Equus_caballus Locus BAT1
snOPY snoRNA Orthological Gene Database
Equus_caballus BAT1
Equus_caballus
BAT1
20
SNORD83
5034..5110
11292
GGTTGGAATTGGAGGAGCCTACTTCTGGGCCTAGTTGGAGCTTTCTCACCGCGACTTGC
CTACGTTTATTTGGAGCGCTTTCCAAATGTTTACGGGGGTGTTTGTGTGTTTTTGGGAAA
GATGTCTCATGAGGAGTAAGGCAACGGTGATGTGAGACCACCTGGCAAAGGTTCTGGTAA
AGCCGGAGCGAGGATACTTCTATCTCAGTTTATTGCCTGCCTTCTTACTCGTATGATGGA
GAGATGAATACCCTTTTCTGACCGAGCCTTTTCTCACGTCTCCCCGCGCGATTAATTACA
CGGGGATTTCTTAAGCACCAGAAGGAGATTTCTGAGGAGTGGGAGGCTGAAGAACTGTGG
GAGGTGATGGCAGCCATATGATGTTTTCATTTGGAGAAACGAGCGCTTTGCGCAATGATG
ACCTTAATCTATCACCCTTGACTGATGGCTGCTGAATTAGGGGTTGACACCTTGAGATTA
TAGGGAAAGCACAAGGTTTTCGAGGACTTTTCAGGACTTGTGTTCGTTTCGTTATCTTCA
TTTTCCACTACCTTAAGTAATTAATCATATTTGCTTTTCGTTCTCTTTTCTTTTTCTCCT
CCCTATTTTTAGTTTATAGATCAGGAATTTGTAAGCTGGTCTTCCTCTCCCAATTTTATT
GTTTCTGGTACTCTTATCCTAATGTTGAGAACCTGTATCCTAACCTCCCCTGGGACCGCT
TTTGCTTTTGCGTTTCCTGTTTCTTTGTTACTTTTTTTTTCCTGGTAAAGGTTTCATAGT
TAGGGGAAGTGGGAAGTGTGTGAGGATGGAAAAGTGGTGGTGAAGGCTCTGCTCATGACT
GATAAGTCTTTTATCTTTTTTTTTTCGTAGCTCTTCTGTCAGAGACTTGTGTGTTTCTTT
TCCACTACTGTTCCTCAAGCCCCACTCTCCTCCCTTGCTTTCACTTATTCTGCGTCAACC
CATCCAGAGATCCCTCCCCTTCTCTCCCTGCCGGCCTAGTTATGGCAGAGAACGATGTGG
ACAATGAGCTCTTGGACTATGAAGATGATGAGGTGGAGACAGCAGCTGGGGGAGATGGAG
CTGAGGCCCCTGCCAAGAAGGATGTCAAGGGCTCCTATGTCTCCATCCACAGCTCTGGTT
TTCGTGACTTCCTGCTCAAGCCAGAGTTGCTCCGGGCCATTGTTGACTGTGGCTTTGAGC
ATCCTTCAGAAGGTAAATTTTTTTGTTGGGTGTAGAGTACTCATTAGATTGAGGAAATGA
GAAATAGATGTGTTTATGGTTCCTCAGATATAAAGTTATATGTTTAGGATAGAATAGGAA
ATAAGGAAGTAGCAAAAACTATTTTAGCAGTAGAAGAGGTTTATACAGGTTGGTTTTTCA
TTCATGATAGCATGAAAGTGCTAGTGATCCAAAAGCACCGTAGAGTTCCACTGTTCATTC
TTTTGACTGGGTTTTCTCCTTATCTACTTGTGTTTGTCACTTTGACTTCTAATTTTAAAT
TTCCATAGAGGGATTGGTTGGACCTTTAGTACCGCTCTATTGGGCCAGGCCAGCTCTGGT
TTCTGGAAACTTTTATGGCTGGTTTAAACATGGCTGGCTTCTGGGTCAGGTACCAAGTGC
TTTATTTTGTCCAGGGTTCCAGGGTTATGTGACGCAAAGCAAAGCAGCCTAAGTAGGAGA
AATGGCCTGTGGCAGGCATTCAGTGTCATGATTGTTATAAATTAAGGAAAATGAAGACAG
AGCCAGGAGCACCAAAGGTGAGCTATTGGCAGGTGCAAGAGAGTTTGTTAGCAGGAGTGG
CGCACCTGGAGCTAGAAGAGGCTAAAGCTAGAAGGAACTAGGAGGATCTGATTTTGGGAT
GAATTTGCTTGAGGGAGCAGAGAGGTAGAAAGGGTCTGGAAGTTTACAGGAACCACTTAA
GAATTGAGTCATGAGAAATGAGTGTGATGTGAAAAGGCTTGTGCAGTTAACTGGAGACTG
GAGTCTAATTTATGTTTTTTTTCTCTACTTTTAGTCCAGCATGAGTGTATCCCTCAGGCC
ATTCTGGGAATGGATGTCCTATGCCAGGCCAAGTCAGGCATGGGAAAGACAGCAGTGTTT
GTGCTGGCCACACTGCAACAGCTGGAACCAGTTACCGGGCAGGTACACGTGGGGAGAGTG
CTGGGGAAAGCATTTTGGTTAGGAATTTTCGAGAAGAGTGTTTTTGTCACAGTTACATGA
TCCCTTCAGAACTGTGAGTGCTTGTCACTAAGATGACCTCTGTCACCCTTGACTGATAGC
CATGTGGAATATTCTGTAATAATCATGGGGATAATGACTTAGATCTCAGAAGTAAAGTCG
TTTGTGGTCTGCTGTTTATGGTGTGCTTTTACGACAACCACTTCCCCAGAGGGGATAGTG
AAGTGATATACTGTATGTTTCCATCTACTTGCCCCTCAAGGTGTCTGTGCTGGTGATGTG
TCACACTCGGGAGTTGGCTTTTCAGATCAGCAAGGAGTATGAGCGCTTCTCTAAGTACAT
GCCCAATGTCAAGGTAAGCCACCATAGAGACCTGGGAGAGTGAAGGTGTGGGTAGTCAGA
GGCATCGGAGACTTGTAGATCAGCAGTCTTCACGTCCCACAGATGTTAAATACCTATACA
GGAATCTCAGTTATATGTAACAGTAAGTTCCCGCAACCTTTGGTGTACAAGAGATTTACA
TTCCAGGGCTCATTTGGATATGCTTTATAACTTTGGAGATGCTTGCTATATTCTAATCTT
GGAAAGGCTTTAGTTTGCCTTGGTTTCTAACACATTGTGTAAATATTCCTGTTTAAGGAG
GAAACTGCATGATTGGGCTGTGGAGGAGTCTTACCACGAGACCATCCTTGTGCTTGCTAC
TTCTTTTCAGTGTGCTTTGGTTGACAGTTTGAAAATTTTGGGGGGTGTGGCAAGAGAATG
CTGGAAGCCCTAAAATAGCTCTAGTTTGGTGTGTGAATTTTGAGGATTCTTTAAAATGGC
AGAAAATTGAAAGATATTTTGGGGCCACAATAGAGTTGGCTTGAGTTGTTTTCCATTTTT
TAACCTCGATGTTTATGGGGTGGTTCCCAGATCAGTAGTTTCAGCATCATTTGGGAGCCT
GTTGGAAATGCAGATTATATGGGTCTCACCCTACACTTACTAGTGTGAATATACATTCTC
ACACGATCCCCAGGTAATTGGAGTTTGAAGAGGCAGTGATGTATATACCTTCCTATCCTC
TTGGCTAGGATGGGGTGAAGAACAGTACTCTTTTTCAGATTGTTATAGTTTTTCCTTCTA
TTGATCATTGTTTTATATTTTAAGGGAACTAGGAATGTTTGAGTCATAGCCCTAAACTGA
AAATAATTTCTTAAAAACTGAAGTCACAATAGTAGTACTTGTGCATGGTAAAAATGCTTC
AGTAATCTGGAAGGGATTGTAATGAAAAGATTAGTGTCTCTCATCTCTAATCCAGCTTCA
CAGAAGGTAATCACTTTTAACCTTTTTGGTTCTGATGAATCTGTGAAACCAAGTATTAGG
CACTGTTTTCTCAATCAAGTTACAGGCCTTTTTGATTTCTTTTCAGGAAAGATTAGTTTG
TTTATGCATTTTTTCTCCTGCTATTTGAAAGTTATGTTAATTTTAATTGTTTAAATATGA
TCTGAATGCTATGTATATACGTATGTATCTATGTTACGTATACGTGTATTTTTACATTGT
CAACCTCAATAGCATTTACTTTGTGTCTTTTCACTGAGTAGAGTTGACTAGTTGATTCTG
AAAGTTGAAAACCAGGAAACAGTTTCTATTGTTGCACATGTATTGTTGAGCTCAGTAGCG
AGCTAGGATTGCACTTCCTCCTCTGTAAGGTCCAACTCATCACCTTTGTGCCACTCATAA
GAGAATGTTCTTGCTGACAAGATCAGACACAGATTGTCATCACATATTCTTGTCTTTTGC
TGAAAATTGTGTTATGGTGACTTGTTAAAAAGGCTGGACCAGTTCAACAGAATGTCCTAC
CTCTGGATTTGTCTGGTTACTCCCTTACGGTGATGTTTAGCTTGTTCGTTCTTCCCAGTG
TTTCCTGTTAACTGAAATTTATATTTAAAAGCTTAACTGATTCAAGTTAAACATTTTTGG
CAAGAATTCTTCATAGGCGATGCTGTCTACCTCCTGTTTTGTTGCAAACCTGGTTATCCC
ACAATTAATGATTTTAGATTTATGATAGAATTGGGGTCATGACAGTCTGATCCCTTGATT
GATCTTTACTGCCTTGAAACTAGAAAGCAGTTTCTGGTGGTGTTTGTTATTGTACATAGG
CCAGATCCTCAACAACTGTTTCCCTAATGGTTTTAACACAAAGGAATACTTTGAGCGTGA
ATCAGTAATTTCCTAAGGTTTATGGAAAGGAGTTTAAAAGTCTGGGTTCAGTTAGGAAAA
CTTGATGTTCCATGAGCTTTTTGTGGTACTTGACACTCTGCTGATTCTTCCTGTCCTCAT
TCTTAGAGTGAAGCCTGACCTTAGAGTTGTGGGAAGGAGGATTGTTAGACTGAGTCAGAA
GAACTAAATGCTAGTCCTGACTGGCCTGATTAGCCATGTAACTTTGAGCAAGTCACTTTT
GTTTCTTAACATCAGTGTTTGAGGGGCATAGTAAGAATTTTAGATTAGGTGACCTCTAAT
GTTCCTTTTAGCTCTGAAATGTTAAGAATTGTTTTAGATCGAACTGAAAGGATGGGAACT
GTGGGGGGATTGGAATCTTTCCCTTCTTATGACACACTCTTTTTTTCCTGGGTTGGCAGG
TCGCAGTGTTTTTTGGTGGTCTGTCTATCAAGAAGGATGAAGAGGTGCTGAAGAAGAACT
GCCCACATATTGTTGTGGGGACCCCTGGCCGCATCCTAGCCCTGGCTCGAAATAAGAGCC
TCAACCTCAAACACATTAAACACTTTATCTTGGATGAATGTGATAAGATGCTTGAACAGC
TCGGTGAGTGGCAGTGCTGGGACTGGGCTAGTGATCTAGGAGTTGCCCTTTGGAGCCAAA
TGATGTTTATTTGATAGAGGAGCACTTTAGTGCCAGGACGACTCTTAATCTATCACCCAT
GACTGATGGCTCTGGCTTCCCTGGACGGTCTTTGTTATGCTTTTTAAGCAGCCGTGGTGA
TCAGTGAGAAGGATGTCTTGTTCCTCCTTTCTATGATAGATGTTACCACCCTTTCCTTTC
TATACTGGGTGTTGTAGGGGAGGTATTAAGCTGAAGGAGGAGACAGTCTACCCTTCTTGC
GTGCTCAGCACAGCATATATCATCAGAATTTATAGCTGAATAGATGGCTAGACTTAAGTT
CCGCGATTATTGTGGAGAATGTTTGTGGGGGGTTTGTGTGGCATGGTATTCTAGTGTGCT
AAGTGGAGTTAAGAAAGGAAAATTTTCTATAAAAAGTCAAATTTGGTAAATGAGAGAGTA
GGGTGGGCATATAGCCAGGGCCAAGTCATTCCAGATGATCTTTGGCTATTCTAGATGGTG
AGCAATAAGCAGGGCTGCAGGTAGAGATGTCATATTTTCCTGACTGGATAGGAAAATGTG
ATCTAGGGGAAGCATGGAATGGGTTCTGACAGCTGGAATATAGTAGGTGTGAGATATTTG
TAGACAGCTGGGGCTTGAGGAGAGGGGTAGGGAGAATGGGCTCGTAAAGCATTTTTCAAA
GGTCTTGTGAGTCTGCAGTGGGCTTATCCATATTTCATAGTTATGGGCTTTGAGGTTTTG
TCATCTTATTTCTTGCCTGGTTAAAATACACAGAACTGGCATCTAATCCCAAATGTTTAT
TCCAAATTAATTGCCCTTTCCATTGTGTTACTACTATAGATGTGATTTCATGGTGGTTGT
AGAAAATAGATCTGAGGCAAATCTTTCTCTGAAATAACTCTTGCTTACCCATTTCCAGCA
GTCTTCACCTCATTGAAGCCTCTCTGGTTTTTGTTCTTGTTTATGACACATTCTTCTTTT
CTCCTATAATTTTTTCCCTTTACCTTGTAGACATGCGTCGGGATGTCCAGGAAATTTTTC
GCATGACCCCCCATGAGAAGCAGGTCATGATGTTCAGTGCTACCTTGAGCAAAGAGATCC
GTCCAGTCTGCCGCAAGTTCATGCAAGACGTAAATACCCTTCTACCTTCTCTCCCTCCAC
TCCCCGCCCGCTGCCTCCTCCCCTTCCGCGCCCTCTTCCTCCAGACTCCCTTGTCCTTCA
AGCGCCAAGAAGGGGGCATGTGCCCACCTGGGAGTGATGACTCCTTGAAGAGACACATAG
AGGCAGAGACAGCTAGTGTTAGGGTCTGCGCGGGCGCCAGGGAAACTCCGGAAGACTTGG
TCGGGTTAACGTGAGAGCGGGTAGTGTTCGACTTTTTTTTTTGAATCACAGCATTTTTGA
ACCTCTTCTCCATTTTGGGGGAGGGCAGGATTTTCTGCCCTACTACCCATCTCCTACATA
CCCCCTACAGCCACGCACCCTCAAGGTGGCATCGAGCATTCAACTGGAGCCTTCTGCTCC
CCAAAACTCAACCTCCCGGTGGCAGGAGAGCAAGAGAGGGACAGACAGATGGCAGGGCAT
GTCCAAAAGAAGAGCAAACAGCACAAATGAATCCGCTCCCTCCCCATGTCCAGGGGTGGG
GGCCTTTGGCACCTCAATCCCCAGTCCCTTGCACCTTCCCACCCGTACCTCCTCGCACCC
ATCCGGAACCTCGGTTGATGTGAGCCGGCAGCAGAGAAGCACCGTGGCGCGGCGGGGGAA
ATGCAGACGGCACCCGGCGGTGGATGGCGGCAGCGGAGGCCGCGGGGAAACCTGCCCAGG
AAGCTGAGGACCAAACCAGCCTCTTTTTCTGTTCCTGGTTTTTTTCCTGAACCCAAGGCG
TGCTGTGCTCCCCATTTCCCCCCATATGTGTTGGGGGGAGGGGTGTCCTGAATGGGGTGG
TAGATTTTTTTTCTTTTTTTAAACATTTTTTTAATACTCAGAGGAGAGGGATATGGGAAA
GGTAAAGTGATGAGCTCCACTTGGATGTAACCAGGTGGGTGTTAGAGTTTGGGGCTAGGA
GGGGCCTGTTGTACAAGCAGTGGAGTGTGTGCTTTCCCTCCCTGCTCTGCTCCTTCCCAT
GGGATGATAACTCTTTATCTGTAGCTGTATTTGGGGCTAGAATTAGATTTGAAGGCGGCC
ATGGAACTTCTCTTTGGAAAGCCTGCCTTTGCTAGCCTTCTGGGGTTGGGCTTCTGGGTT
TCTCCCATAACACACACATTCTTTCCTCAAATCTTGGACCCTGGGTCTTCGTGTTAATTA
TGTGCCTCAAATTAGTGAAGAGTCCTAGGAGAATTGGGCTCTGGAGTTGAGTCTTGTGTC
AATTTCTCTTTTTCATGCTACCTTCCTCCCCTTCAAGGGTTGTGCTTTTTTTTTTTTAAA
GAGATGAATGCATATCTGCTGCTCTGAATTTGTTAGCACCACTTATTGATACAATCCCTG
TAACACTATAGTTGGTTTCAGAGACCGGTCTCATCTAAAACTATTCTCTAGTGGTCCGAG
GGCAAGTTGTTACTCATTTTGAGTAATTTTTGCTTTTCCATTCATGACATTTTGACCATG
TCCACTGCAGCATTTTGATCTTAAAGACATCTACCCTCTTAACGTGGATATGCTTCTCTT
AGTTGAGAGAGTACTCAAATGGAGCAGTCTTTGTCCTCTCTCCCATATTACCATCACTGG
CTCTGATGGAGTTATTCTGACCTCGAGTCATCATTTTCCAGGGGTTTGGGTCATGTTCTC
CCTTTGAGAACCATCTCCCAACTGTTTTCTTTCCTCTGCCACCTCCATCTGAGGTGATGG
CATATTGCCATTGGGAGGTTTCACTGCTCCTTTTCCTCCCTACAAAGTTACCTTCCCATG
ACTGTTTTCAGTTGGGCAATCTTAAAACTCGAGTGATTGGAAGGAAATTAAGTCTAATGT
GGAAGAGACCACATTAGAATGTGGATATTTTTGGGGGTGGGATGGGGTTTTCAATCTTCT
CTCTTCTCCCCATCTCCCCCCATGGGGTGTATTGGAGATCAACTTCCTCCACCCCCCCAA
GGTTTAACCCCCCCACTCTGCCCTCCTCCCGTTCCCCACCCCCTTCCTCCCCCCTCCCCC
CCAGCCAATGGAGATCTTCGTGGATGATGAGACGAAGCTGACGCTGCATGGGTTGCAGCA
GTACTACGTGAAACTGAAGGACAACGAGAAGAACCGGAAGCTCTTTGACCTTCTGGATGT
CCTTGAGTTCAACCAGGTCAGTTGTTCAAGGTCCAGTAGGGGAAGGAGCACTTCTCCAAC
TGTACAAGAAAACTATATTAAGTACCCTTTTGTTGAGAAAACCACATGTGATTTGAGAGA
ATGGTGGAGAATTTCTCTTAAATGAGAATGTAAACATCTTTTTTGGGGTTCAGCATGAGC
AAGTGGGAACTGCTTTTTTGTTTTATGGCTGATACAGACAGGTACTCAATAAATAAAAAC
TTCAGTGAGTAAATCTAAAAATACATAAAACCGTTGAAGAGTTTAAATAAGTTTGTAGAA
GTCCCGAAATATCTTGGGCCTAATAGTTTCCTAAATTTGTTTGTTTCTTCTTCTGTCACT
CACTGAGAAGAAGCCTTCTGCCACTGTACATGTTGTGTGGTTTGTTTGCACTAAAAACTA
CTTTTTAGAATTAGGGTAGGTGGTTGTGTTTGATATTTTGATAAACAGGAATATTGGTAA
TGGTGTTTCTAGACCTTGGTTCCAGTTTTTACCATTTTTTTATAAGGTAGCCTCATCTTT
GTCCCCTAACATGTCTGGTAATTTTGGCTACTGTTCTGTTTACCTTCTGTGTAACAAGTC
TGCTGAGGAAAAAGCAGAGCCGAGAGAGAGAGAGGCTAAGTTATATTTAGAACAGAAGAG
GAAAATGTGTGATGGGGACTAAGAGGGACTAAGGAATTCTTTTAGAAGAGTGTAATCACT
GAAAACTACTCTCTCGCACAAAATCTCTCTCACACACCCATGGACCCACATCCTCCCTTC
ACACACACACACACCCCCACGCGCGCACACACACAGGTGGTGATCTTTGTGAAGTCTGTG
CAGCGTTGCATTGCCCTGGCCCAGCTCTTGGTGGAGCAGAACTTCCCAGCCATTGCCATC
CACCGAGGGATGCCCCAGGAGGAGAGGTGAGTCAGAGATGGGGAAGATGTTTTGCGTCTT
CGGGAGGAAAAGAGGCCCTTGAGAAAAGGAAATCTCAACATTTTTCTAATTTCCTTTCTC
ATGAAGGCTTTCTCGGTATCAGCAGTTTAAAGATTTTCAACGACGAATTCTTGTGGCTAC
CAACCTATTCGGCCGAGGCATGGACATCGAGCGGGTGAACATTGCCTTTAACTACGACAT
GCCTGAGGATTCTGACACCTATCTGCATCGGGTAAGCCCCACACCGAGAAGGACATCCCA
GTGTCCTCTCCCACTCCCTTATTTTCTGTATCTTTTCATACCTTCCATCTTCATCCCTCC
TTTTGGGTATCTTCCCTATTTGGAGTTTTCCATTTCTATTGTCTGTCTTCCAGGTGGCCA
GAGCAGGCCGTTTTGGCACCAAAGGCTTGGCCATCACATTTGTGTCAGATGAGAATGATG
CCAAGATACTCAATGATGTGCAGGATCGCTTTGAGGTCAATATTAGTGAGCTGCCTGATG
AGATAGACATCTCCTCCTACAGTGAGTATTGATCTCGTGAAACTGTCTTCCCCAACTCTT
TAGATTCCCTTTGTGCTTTAGTGTGTTTTATCTTAAATCCTATTACATACTCAAAGCCTC
TGCTGCATAATGGGTGCTTGATAAGTTCATGTCCTCCTGGTCTTGATGCCCTGTTGGGAT
GTTTAATTGACCTCAGTAGGGGTCTCTTCTCTTGTCACATTATTGTCCTCCACCCCTAAG
TCTCTCCTCTGAACCCACACACTGCACAGACATCTGCATGTATGGGTGTGTGTGTTTCTG
CCAACCTGGCTTTTTCTTTTCCATGTCTTATTCTAACTGTGCCATGTTTCCTCTTCAGTT
GAACAGACGCGGTAGAGGACTTACCCACCCATTCTGGAATGTGACAGCTATCCCTCTTCG
GGAGACGACACCAGGTGTGGGGGTGAAGGAGACACTACTGCCACCTGCCCCTGACAACCC
CCAACCCCCACCCCATGGCTTCCCTCTTTTGCATCACCACCACTCCTAAACTCCCATTTC
CTGATTTGTCAGAACTTTTTTTAACAAAACTAAAAAACATATGCGTCTGTGGTGTCTGTA
AACGCTCCGTCCCTTTATTGAATTTGGGGTGAGGTTATTTTATGGTATGATCAGTGTATA
TTCCTGAAAGGACTGCTGTGGGGCAGAGGTCAATGGCAGGGGGTCAAAGTAGGGGATGTG
ACTAAAGAGATTGCAGAGACCATGGCTTTCCACTTTTTTCCAATTTCTGACCCTTTGTAG
AGGTGTCTTCCATTTTTCTGAGTGGCCTGGGAGAGGCTGGGATGTTTCTGATTGAGGAGC
TCAGGGGGCTCGTGTGCAGTATTTCCATTGTTGGAAGGTGAAGTGGGAACTGGTGGAAAG
CTTAGCCGTCTCCTCTCAGGCTCTCTCTGTGTCTTCTCATCTCTTCCTTCCGCTTCTGGG
TCTTGAGCACCAGGGCGTGGGCTTCCCAGGCCCCTTGTTACCCTTCCAGTAGGCCTGGGA
CAGCTCCAGCTGCTGCTCCAGCAACTCCTCAGCTTGGGCCAGCTCAGCTGAGAGGGTGGG
GCTGGGGATCCTGGGTGAGGCGGGGCATTGGGGAGGCAACTTCATCAGCCAGGACAGGGG
GTTTAGGCTCGTTGGAAGTCAGGAATTAGGCCTCTCTCGTATCGATGCCATTTAAGGTCA
TCTGTACTGCTCAGCCAAGGTAGCTTCCTATCTTACGTTGAGATCGCTGGCCCAGGGGCT
ATAACTGGCCTCCTTGTACAAGGATATGGGGTCATGGGAAGGAGAAGAGTGGCTGTCTCT
ATCCCCTAAGAAATAATTAACTCTTAGATGAGGGGAAATTCCTGTTCAAGGACTTAATGG
ACTGTGCAGGTATAGAAGGGTGGTGGGAGAGGGAGCCTTGAGGTCCATGACATGTGAAGC
AGGGAGCGGTCTCAGCTGCGCAACAGCCACCAGAAACTGGCTCCCTGTGGTCCTTCGCCT
CGCTTCAGTGCCTGCCCCTGCCCCTGGCCCACTCTGTTACCCCAGTGTCCCTCCCAACCT
GGCCCCAGACAGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1211, 2014..2141, 2440..2532, 4799..4982, 6030..6148, 8164..8295, 9096..9205, 9306..9450, 9593..9740, 10078..10292
1001..1211, 2014..2141, 2440..2532, 4799..4982, 6030..6148, 8164..8295, 9096..9205, 9306..9450, 9593..9740, 10078..10091
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved