGGACATGGCATCGCTTGGCAAGCCATGCTGTGGCAGGTGTCCCACATATAA
AGTAGAGGAAGATGGGCACGGATGTTAGCTCAGGGCCAGTCTTCCTCAGCAAAAAGAGGA
GGATTGGCAGCACTTATCTCAGGGCTAGTCTTCCTTTAAAGAAAGAAAGAAAGAAAGAAA
GAAAGAAAAATAAAAGAATAGGTTGTAGCAGACAGAGTGTATTTTGGTTTATTTCCTTTC
AATATGAATATAAAATATATATGTGTATATTTATATAAAATGGTATTAGACTAGATTTTG
TGAAAATAAAATAGTATTTCGTGACAGATTCAGGAAATTTTTGTAGCATGAGGAAAGTAA
AGGACTTAAGGATTAGCATCTGTATTAATAGTCAACTCACTAAAAATGAAAAATATATAT
AATGCCATGACTTTTTTTTCTTTTAATTACAAATAATAGTTGCTCAATGTAGAATACTTG
TAAAACACAGAAAAGCTCAAAAAAGTATTTTGGTATATGTAGTTACCATATCTTTTCCTA
TGAAATAGAGACACTCATGTATTTTTATATTTTTCTTAGAAATATGAAATCATACTATAT
ATTATTATTTGAAGCTTGTTTTTCTGCTTAAAACTAATTTCTTTTTTGTTTTCATTATTT
TAGATTTTTATTATACAAGAGAGAATAGTATAATGAACCCTCCTATATACCCATCCCTAG
CTTCAGCAATTATCAACATTTTGCAAATCTTTTTTTTTTTTTTTAAAGACTGGCCCTGAG
CTAACATCTCTTGCCAGTCTTTTTCTTTTCTTCTTCTTCTCCCCAAAGCCCCCCAGTACA
TAGTTGTGTATTCTAGGTGTAGGTCCTTCTAGTTGTGCTATGTGGGACGCCACCTCGGTG
TGGCTTGATGAATGGTGCTAGGTCCACACCCAGGACCAAACCGGAGAAACCCCGGGCCAC
CGAAGCAGAGCACAGAAACTCAACCACTTGGACGGGGACCGGCCCCAACATTTTGCAAAT
CTTGCAGCTCTTTTAAAACTGAAAGTTGAAGTTTTTGTGCTTTTTGGATATGTGATCTCG
TTTTTTCCTAACAATAGCCCTGTGAGGTAGGGATGATTGTCTTACTAGACAGACAGGTAA
TATCTGAGATTGTTACTTGTGGTGACGGACTCAGGATCTGTGCTTTTTTTGTGGTCGCAT
GGAGTCTGCATATTTCATAATTGTAAATCAAAAGTAAAGTTTATTGGTAACTCATTATCT
CTCAAATATGTTACAGAAACCACATCGTTCTGCAGGAAAATGCACAGCATGCCACCAGGT
TCATAGCTCTGGCAAATGTTGGAAATCCAGAAAAGAAAAAGGTAAAGATCTGAGTATTTG
GTGGTAGGTTAATATTTATCTTCCTGATAAATATTTCTCTTGCCCAGTTTAACATTCAGA
TCTTCTCTTTTCCGTAACTGCAAGGTCTTAGCACCTCAGTGACTTTTTGGTAAAGGTATG
GTAATGAAAGCTCAAGTTTCCTTGGGTCCTTTTTAGGAAGTTTTAGAGAAGGGTTTGGTT
TGGCAAAATAGGCCCAGTGGAACAAAGGCAGAATTTCAAATGAATGATTTTCCTTTCTTC
CTACATCCATGTGGTTGCCTCTGGGTACGCATGAGTTTGCCCTCAGATGGTATTCTTGCT
TTCCTTCTTAGCAACTTGATTTAGCAGAAATAACAAAATCCTCCCAAGGATTTGCCTAAG
CCCTCCTTGGCTTTGGGAAATTTTAGCGATACCTGGAATCTATCTTTGTACTGGAAGACA
GTGCAGCTGCATGAGAGAGAACATATCAGAAAAGTACATTAATTTTCTCACTTCCCTGAG
AGCATTTCTTATTCCCTAGGGCCAAAAGCAGGATGTTGTGGATTGAGACAGCTAAAATCT
GAACAATCAGTCAAGTGGGAAAATAGATACATAATCTGAAGATTATTCTACTATAACGTG
CCATAAACAATGTACATACTATGTACGTTGTTAGCCTCAGCCCTAACCAACTCATACTTC
AGTCAAAGAGTATGCACATTTTTAAATGTGGCAAGCACTGTTAATTCTTCTCAAAGTTTT
GTTCTGATTTACACCCCCTCCAGCAGTGTATAGGTCTAAGTTTTTTTTCTATCCACATTT
TCACTAAATAGTGTCACATTTTTATTAAAGTTTTTGCCAATCTGATAGATGAAAGATGGT
ATATCATTGTTGATTAGTTGCATTTCCCTGATCAGTAGTGAGGTTAAGCATTATTCATAT
TTCATCTGAAGTTTTCAATATTTGTGCCATTAGTCCAAGATTCTGGATGCTTTATGAATA
TTTACTTCTTTGCTACTAGTCCCTAAGAAAATTTATCAGCATGTACAGCAGAAATCGTAT
AATATCAGAGGGTAGCCCTAAGTTGTCCAGTTTAGTTTTCATTAGGAAAAAAAGAATGGC
AGTGCCATGATTCTGTTGACAGAGTCCACAAAGATAAAAGACCCAGAGACAGAAGCAGTT
TGTGTTCAAGGGTTAAGGGCCTTGTAGTGATGGTTGTTTGGTGTAAGGACTGATTTTTGT
GAGGGCTGGGCCTTTGATCTCTTGCTCGTTCCTTCGTCAGCCCTTGGTTAGCCCCGCAGA
GATCACTGAATTGGCATTTGATTTACTGTGTATTCTCTGAGCATAGATGGGCCAAGTTGC
TGCTCTTTTAATTTTACTCTATTTCTGAAGCTTTCTGTGAAATTGCAATAAAATAGGTTG
ATTACGTTTGGATAAACAGTATTTCCCCTAATGTTATGTTGTTTTTCTCCCAAAGTACCT
TTATGCATTCAGTATTGTTCCTATGAAACTAATGGATACAGCAGAACTGGTAAAACAGCC
TCCAGATGTCACTGAAAACCCATACAGAAAATCTGGGAAGGAAGCATCCATAGGAAAGCA
AATTCCTGCCCCTGAGGTATGTTCTGATTGAGAGGTGGAATTTTCTGGGCAAGATTGCCC
ATTACAGGTATCCCTTTCCTGGTTATAGTTTAGTTCATAAGACAAGTTTAATCCTTTGAA
TCTAGATCTTTTTTTTTTCCTTGGGAAATCATGGTGGTATTTAGAAAGCCTTAGTAGATT
TCAGGTAATCTGTGGGGTTACCAGTTTCACATGTTCAGTTTTGCTTTGACTAAACTTGAT
TCGTATGTTAGGGTTATTGTATCATAGTGTTAAATCTTTCCTTGTCTGAAGTTGATTATC
TGTTCTTAACTTTTCAGGCAAGGCTCCAACTATTTGGTGGCAGTGTAGTTTGTGATTTTA
TAATGAGTGCTAATAGGTAAATAAGACTCCTTCTGAAGAACTTTCTTAATAGTAGTCTTT
TCTGAAATTAATTTTTCCCTCACTAAAGCGATGACTGTCGGATTCCCTTACTAGTGTGCA
TGGTCTGCCTTCTCAGGCTTTTTTTCTTTATGAGCAACCTGCTCATCTTTTTAATTAAAG
TTCAGTTAGACTTGTTTGACCTGTGAAATTGTAGGACTGTGCTATGGGCCTATTGAGAGA
GAAAGGAAAAAGAATTTGAGTGAGTTCATATTGTTCTGTTTTAGGCAAGAATTGCTCTCT
AACTTGCATTTTAACTTTCTTTTCCAAAGAGATGAATTTGGTAGCTTGGAAAGTATTGAG
AAGTAAGACTGGGAGTCTAGGCTTCAGGACTGGAAAGATGTTTTTCTTCTCTAGAATAGG
CAGAAAGGGCTGGGAGGAAAGATAGACATTACCTGGCAGCAGTGTTCCCTTGTGTGTGAA
TTGTGGGCTGCTTGTCTAAAGGTTAGTTTAATAACCTTTGCTCTTCTACCTTTGGCCGTT
CCAGGAAGAAACAGCCTGTCAATTTTTCTTTGATTTAAATGAAAAGCAGGGAAGGAAGCG
TTCATCTCCAGGCAGAGATAGCAAGTCATCTCCTCACCCAAAGCAGCCTCGCAAACCTCG
TAAGTACCTTGATTCTAGAGGTCTCCTGTGTGAGCAGTAGCTGTTATTTCAGGTCTTGTT
TGGGAAGCAGCATTGCTAAGACAGCCTCTTTTGGCAGAGGGAAATTGTACAATGAGTCAT
CAGGACCAATAATAAAAATACAATATTACAGTGATGGCCTGACTTTAAGGCTGTCTGAGC
CTATTCCTGTAAGAACTATGGAAAAATCTCCATTCCTTCATGTCAGATAAACATATGAGT
TAAAGAGCCTTCAAAACTAATGTGGGTTTATAAAATAATAGAAAAATCAAACTGGTGGAA
GTGACTTTAAGGCTATTTCGTTGAGATCCTCTTTTCCCATCCCCTTGTTTCCAAGATGAG
GAAGCTGACCTTGGGAAGGTAAACTTCTTACCCAGGGTCAGTTGGCTAGCTAGTGGCATA
GCTGGGACTATTATTAGGGTTCCTAACACCCAGTTCAGTGTTCTCTCATTGCAGCCTGTT
GCTAGTTACATACTGCTTTAGTCAATATGTGGTTATCCACTTGTGGATCACCTACCTGTG
GATTGGTTACAAATTCAGAACTTTGAGAATAGAGGTTCATTGATAGTGGTGGTTTTGGGC
GGGGGGTTCATCGTGGGAGCACAACAGGCCCAGCCCATTGTGGCAGTGCTGTATACCAGT
CCTTGCAGGATATAAATATCAAACTAGACTGAGTTCTGTTCGGTGATTATATGCTAGAGT
GCTTGGACCACAGTAACATCTACTTTCTTCCACATGAAGCTCAGCCTCCAGGACCCTGCT
GGTTTTGCCTTGCCAGCCCTGAAGTGGAAAAGCACTTGGTGGTCAACATTGGCACACATG
TGAGTTACTTCCATGGACCTTTTACAGAGAAGGAGATATCTCTTTGTTTTTTATTAACTT
TATTGAGTCATAATTTACATATCATAAAATTCACCCACTTTAATTATGCAATTCAGTGAT
TTACTGAGTTGTACAACCATCACATAATACAATTTAGAACGTGTCCGCCACTCCAGTAAG
ATCCCTTGTGCCCATTTACAATTAATCCCTCTTCCCACCCTCAGCCCCAGGCAACCACTA
GTCTCCTTTCTGTCTCCATAGGTTTGCCTTTTCTGGATATTTCATTTAAATGGAGTCATA
CAACATGTGGTCTTTTGTGTCTGGCTTCTTTTACTTAGCATAATCTTGAGGCTCATCTGT
GTAGTAGCATGTATCAATATTTCATTCCTTTTTATTGTCAGATAGTATTCCATTGTGTGG
ATATGCCACATTTTGTCTATACATTCATCAGTTGATGGACATTTAGGTCGTTTCCGCTTT
TTGGCTGTTAGGAATAATGGTGCTGTGAACATTTGCATGCAAGTCTGTGTGGACGTACGT
TTTCATTTGTTTTGAATAGATACCTAGAAATGGAATTGCTGGTAAATTTATGTTTAACTT
TTTAAGAAGGTGCCAAACTATTTTCCAACGTGGCTGTGTCGTATTGTATTTCCACTAGCA
ATGTTTGAAGGTTCCTGTTTTTCCACATCCTCACCAACATTTGTTATTGTCTGTCTTTTT
GATTGTAGCAACTCTCCTCTGGTTTTGCAGAGCCAGTTTCATAAGATCACTCCCTCCTTT
TCTCCCTCTTTGATAAATAGTTATGGATCTCCTAGGGTGATGCTTTTATGTACTTCTTGA
ACTCTGTATTTTTAGTTCATACTTCTTGGGGGTGATGAATTGCTTTTATTAATTACTCAC
TATTTAAAACAGGGATTTTCTTTGTCCTAAAAAGGGAGTCCTTTGTTGGCTGTGTACCCA
TGTTGGGTTAAAGATGTTGATATTCTTTTTTTATATCTTTACATTCAGAAACTTGACCTT
ATTAATTTTTATGTGGAATTTTGTAATGCTGGGAACTGATTCACACAAATTATATAAAAA
ACTGCAGTGACAGATTCTCAGTTTTGCCTAGTAGAGGATATAGCTTCCTAATGACAGGAA
TACCCATATCCACATTTCTGGCGTGGGTATCTGGGAACCCAAGATGATAATTATGAAGTT
GCTTGGTAAGCGCTGAATCAGACTATGAGAACTAGATGATGTTGAGGGTGATTTTATTTA
GGCTGTGGAAAACCGTGACGAACTCTCTGTGTCTCACAGTAAAGTCATCCTATTCCAGAT
TTCCCCAGATACTTTCCTTGGGCAAGGCTCAGTTAGGCATTAAATAATACTGTTCTTTGA
TCTTCATTTTTTTGAGCTCCCTGTAGACCATTATCCTTTTTCACTCACTTAGAATGAAAA
AAGCTTCGTTTTCAGGGTTACAGTTTTACCCTAGCCACATGTGGCTAGAACTAGCTGTTT
CCCAAGGTTCCTGAGGGAAATATTTATAAACTATTTCCTAGTGTGTGGTGCTTCTGCAGA
CAGATACTTTCATCCATTTCCATTGATTTGTTCTAATTTTGGTTTCTAAGGGTGACCTTT
TCCTCAGCTTCTCTTGACAATCTGAGGGCCCTTTATTGTGGCCTCCGATGGACTGAGTAG
AGTCTCACTTTTGTCTTACAGTTTAAGTCACATCCCTCTCCTGTCTTTGTTGTTTCAGAC
TGAAGCGTCCCAGTCTTTTACATTTATTGTTATGTCTTGATTTTTTGGCACAGTCCTGTC
TCTAGGGGGAGCTCTCCTGTCTCTAACGGGGTCAAGGCCTGTGACACAACTGGGACATGG
AGCCTGTAGATGAACTCTTCAGAGGGAAGAAGAGCAAACTTGAAAAGCCCTTGCTTTTAA
GGAATGCCCTTTTTGGATTCTCTCTCTTGGACCTTGTTTTCCTCTTTGGGTTAGTTTATG
CCGTTCTTCTCTCCCATGGAACTTGTATGGTGAGGCAGACTTTGGACTGCCATCTGTTTG
GGAAGCTTCAGTAGGTTCAAGATGCCATGCAGGGGAGAAGAGATTTGGAATGGTTGACTT
AGCTCAGTGCTGCTCTAGGCCTCCGGGAGAAGTGACCTTTTCTTTCTGTTCACCTTTCTA
TTGCCCACAGTATGTAGCTCAGGGTATGGACTTAGAGGATAATAAGGAAACCTGTTTGCT
TCTCATCTAGGCCTGAAGCTAGAAGGGCAAAAAGCATCTCGGGTCTTGTTTATGGCCCAA
CCCAGCACCCCAAGTAGGAGGGCACGTGAGGATTTTAGCCTGGAGCCTACCTAGTAATCA
AGTCTACGCTTACTCGCGCTGTCCTTTGTCTGGTAGAAACCTCGTAGCAACCTCTGGTGT
CTGGCAAAGGGTTTGGAATCCCCTCCCTGCAACCATTCCTCTTGATCTCCTTTCATTACC
TTTTTTCCCGAGCTTTCTCTGTCTTTGCCGTGCCTTCCTCAAGGGATATACATAGAACTA
TGCTGACAGCCCATGGCCACAAATTGGTAAAAGCAGGGAAAGGCTGCTAAGAGTCCAAAA
TAACTTGCAAAATCCGTAAATTTTACTTAAGGGGGAAACATTCATTCTGGTCCTTTTCAT
GCATTGTTAGAGATAATTCAAGTATAGAACAGGTTAGAAGGTGAGAGTTTGAAAGGGAGG
GAGGAGATTAGGCATGTGGATTTGGGCAGTTCCACAAGAACCAGAAGGTGCTGCATTGGG
GGTGCTGTTTAGTCCAGACTAGAAACCTTCAATAGCCTCAGTGCAGATCACAGTATAAAA
ATTGATGTTTATGGTGGCGACTCTGCCATAAAGGAAAGGCTAGAAGACTCAGGCTTCTAG
AGTAACCTTTTAAAACAAATACAGTCAAGAATGGTTATTGTAAAAAAAAAAAAAAAGGCT
TATTGTCAAAATTAAAAAAATGTTTTGGTGCTTTACACCAAGTAAATGAAGGATGATCAT
CCTTTAGTTTGTTTCTAAAACCTATCCCGTCATTCTGTTGGGCTTTCTTGTTGTAGATGA
GACATAAATGACTCCTTCTTCACCCTTAACTTTGAACCTACAACACTATAAGTATACTTT
GGATTGTGTTTTCTAAAGCTCTCATACCTTCATCATTTGCTTGCATTTGATATTCATTGG
CCCTTTGTCTACACACTCAGTGTTTTCCCTTCAAAGAGTGTCTGAGTGTTGAGCAGTCTT
GCGTGTTTTGGTTTTGACAGAAATATTTTTGGCTGCTCTTTAGCTGCTGACCTCCACTGT
TGGGAACCATAGTTTTCCACCACTTTGAATGTATCTGAGTTTGAGATTTCTCCTCCTTCC
TTCCACCCCATTAGGTTTTATGGTTGCTTTGATGTTGTAGAGGTTAGTCAGCAGCTTAGG
GCTGTAGGAACATTGGATGCTAATGAGGTCGTCTTAGCCTTTTTTTGTGAACCCACGGAG
TGTATTTAGCAGTGAGATTAGATGTTACTATAGGGAAAGTGGTCGTTTTGAAATCAGAAG
TGGCATCTTTCTGTGGCTGAAAGTGATAGTAACTAAAAAATTGTTCTCAAGTTGGGAGCC
TGGAAGGGAAAGCCAACTGTTAGTCCAGTCTCCCTCGTTTCCAGTGCGTTTGAAGCCAAA
AGGCTGTTTGTATGCTGCTCATTTGCTGCCAGTTCATTTGATACTTGCATAGAAATTTGT
TGCATCTGATCTTATTCTTCAGCAGGTGCTTGAGAACATTGTCGTTATAACTTCTAAAAT
CAGATTTTTAAAAGTTGAAGAATGTCTCTTGATAGGCTCTTGAGCACTTTTTCCACCCTG
TCAGGCTCACTGTTGTGGAGGCTTTTCTCCCTGAAGAACCATGCATGTGGTATTGGTGTC
TCGGTTCTGTGTGCTTCCTCTTCAGTGCTACCTTGCCCTGGCCAAAGGAGGCTTGTGTGA
TGACCATGTCCTCATCCTGCCCATTGGACACTACCAGTCAGTGGTGGAGCTTTCAGCAGA
GGTGGTGGAAGAGGTGGAGAAGTATAAGGCTACACTGAGGCGGTTCTTTAAGAGTCGAGG
GAAACGGTGTGTTCTGTTTGAGAGAAATTATAAGAGCCATCACCTGCAGTTACAGGTAGG
CGGTTTCTGCTCAAGAACTTGGAGGGGTCCAATGGGAACCTGGATATTGATATTTAAATA
ATGTTAATTTTAATTAATATTTAAATATGTTATTCTAATGTAAAATTAAATATTTAATAT
GAACTTTCATGTTAATATTTGAATAATGTTCATTTGAAAGGTTAAAGAGTCTCTGGTGAT
AACTCTAGAGAGTGCACAGGGAAGTGCATGGTCAGTGCAAGTGAAGAGCACAGACAGTAA
GTACCTTGTTTAGAAAAGGAATGGATAGTTGAGGAAGGTTCCAAGAAAGATTTGGGCCTT
CATCAGTAAAGTTTGGAAGAGAGTGGGTATTTTGTGTGAAGGCCCAGTGTGAGTGAAGGC
TCAGAGGTAGGAAATAGTCCCAGAACCTGCATGGAGCTAGCAGCTCAGAAATTCCAAGGT
TGTTTATGGTTAATTTGTTTGTAGTTGTGGTGGCTTTCTTTCTGGCGCATTTGTTAAGTT
TTCAGATGGGCCTGACTCTGCCACATATATTATTTAGGAGCTGGCAAAGGCTTGATGACA
GAGCTATCTCTCTAGCCTTTCCTGCATCAGCAATTGGCTCTCACATGTGGCAGGCCATCT
CGTAAGTTTAAGTCCTTACAGACAGGCTGACATAGGTCTGTCTGGCCTGAGGAGAATCTC
TGCTGAGGGGTGTTTCTCCACCCCTGTGATGGATTTGCTTCTTCTCAGGAACTGTGCAGG
AGGCATGACCTCTCTGGCACCTGCACAAAGAATTTCTCCTATCTCCCTACCCCCTACCCC
TACCCCCCAGGTTATTCCTGTGCCACTCAGCTGCTGCACTACTGATGACATTAAAGATGC
CTTCATTACCCAGGCACAGGAGCAGCAGATAGAGCTGTTGGAAATCCCAGAGCACTCTGA
CATCAAGCAGGTAAAACAGGAGTAGAAGGTGATATAAAGCAGGAGTAGAACGTGATATAC
AGGGAGAAGTAAAGACCTGGTTTCTCACATGGTGAGCCTGAGGTACTGTCAAGGCATTCC
AGAAATGTTAAATAGGCAGGTGACGATTTGGAACTAGAACATGGGGTATTGATTAGACTG
CAGATGAAGATGGCATTACAGCAATGCCTTAGTGCTTTCCTGGGAAGAGCAAGAAATTAG
AGATTTCCTAGGGCAGGAACTTAGAAAGATGGGTGCCACAGGGAGGATCTTTGTGTTATC
TGCCAGTTTGGCTTTTTAAACTCTTAATTCCACTAAGTGGCTTGGTATAGCTGCTCACAT
CCTTTTTCTTGTACTTCTAGACTGAATTCTTTGCCAAATTAATGTAGAGCTGAGCCAGGA
TTTTAGATTTTTAAAGCACTATTGTTTGTCCTCATAAAATTCTGTTTACTTTAGATTGCA
CAGCCAGGAGCAGCATATTTTTATGTTGAACTTGACACAGGAGAGAAGCTTTTCCACAGA
ATTAAAAAGAATTTTCCTTTGCAATTTGGAAGGTTTGTATGTATTTCTTATTTTAAATGT
ATTTTCACTAGACCTACTGTGAACAAAGTAGAGAGCTGCATGGATAGTTGAATAAAAAGC
CAAATAAGAAACAGTCCTTCGTCCAAGGAACCAGTACTCTTAGGGCAAGGCAGATATTTA
TGTATATGACAGTAATGTAATGCAGAATGTGAAAAGTACTGTAACAAGGTTTTGAGGAAC
AATGTACTTTAGAAGTTCAGAGAAGGGAGAGCTCATTTCTCCTTAGTGAAAGGCTTCATG
AAGGGGTTGAAGTTGAGCTCGAGAGAGAGATTAGAGGGCAAGCATTGGGGTGTGGACATT
CTAGCTCAAGGGAGTAAAGTGCTGCCAGTAATTGAACATATGCTTAGTGCCAGGCACTTT
GCCAAGTGCTTCACATGTGTTGCCTCATTTAATCTTCCCCACTTTGTAAGGTAGGTACTG
TCATCCCAATTTACCACTGTGGAGAATGAGGCTCTAGAGCAGCGCCTAATAGAACTTTCC
ATGATGATAGAAATGCTGTATAAATCTGCACTGTCCTGTTCGGTAATCACTAGCCACATG
TGGCTACTGAGCACTAGAAATGTGGCTAATGTGACTGATGCACTGAATTTTTAAATTTAA
TTTAATTTTAATTAGGGTTAAAATTTAAATAGCTGTATCTGGCTAGTAGTTCCTAGAGTG
GACAGCATGGCTCTAGAGGGGTTAGGTAGTTTGTCCGTGGTCACACAGTAGTAGGTTCAA
ACTCAGCTCTGTTGGACCCCAAGATGTGAACTCTTAACCTCATTATTCTGTAGTATCCTA
AAGGTCTGGATAAGGTTTCATTTCTGCTCTACATATCAGGCAGAACATGACTACAAAAGC
ATACAGGGATTAAGTAAAGACTGAAGACAGGAAGTTACTAGCAAGAAGAGATAAGAGTAC
GGAGAAGAGTTGAAAATATGTAGAACAGATTATCTGATGCTGTGTCTGTGATTTGCAGCT
GTTTTTTTCCCCAGTTAGAACAGAGCTTTGAGGCAACCTTGAACCCTTCTTGGACTAAAT
TGGAAAGCCTGCCAAGAGATTGCTACTGTTGGATAAGTCCAGTTGTCTACATTTTCAAGA
AGATAATTGATAAATGAGAACACGTGTATGAGGAGCTTCAAAAATCTGACATTATCTTTT
TGTTGTTGTCTTAGCAACAGATGCAGATGTGGACAGTGATGACATGTAGGCACATGATTG
CAGATACACACAGGCACATAAGCCCAAAAAAGATTCTCTGAATGCTTTTGTGCTCCTGAT
AGTTGTATTTTCAACATTGAGAATTTTTCAAAATACAAATTTATAGTTATATAGTATTTT
ATAGTTAACAAAATACTTGAAAAGTATTTTTGAAGTACTTGAAAAGACATATTTTTCCCC
ATTGTGCAAGAAAGGTGGTTCTGGGGCTGGCCCGATGACTGGTTGGGTTCGTGCGCTCTG
CTTCGGCAGCCCAGGGTTTCGCCGGTTCGAATCCTGGGTGCGGACACAGCACTGCTCATT
GGGCCATGTTGGGGCGGTGTCCCACATGCCACAATTGAAAAAATGCACAACTATGTACCG
GGGGGGCTTTGGGAGGAAAAAGGAAAAAAATAAAATAAAAAAAAAAGGTGGTTCTATCTT
CATTATATGGATGAAGAAGTAGGCTCAACGTTTGCCCAGTGAGCCAGAATTTGAGCTCAG
GTCCTCTGACTTTTAGAAGACTCATGTGATTTGTTTTCAACTTTTCCATTTATTGTAGCT
TCAAAGTGGAAAATGAACCATATATTACAGATAGTTATTTCTAATATATCAAAATAAGTA
AAAATAAAAATATAAAGCAGAGGCAATCAGAAGGTAGCTTGCGTGTATGTCTGTGTGTAG
TTCTGAGAGCTAAGTTGTTTTGTTGACACTGAGCTTGTGATGTTGTGCCTGTGTAGGCCT
GAGTCCCCTTGAAGGAGAGAGGACTTTTAAGTCAGAGTGGTGCATGACTCTGTAAACCTC
AGCAAACTCATGGTCTAGTTGGGATGACAAAGCTACATTTTAAGGTAGGATGTAATCACA
GCTAGTTCGGTGCTTTGATTGTGTTATCCATACCTTGCAAAATCTTTACTTTGCATTTCA
TAGGTGAGAAGATCAAGATTTGTAGATGAAGTAGTCTGTTCAGGTTGTAGACAGCAAGTG
GCAGAGCTAGGGATGGAATTCAGTCTCTGATCTTTCTGACATCAGGACCTGCCCTCTTGC
TACTATGCCATGTTGCTTCTCTGAGTACCAGTAAGTTCCAGGTTGTTCAAGAGAGAGAGA
AGAAATGGGCTTTGAGGGGTTAGGAAAGAGGTAGGACCTGAGCTGGTCACTTAAAATGGG
TATGATTTTGGCAGAGATGGCACTCAGGGCAAGAGAGAATGGTATGAGCAAAGTCGGAAG
AATTTGCATTTCTTCTTTGTTGATGCTGAGGAGAGAGCTCTCTGGCCGGAGAGGAATAGA
GGGAGGGAGAGGCTTTGGGGCTGATACTGTGCATTTTGACTTGTGTTCTTTCTGCAGGGA
GGTCCTGGCCAGTGAAGCCATCCTTAATATTCCTGACAAGTCTGACTGGAGGCAGTGTCA
GATCAGCAAGGAAGAGGAGGAGACCCTGGCTTGCCGCTTCCGGAAAGACTTTGAGCCCTT
TGACTTCACTCTGGATGACTAAGCAAAGGGAAAAACACTTTATGAACATCACAGGAATTA
GTAGCAGCCTGTTTTTTAAGAAACTACAGTCTCCCATGGGGACTGTTTTCCTGCCTCTTT
TTTTGTGCATTCGCATGGAAGCTGCCTGCAGCAAGAGGCCTCAGATTGAATATTTTTTGG
AAAAAGTCACAATCTAGGATGAAAATCCTATGTTAGTAGCACGTCTGTCAGCTCCAAGTA
CAGCTTGTGTTTATCAATATTTTCAAAAACACTTAAACTATCAAATAAAATCCAAGTGCT
TTTCCATGGTTGCGGAAGTATCTTGTGTTCATGTTACCTGTAACCATTAAAATGAAATAG
TATATGTGTGTAATAGGAGGGGCCAGGGCTTTAGGCCCAGCAGTTATCCCAGGATCTCAC
AGGTGACTTCTCCCTGAGCAAGGCCCAGGTGGTGCCATTTCTCTCTTATAGCATTCATTT
TATTGATAGAGCTCATTCAGTCCTTCAGCAAATACTTAACTCCTGTGTGCCAGGCGTTTT
TCTAGGCTCCAGGACTATAGCTATGTTCCAAATGGTCCCTCTTGTCCCAGAATTTACAGT
TTAATTGGGAAGAGAACAGGCAGATCTAAGAAAAGATGAGTTCTGCTTTGGATCTGTTGA
GTTTTAGTGTGCTGTTAGATAGTTCCAAACTCATGGAGATCTGGGTTGGTGATAGGGCTT
CAGGGAGCATCAGGGTATAGGCCAGAGGTGAGATTATGAGAATGGATGAAAATAAGGGTG
AATACAGCCCTAAACTGGAGATAACTACCTGAGAAATCTCAATATTTAAGGAGTGCTTGG
AAAGAGAGTGATCCATCAAGTACATGGAGAAGGAACAGAGAGAAAGCTCACAGGAGAATG
CTGTATCTTGGAAGCCAAAATAAAAAATTACATGTTGGGCATTCATGGCATAGACACTGT
TTCACTTAATCCTCACAAAATGTTTATGAGGTAGGTATTGCCTCCATTTTACACATGAAA
AAACCCTAGACTGGGGCCCAGTCCAGTGGCTTAATGGTTAAGTTTGGGTGCTCCACTTCA
GCGGCCTGGAGTTTGCCGGTTCAGATCCCTGGCACGGACCTACGCACCGCTTATCAATCC
CTGCTGTGGCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1023, 4168..4252, 5614..5692, 6219..6320, 9328..9542, 11740..11858, 15436..15520, 16975..17115, 18004..18118, 18879..18958, 22885..23094, 23890..24009, 24474..24571, 27117..27390
1001..1023, 4168..4252, 5614..5692, 6219..6320, 9328..9542, 11740..11858, 15436..15520, 16975..17115, 18004..18118, 18879..18958, 22885..23094, 23890..24009, 24474..24571, 27117..27258
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved