Equus_caballus Locus BAT2
snOPY snoRNA Orthological Gene Database
Equus_caballus BAT2
Equus_caballus
BAT2
20
SNORA38
1297..1427
15053
GCCTGGTCAGGAACCGAGTGACAATGGAAAAGTTTGGCCTGCTTGAGGAGCGAAGGGTA
TTAGGGAAAGAAATGACTATTGATGGATTTTCTTACTGAGGGTAGGAAAATGAAGTTGGT
TCTGGCTTTGGCCCCATAGTTACACAGTGCTGTTGAGGTGGCTCCATAATGCTTTATTTT
TCTCATGTCTGCATAGGTGAGCCAGAGCCCACCAGTACTTCATTTAGAGACAAGATTTTT
TTCAGGAGCTTGGATGGAGGCAACTGTAGGAGAAGATGGGGTGTTTCAGATACTTGGGGT
TCTGTAAATGGGAGTATGTAGAACCCCGATTGTTTCATGAGGAATTCTCTGGCACCAGTC
CGCCATCTGGCTGAGCAAGCTCATAAAATCCTTAAACTCCTGGCATACCTTCCTGCAAAC
CTCCCCAGATGGGAGTGAGGCTGCTGGGAATGGAACCTGGGGCACAGGGCCCTGGTGCAC
AGTTAGGGAGCTGGTGTCTAACAGGTAGGGGATCTAAAGCACTGTTCTTGCACAATGGAG
CTGTGTGCCTCTTTCTGGTTTTCTCTGGGGCTTGGACTTGGCCTGTTTTATTGTAGGTCT
TTGAAATGATTTTGGTGAAAGGGAGAAATTATAACTTGGGATAGTGAAGAGGCTCCTACC
CTTTATAGACTGACATAAAGGAGAGAGAGTTTCTCCTAGGAGGAGACTAGATTTTTACTT
GGATTTTCTTGACAAGAGGTGTGTGGGGGAAAGAGGGCTCTGTGGGAGTTGAGTAGATTG
TGGTTGCTTAAAGGGACTGGGGAGTTTGAATAGGCTAGAGGAAAAGACACCAGAGGGCCA
CATATCTGGCCCCCCTAATGAGAATGAAAGGGAGCTTTTAGGCTTCTGTTAGTCTGCAAA
GGAAGCAGAGACTGAAACATTTGGTGTCTGGCCCACAGGCTCCGGCACGTTTTGGGGGAG
GTGTCTGCAGGACCCAACGTACTCAATGAGCTTCCAGCGCAATGTCCGATCGCTCGGGGC
CGACTGCCAAGGGGAAGGATGGAAAGAAGTATTCCTCGCTCAACCTGTTTGATACGTATA
AGGGCAAGTCCTTAGAGATCCAGAAACCCGCTGGTGAGGGTCCTGTAAAGATGCTCCTAG
TTGTTGGACGTTGGATATGAATGGGGCATGTGATTTAGAGTTCTTTGAAGGGAAGTGGCT
ATAGTATACATATCGAAAGACTAGAGGAACATTAGAGACTTCCCAATTTTATCTTGGGTC
CTGTAGAGGACTTTGGGTTTTGGGTGAACACCAGTTATCCTCCTACAAAGGCGTGTCTGT
GGTTCCCTGTCTTTGGACACGTAAGAATTGGAGGCAAAGAAATGTGGACTTGGGGAAGTC
TGGGGCCAGCTTGCTCCCTGCAGGCTCAAGATCAACCAGCCCACATAGAAGCGTTGAGTG
GAACGCATCTCAACTGTATAGGGTTTCAGAGATTGCCAAGGGCAAAGGAAGGGGTAGTTT
CTAAGAAAAGTTTAGTAATAAGACATTGAGGATGTCTAAATGGGGCCTAGGGTAGGACAC
TGTCAGATCTGCCCTGTGAGGCATTTTTCACTCCATCTCCACCTTTTCTCCAGTTGCCCC
TCGCCATGGCCTGCAGAGTCTTGGGAAAGTTGCCATTGCCCGGCGTATGCCACCCCCAGC
CAACCTTCCAAGCCTGAAAGCCGAGAACAAAGGCAATGACCCCAACGTCTCACTAGTGCC
GAAAGACGGAACAGGATGGGCAAGCAAACAGGAGCAGTCCGACCCCAAGAGGTAGACAGA
GGCTTGGGGGGCACCTAGAGTGATGAACGTTTTAACTTTGAGCTTCAGAGGCTTGGTGTA
GACCAGCCACATAAGAGCCAGAGACAAAGAGGGAAGCCCCTCTCCTGCCTATTCCAGGCC
TCCTGTTTAATGACTAAGGAGTGGTACCTTTGCTTTCTGTCTGATAGAAAGCAAGCATGA
AGAAACAGAGAACAGCCTATGCAGGGTGACATGGTTTTAGTATTTTGTCCTAATATTTGT
AAACAGTAGCAAATAGGCCTTGGTTCAGTGCCTATCCTCCACCATTTGGAGAAGTAGAGG
AGGTATCTCAAGCTCTGGATAACCTTCCCATCCTAACATCCCCTCAGTTCCGATGCCTCA
ACCGCTCAGCCGCCGGAATCGCAGCCACTGCCGGCTTCACAGACGCCTGCCTCCAACCAA
CCGAAACGACCCCCAGCAGCCCCCGAGGTATCTGAGGGACTGGATGTTATTGAAGGGGTT
GGGGCAAGAATAACTTGTAGCTGGGGCCAGCTCCAGTGGCCTAGTGGTTAAGTTCAGCAC
ACTCGGCTTCAGTGGCCCGGGTTTGATTCCTGGACACAGACCTACACTGCTCTGTTAGCA
GCCATGCTGTGCGGGCAGCTCACATACTAAAATATAGGGGAAGATTGGCACAGATGTCAG
CTCAGGGCAAATCTTCCTCAGAAAAAAAAAGAAAAGGTTGTGGCTCCCCCAACCACATCA
CCATTTATTATCTCTGCTTCCCCAGAACACTCCTTCGGTTCCAAGCGGGGTAAAGTCCTG
GGCACAAGCCAGCGTCACCCATGGAGCACATGGAGATGGTAAGTGCAGGGCTGTTTGGGG
AGCTCTGTCTGGGCACCTTGGTAGGCAGAAGCCCTGCACTGTACCTTCAGTGAAGTGTCG
TCAGTCCTTCTTGTCTAAATTTTGGACCCCATATTCACTTTCATAGGGTACACGAGCAAA
TTTGTTTCAGTTTTATATGAGGGTGAGGAGGGGGTCCCAGAACTGACCTTTTTTCTTGGG
GCATGAGCGCCTAATACATGAGGGGTGAGTTTGAAGGCAGGAACCTGATGATCTGGTACC
TGTCAGAGCCTTCCACTTTTCATGATGCATCCTCAGTAAATGTTCTTCTGTTTTCTGCTT
TGTACCTCAACCTCAACAGGTGGAAGGGCATCAAGCCTACTGTCACGATTCTCTCGAGAG
GAATTTCCGACCCTGCAGGCGGCTGGCGACCAGGACAAGGCTGCCAAGGAAAGGGAGTCT
GCCGAACAGTCGTCTGGGCCCGGACCAAGCCTCCGCCCCCAAAGTGAGTTGCTGCCATTT
GTGAGTGAGTGAATGGGTGGGTGGGTGAATGATTACCTTTTGGCCAGGACATTACCTTAT
TTCATCTCAGTGCTAAGTGTTGGTTTACTCACCTATTTCCACATCACTTTCAGCTATGTT
CACTCTCTGCCTTTTCCAAAATACAGATTCTACAACTTGGAGGGACGGAGGTGGTCGTGG
CCCTGATGAGCTGGAGGGCCCGGACTCCAAACTTCATCAAGGCCATGATCCCCGGGGTGG
GCTGCAGCCTTCGGGCCCACCGCAGTTCCCTCCCTACCGCGGAATGATGCCGCCCTTCGT
GAGTTTGGATATCTTGTTTTGGAGTGGTTGCGCTGGAGGCTAGAAAGTTAGGAATTAGAG
TTTAATCTTTGGAGGGGATAGTTAGAAGACAGGGACCTATGACAGGTGAAGGTGGGATGG
ATAATAGGTTTAAGGAGCTGGCAGACTATTTAACTGTCTTGAGCAGCTACTGTTTGGCAG
ACTATTTAACTGTCCTTCTGAGCAGCTACCATTTGGGCTCTTTTGCAGATGTATCCCCCA
TATCTCCCATTCCCTCCACCCTATGGACCCCAGGGGCCTTACCGATACCCCACTCCTGAT
GGGCCCAGGTGAGTAATCCAGGTCTGGGTTTGTGGTTGGGGACAGGGAGGGCCTATTGTG
GAGGAGATGGTTTTCTGTCCGGGAGGCTCAGTTGTGTATGTGGTTATACAACGTGCTGTC
TTTTATTCTCTCTCCCATTTGCCGTTTTATACACAGCCGTTTCCCACGTGTGGCGGGCCC
CCGGGGCTCAGGGCCGCCAATGCGCCTTGTCGAGCCCGTGGGTCGGCCTTCCATCCTCAA
AGAGGATAATCTCAAAGAGTTTGACCAGTTGGACCAGGAGAATGATGATGGTTGGGCAGG
TAAGTGGATATTAAGGATTAAGTATTTTGGGTTTAAAAGGCCAAATCAAGTGAGGAAAAA
ATGAGGGGCTGTGTGGGAGAAAAGCAGACATTGATGGGTAGGGGAGATATATGGAGGAAA
GCTAAGTTCTGGTAAAGAACTGCAAGGAGCAAGAATGACAAGACTCACAGTGGATGTAGA
CTTCAAGGGGAGGGGGGTAGTGTGTCCTAGTCACATGGTTCCAGAACATTTCCTGTGTTC
CAGAAGATATCTGAGATTGGAGAGCAGAATGCTTGGGCTACTACTCTTCACTTTTCCCTT
CAGGGGCCCATGAGGAGGTTGACTACACTGAAAAGCTCAAGTTCAGCGATGAGGAAGACG
GGCGAGACTCCGATGAGGAGGGAGCTGAGGGCCAGTGAGTTAGGACTCTGGGGAGAGGAG
GGGGCTCGGTTTCTCATGGTAGTATACTCTTAAAAAGAGCTGAGTTGGCGGCTGATTTTA
ATTCCATTGTTGGTCTGCTCACAGCAAGGAGTCCCAGTCAGCTGCTGGTGAGGAACGGCC
CCCTGAAGCAGATGGCAAAAAGGGCAACTCCCCTGGCAGCGAACTGCCCCCTCCCAAGAC
GGCCTGGGCAGAGACCTCTCGGCCTCCAGAGACAGAGCCGGGGCCTCCTGCACCAAAGCC
TCCCCCACCCCCACCTCACCGGGGCCCCGCCGGGAACTGGGGCCCCCCTGGGGACTACCC
AGTGAGTGTCTACAATGAGGGGTTGAGATGGTCAGTTGTGGGAGATTAGTGTCAGCTGAA
TAACTGAAGCAGTTATAATGGAGCTAGAGGGAGGGCCGGAGATGGGCTACAGGAAGTATA
GAGCTGTGAAGCCTCTCTGAAAAGGTTTGAAACATCCTTGGTGATAGGAGAGTCTGGGTG
AAAAGAGAATTTGGGATGCTATGAGGAAGAACAAGGAGGCCTGAGTGTTTGGGTCTCTGA
AAGGAGAGGGGAAACAGAAAAAAAAAAAAAAAAACAGGGTTATGAGTTTATCCTCACCCA
GAGAGGCCATCAGCCCCAAGGCCTGGTCCTTGCACCCAAAGCTAGAGACAGTTGATCAGT
TTGTGGAAAAGACTGTAAGAAGCATAATGACTGATGCCTCTGGCCCTGCTGGGTCTGCCC
ATTGACAGGATCGTGGGGGCCCTCCCTGCAAGCCCCCAGCACCCGAAGACGAGGATGAGG
CATGGCGGCAGCGGCGAAAGCAATCTTCATCTGAGATTTCTCTGGCTGTGGAGCGGGCCC
GGCGTCGCCGGGAAGAGGAGGAACGACGCATGCAGGAGGAGCGCCGGGCAGCCTGTGCCG
AAAAGCTCAAGCGACTTGATGAGAAGTTTGGGGCACCTGACAAGCGGCTCAAAGCAGAGC
CTGCTGCCCCACCTGCTGCCCCTCCTGCCCCAGCTCCACCTCCTGCAGTCCCCAAAGAAC
AACCCACACCTCCAGCTCCACCACCGGCACCAGTCCCAACACCAGAAAAAGAACCAGAAG
AGCCAGCACAGGCTCCTCCTGCCCATTCGACCCCCACTCCAGGTGTGGCTACAGCTCCCA
CCCTGGTGAGTGGTGGTGGCAGTACCAGTAGCACCAGCAGTGGCAGCTTCGAAGCCAGCC
CAGGTACGGGGATGGAGATAGATACAAGCAGGTGTCAGGTCTCTGCTTGGGTCGAGGGTA
CAGTTGGTAAGGATGGGAGTAAATGAAGTAGAAGGCACTTGTTTTGGTTTGTTGGACTAT
CAGTGGTAGGGTGAAAAGAGGACCTTTTGCTTGTATGAATGTCTGAGGGGGAGAAGATTT
TATTACCCAGATTCTTGAATAAACCACTTCCCACGGGTCTGGCATGGAGCAAGACTGAAG
AAAGTATCTGTTGTTTTGGTGGTTTCTTGGGAAGTTAATGGCATCATCCTTGGCTCTTGA
GAGGCCATGAAGTGTTTTCATGGGTTTTAAATGGGAAGGGCTTATCTTTAGAGAGCTAGA
GGTGAGATCTGAAATTATGGGAGTGTTTGTGGAATATCTTGGTGGACTAGGCCACTCTGA
TTGTTGTTGTCTTCAATGCAGTAGAACCCCAACTGCCCTCCAAAGAGGGTCCTGAACTAC
CAGAAGAGGTTCCTTCTCCTGCCACACCTCCAGCCCCTAAGGTGGAACCCAAGGGTGATG
GGGTTGGCTCTAGCCGACAGCCCTCCAGCCAGGGCTTGGGCTACCCCAAATATCAGAAGT
CGTTGCCGCCTCGTTTCCAGCGGCAGCAGCAGGTGAGATTGAGTTACTTGCCTCTTAAGG
GCTGCTTCCCTCCTCGGCTTCAACATCTACCCTGTCCATAAGTTACCTTCTAGGCCTGTC
AGTTCTGTTTCCATTGTATCACTCTAGTTCCTATCTTATTTGTAATGTTTGTGTATTAAC
CTTTTTTCTTGGCTGGTTCCTTTTCCTGTCTGGGGCTGGGGAGGCTTTGATGCCTTTCTT
ATCCTCTCTTATTCTCTCCAGGAACAGCTCTTGAAGCAGCAACAACAGCAGCAATGGCAG
CATCAACAGGGCTCCGCCCCACCTGCCCCAGTGCCCCCATCACCGCCACAGCCTGTGACC
ATGGGGGCTGTGCCAGCTCCACAGGCTCCACCACCACCCCCTAAGGCCCTGTACCCAGGT
GCTCTGGGCCGGCCCCCACCCATGCCCCCAATGAACTTTGATCCCCGCTGGATGATGATT
CCTCCTTATGTGGACCCCAGGCTTCTCCAGGGCCGGCCCCCTCTGGACTTCTACCCTCCT
GGTGTGCATCCTTCTGGTAAGGGGCCATAGGAGGAGTAGGGGACCCCTTAGTCCTGGGAA
GTGTGTATCAGCATCTTGCTGTGAGGATGAAGGGCCACCACTGAAGTGGGGAAGGAGATA
TGCTTAGCACAGCTGAGATAGCTCTTTGTTGCAAGAATGGGCTTGGGGAAGAAATGAATA
GTGGTCCTTCATTGGCCAGGATTTACTTGGGACTGATTGATTTCATTTATAGGGAAGCTG
CGTGGATAACCCTGTCTCAGGAGAGGAGGCAAGACACAGACTTACTGGGAATAAGAGATG
GAGGAGCTGACGTTGACTTGACTGACAGGATTAGACTGGGGAGATGGTCCTTGGGCTGGA
GGGCCTGTGACATAAAAAAGAATTATCTTTCTCATACTCCGTTTCCTCAGGCCTAGTTCC
ACGGGAGCGTTCAGACAGTGGGGGCTCAAGCTCAGAGCCATTCGAGCGCCATGCACCCCC
TCTCTTAAGGGATCGGGGCACCCCACCAGTGGATCCAAAGTTGGCCTGGGTAGGCGATGT
CTTCACCACCACATCTGCTGACCCCCGCCCGCTTACCTCACCACTACGCCAGTCTGCTGA
TGAGGATGACAAGGGAATGAGGTGAGTCTGAATAGTGAGAAGTGGGTGAGTTGCTAGTGA
AAGGAGAAAAGGTAGTTTGGATGTTGGTGAGGTGATAGGGATAAACATGAAAGGAGTGTC
TAGGTCATAATAACGTGTTCTCTTTCCCTGCCTGGTTTCAGTTTTCCTTGTCCTGAGACA
CTTATTTCCATTCTTTTCTGTCTCTAGGAGCGAGACCCCTCCAGTACCTCCCCCCCCACC
GTATCTGGCCAGTTATCCAGGGTTTCCTGAGAATGGAGCCCCTGGACCCCCAATCCCTCG
CTTCCCTCTGGAGGAGACAGCTCCCCCAGGGCCCCGTCCACTCCCCTGGCCCCCAGGCAA
TGATGAGGCTGCCAAGATACAAGTTCCACCACCCAAGAAGGAAACCCCCAAGGAGGAGAC
TCCTCAGCTAACAGGACCAGAAGCCAGCCGAAAGCCTGCCCGTGGAGTTGGGGGCCAAGG
CCCTCCACCACCTCGCAGAGAGAACCGCACTGAGACCCGCTGGGGCCCTCGCCCAGGCAG
CAGTCGTCGTGGAATCCCTCCAGAGGAGCCAGGGGCCCCTCCCCGCCGGGCTGGGCCTAT
AAAGAAACCCCCACCACCTGCAAAAGTTGAAGAGCTGCCTCCCAAGCCCCTCGAACAGGG
GGATGAAACCCCCAAGATTCCAAAGCCAGACCCACTGAAGATGGCAAAGGGGAAGATAGG
GGGCCCCAAGGAGACCCCACCCAGTGGGAATCTTTCTCCTGCCCCAAGGCTTCGGAGGGA
CTATTCCTATGAAAGAGTGGGTCCTACTTCTTGCCGGGGTCGGGGCCGAGGCGAGTATTT
TGCCAGAGGGAGGGGTTTTCGGGGGACCTATGGAGGCCGGGGACGTGGAGCTCGAAGCCG
AGAGTTCCGCAGTTATCGAGAGTTCCGCGGAGACGATGGGCGTGGAGCTGGGGCAGGGGG
ACCAAACCATCCCCCCGCTCCCCGAGGCCGTACTGCCAGTGAGACACGAAGTGAAGGTTC
AGAGTACGAAGAAATCCCCAAGCGGCGCCGGCAGCGGGGCTCAGAAACAGGCAGCGAGAC
CCATGAGAGTGATCTAGCCCCCTCAGACAAGGAGGCCCCGCCACCCAAGGAAGGAGTACT
TGCCCAAGTCCCTCTTGCTCCCCCACCATCAGGAACCCCCTCTTCGCCAGCCCCAGCCCG
CTTTTCCACTGCCCGAGGTGGGCGAGTCTTCACTCCCAGAGGGGTGCCTTCACGCCGGGG
CCGGGGGGGAGGGCGGCCCCCTCCACCCATCTGCCCAGGCTGGAGCCCTCCAACGAAGTC
CCTGGCTCCCAAGAAGCCTCCAGCAGGTCCTTTGCCACCCAATAAGGAGCCTTTGAAAGA
AAAGCTTATCCCAGGGCCTCTATCCCCCATGGCCCGTGGAAGCAGCAACATTGCCATGGG
TGTGGAAGATGGGGAGCGGCCCCGAAGGAGGCGCCATGGGAGGGCTCAGCAGCAGGACAA
ACCGCCTCGGTTCCGGAGGCTGAGACAGGAGCGAGAGAATGCTGCTAGAGGGGCTGAGGG
CAAGCCCTCTCCCCTAGCCCTTCCAGTCTCCACTCCCGGGCCCGAGGAGGCCCTCACAAC
AGTGGTAGTACCCCCACCGCCTCGCCGGGCAGCTGCCAAGTCTCCTGATCTGTCGAACCA
GAACTCAGACCAAGCCAATGAGGAGTGGGAGACAGCATCAGAGAGCAGCGACTTTGCCAG
TGAGCGCCGGGGGGACAAGGAGGCTCCCCCACCAGCGCTGCTGACTCCCAAAGCTGCAGG
AACTCCTGGGGGCAGTGGAGGCGGAGCTGGGCCAGGCATTTCAACCATCTCCCGCGGAGA
TCTGAGCCAGAGAGCCAAGGATTTGAGCAAGCGGAGCTTCTCGAGTCAGCGGCCGGGCAT
GGAAAGGCAAAACCGGCGCCCAGGTCCAGGCAGCAAGGCTGGCAGCAGTGGCAGCAGCAG
TGGAGGTGGTGGGGGTCCTGGAGGGAGGACCGGCCCAGGGCGAGGGGACAAGAGGAGCTG
GCCCTCTCCAAAGAACCGCAGGTGGGTAGGGACAAGCTCTTAAGTTTGTTCTTAAGGTCA
AAAATCTGGGAGAGGGGAGAAAAACCTGAGGGAAAGGTAAGGGCCAGTGATGTGGAGTTT
TGAAACCTGAGGGCACATGGGCTCTTAGGTGGTCAGACGTCCACGTCTAGGGAAAGTAGC
TGGAAAGTGCTTGAAAAGAGGAACACCCGTGTGTTTGCTGTTCCTTGCTTCCCACTCTGT
AGACTGTCCACATAGAATTTCTTAGACGTATTCAGAAACACCCGGATTTTAACGGGAGAG
GACAGGTTGGAAGAGATTTGACTTGTAGGGAAAGACAATTTTGTGAATACTGGAGCTGAC
GCTCTGTTCTCTTCAGCCGTCCTCCAGAGGAGCGTCCCCCGGGGCTTCCTCTGCATCCCC
CGCCCCCCAGCAGTTCTGCTGTCTTCCGCCTGGACCAAGTTATCCACAGCAACCCTGCTG
GCATCCAACAGGCTCTGGCCCAGCTCAGCAGCCGCCAAGGGAGCGCAGCTGCACCAGGGG
GGCACCCGAGGCCCAAGCCTGGGACTCCCCAAACCCCTCAAGGCCCGTCCCCTCGGCCTC
CAGCCCGATATGACCCTCAGAGGGCCAACAACAACGATGTCAATTCAGGTAAGCTGAAGG
GGCTAAGGAGGGGAACCTCTCCGTTCCCAGAGAGGTCTGGTGCTGAAGGGGCAAGAGCCT
CCGGCCTTGATGGTGGATGTCTGCACTGAACAAGGGTGGAAGGATTGGGAGGGGGAGTGA
GGAGGAAAAGGCTAGGGGCAGTGACAGAGCAAGCAGATGCTGACTCATTTCCCCTTTTCC
TCAGATCCCCACTTCCAGGAGTCAGGGCCGATGGTGAGGGGGGTGGGCGAGACTCCCCGG
GACACTGCTGGGGTTAATCCCTTCCCCCCAAAACGTCGCGAGCGGCCTCCCAGAAAACCA
GAACTGCTACAGGAGGTGAGGGGTGGGGCTTGAGATTGTGCTTCACTGTTCTTACTCCCA
AGGGTTTTCTTCATTGTCTTTCCTATTCTTGTCATTGTGTTCTCACCCTAAATCCTTAAA
ATTAATCACTGCTTGTTTTCCATACGTTTCCCTTGTTACTCCACACCTCACTCTGACCCA
ACTCCTTATATTCTGTAGTTCCCACCTCATTCATGTTCTGTCTGTGTCCATTCTCACCTT
TAGGAATCTTTGCCACCTTCTCATAGCTCTGGATTCCTGGGCACCAAGCCTGAGGGCCCA
GGTCCTCAGGGAGAGTCCAGAGATGCAGGAACCGAGGCCCTGACACCTCACATCTGGAAT
CGCATACATACTGGTGAGTAAAGTTGAGCAGAAGAAAAGATTATGTTAGAGGCTTAGGGA
AGGAGATAGGGCTCAGAATGAGGTCATCACTCACTCAACTCTGTTTTATTGGCGCTCTTC
CCAGCCACTAGCCGAAAGAGTTACCGGCCTGGCTCCATGGAGCCCTGGATGGAACCCCTG
AGTCCTTTTGAGGACGTGGCTGGCACAGAGGTGAGTGAGGATGGGAAGGGAGTGTCTGAG
CTGGGGTTTTATTGAGCACTGGTCATACTTCCCCACATGTTCTGGTGTGAGTCTTGGGCT
GTTCCCTCACATAGTTGTCTCTTCAGTTTGCCTGTTTGTATACATCAGTCAGGTATTGGG
GTGCTTTCTACCCTGACTTAACCAACTCCCTTTCCACTCCTCTCAGATGAGTCAGTCTGA
CAGTGGGGTGGACCTGAGTGGGGATTCTCAGGTGTCATCAGGTCCCTGCAGCCAGCGAAG
TTCCCCTGATGGAGGACTGAAGGGGGCAGCAGAGGGGCCCCCCAAGCGGCCTGGAGGCCC
CTCACCCCTGAATGCTGTTCCTGGTGAGGGTCCACCTGGCTCTGAACCCTCTGAACCTCC
TAGGAGACGGCCACCTGCCCCCCATGATGGGGACAGAAAGGTAAAGGACAGAAAGGATGA
GGAATGTTTCTGGGGCTTTTGACTTTGGCCCTACCTTTGTCTCCCCTTTCCCTTTGCCCA
TGTGTTTTGAGGATTCTCTTATTTGGGCTTCTCTTCCTTCCCCCAACCCAGGAACAGCCT
CTGCCCCCTGGCCCCATTGGCACAGAACGATTGCAGCGTACAGACCGAGGCCCAGAGCCT
GCCTCTCTCCGGCCGTCCCATCGACCTTGCCCCCAGGTCCAGTTTGGCACTAGTGACAAG
GTTTGTATGGGCTGGATCCGGGGTGTCTTGTGTTGGCTGGAGAGAAGGGAAGGACTGGAG
GTAGGACATGTCTGAATTATGGGACAATCTCTCCTGCCTCACAATCACAGGATTCGGACT
TGCGCCTCGTGGTAGGAGACAGTTTAAAAGCAGAGAAGGAGCTGACGGCATCAGTCCCTG
AGGTAAGTGGGAGAGGGAGAGTTTGGTGGAAATTTATGAAGAAGATGGCTGGGAGTGGCC
TGGGCCTCCAGGGTGCCCAGAAGTCCCTCTGGACAAGGCTTCTCCTTCCTAGGCCATTCC
CATTTCCCGAGACTGGGAGCTGCTCCCCAGTGCTTCTGCCTCAGCTGAGCCACAATCCAA
GAATCTGGGTTCTGGGCACTGTGGCCCAGAGCCCAGCTCCTCAGGCCAGCGCTTGTACCC
TGAGGTTTTCTATGGCAGCCCTGGGCCTCCCAGTTCTCAGGTAGGTCCTACTTCCTATGC
CATGACCCTTTCTGCCTGCTGTCCCTTAAATCAAGCCTTTCTGATTCGTATAGTTTTAAA
AAACATTTTTTTGTCATTTCATTTTTCTCCTTTTATTGTAGTGGGTGGTGTGGGTGAGCT
TTTCTTGACCAGAAAAAGGAGTTATTTCAGCCTTGCTCTCCTGCAGGTCTCTGGGGGAGC
CATAGACTCTCAGTTACATCCCAACAATGGAGGCTTCCGTCCTGGGACACCTTCACTGCA
CCCTTACAGGTAAGACTAGATGCCGGGGGGTCTTAGAAGGAAATGGAGCCATGTTTCAGG
GGAGAGGGAAGGGGAAGACATATTTCTTTGGTATGGCTTAGGGTATGGCTCAGACTAAAG
GAGTAAGTGACTGATTTCCTGATACTGTTTCTCCCCCTTGACTCCAATTTCTTTTCAGAT
CACAGCCCCTGTACCTCCCACCAGGCCCAGCCCCTCCCTCGGCACTGCTTTCTGGGGTAG
CTGTCAAGGGCCAGTTTCTGGATTTCTCAGCACTGCAAGCAACAGAGCTGGGGAAGTTGC
CAGCTGGAGGAGTTCTTTACCCTCCACCTTCCTTCCTATACTCTCCAGCTTTCTGCCCCA
GCCCTTTGCCCGACCCACCCTTGCTTCAGGTAAGAAGTGGGCAGATGCTAGGTTTAGAGA
ATTTGGGTTGGGGAGAAGGCTTTTGGGGGAGTTGACATATTTCTCTCCATTACCCAACAG
GTGCGCCAGGATCTGCCATCCCCCTCAGATTTTTATTCTACTCCTCTGCAGCCTGGTGGC
CAAACTGGCTTCCTCCCCTCAGGGGCCCCTGCCCAGCAGGTACCTTTTATCTTCCCACTT
CTCCTTCATTCCATTTTTCTCTCTGGCTTTTTGTTTGTTTGTTTGTTTGTTTGGACTCTT
CCTGGTTTTCTGACATTCCTCCCTGCCCCCAACACACACACCCACACTTTTTGTTATAGA
TGCTTCTACCCATGGTGGACTCTCAGCTGCCTGTGGTGAACTTTGGCTCCCTGCCACCAG
CGCCGCCTCCTGCACCACCCCCCCTTTCTCTGTTACCTGTGGGCCCTGCTCTGCAGCCCC
CCAGCCTGGCTGTGCGGCCCCCACCTGCTCCTGCTACTCGGGTGCTGCCTTCACCTGCCA
GGCCCTTCCCGCCTAGCTTGGGGAGAGCAGAGGTAAGGTACAGGAACTGGAGTGCTAGGG
AGCTCCAAGAGTTAGGGCTAGCGATTCAGTGTCTCGAGATTGGGGTTGAGAGGCAAGAGG
CTCATGAATTTTTTTCCTTTAGCTGCACCCAGTGGAACTAAAGCCGTTCCAGGATTATCG
AAAACTGAGCAGCAACATTGGGGGACCTGGGTCATCACGTACTCCCCCAGCTGGAAGGCA
AGAGAAGGGAATGGGGTTACAGACTGCCCATCCCCAAGGACTTTCTTACTTTGGGGACCA
GGAGGCAGATCTTAAGCTCACTTTAAACACCCTTTCTCCTTTAGGTCTTTCTCTGGCCTT
GTCAATTCCCGTCTCAAGGCCCCACCTTCCACCTACNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNCGCACCCAAGGGGAATCGACCTCTTTGCAGCCAGTTGAAGGAGA
AAACCCTTAGGGCCCCAAAGTCTGAGGTTCAAGGAGTACCCCCTGGAGTCCTGTCCATTC
CATCTTTGGCCTCCTAGTTTGACTTATTGTTCCACTTGGTCCTGTCCCCAGGCCTCCCCA
CCCGAATACCCTGCGCTGGATGCCGTAACCTTTGGGAGCGGGCAGGCCCACCTTCTCGAG
AAAGGGCCTTCCGACGGGCAGAGGAGCCTGGGTCCCGAGGGGACAAGGAGCCTGGGTTGC
CCCCACCCCGCTGAGGGGAGTTCCCCTTGCCCCCCTCTCCCCCGGGGTTTGTATATAGAT
TATAAATATATAAGGGGGAAACGGGTGGGTGGGGAGGGGTTGTGGAGCTGGGGCCTCACT
TCCCCTCCTCCCTCCTCCCCTGGTTCCCTATCCCTGGGGCCGTTTGTTAAAAAATAAAAA
TAAAAGGATTAAAAAAATATTTCCAAAATGATTTTGGGGATGAGTTGGTTTGCAGTCTCT
TCTATCACAGTAGTGAGTGGTTTCAGTCAGGCAGCTATTTGTTACTTACCCCAGGGATCT
GTTGTAACAAAATACTTCAAGATTTACTCTTAGAATCAATCTTAAAGTTTTGTGGGCTGC
AAATTAGAGCTGGCCTCCGCTAGGCACTTAGGCTTCTTGTGCCAGTGAGGTCAGTTGGTA
ACCAGTTTGCAGCTCACAGCTAGGCTGGTTCCACAGGGATTCCCTTCTTTGGGGCCTTAG
TGGGATTGTCAACCAGTGTCTCTACATGGCTCCTCCAGCACAATGTGAGTCATTAGGCCT
ATGTCTCTGAGCCAGTGTTCTAAGAGGTCCTGGTGGAAGCTGCAAAGCTTATGATTTGGC
CTTAGAATCTCTCTTCTGCCATGCTCTATTGGTCCAGCACTAATCTAGCTAAAAGCAGGA
GGGGATGGCAATTGCATCTCTGAGTCTCAGAATTCGCAGCCACTCATCACCTGGTCTCTA
CAAACCGAGAGGAAGTTCCTTTATAGCTATCATGAACTCAGTGTTCAAACACAAACATTT
GCCATCTTGAACTGGGTAGACCAGTTCTCCCATTGTCAAATTTGGTTGAGTTGTGTGACC
ACTGCATGCTGGTCACACGAAAACTATATTTAGGTAATTAGAAACTAAGTGGTTTTGGGG
GCCGGCCCAGTGGCACAGTGGTTAAGTTTCCACGTTCCACTTCTCAGTGGCCCGGGGTTC
ACCAGTTTGGATCCTGGTTGCGGACATGGCACCACCTGGAATGCAGTACTGTGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1112, 1613..1790, 2147..2246, 2545..2617, 2959..3102, 3266..3417, 3648..3727, 3876..4018, 4323..4413, 4524..4740, 5168..5642, 6081..6271, 6501..6795, 7190..7400, 7587..9440, 9796..10067, 10264..10394, 10623..10752, 10864..10949, 11146..11379, 11511..11639, 11750..11821, 11932..12099, 12286..12368, 12538..12748, 12840..12938, 13079..13291, 13402..13514, 13820..13897, 13911..13944, 13949..14053
1001..1112, 1613..1790, 2147..2246, 2545..2617, 2959..3102, 3266..3417, 3648..3727, 3876..4018, 4323..4413, 4524..4740, 5168..5642, 6081..6271, 6501..6795, 7190..7400, 7587..9440, 9796..10067, 10264..10394, 10623..10752, 10864..10949, 11146..11379, 11511..11639, 11750..11821, 11932..12099, 12286..12368, 12538..12748, 12840..12938, 13079..13291, 13402..13514, 13820..13897, 13911..13944, 13949..14050
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved