Equus_caballus Locus ENSECAG00000018348
snOPY snoRNA Orthological Gene Database
Equus_caballus ENSECAG00000018348
Equus_caballus
ENSECAG00000018348
17
SNORA31
4463..4592
5750
GTACCTACTAATTGGGTCTAAAGTCCAAATAACTCTTGGGCTGGTGGGAAGCTCCCTGC
TTTTATGTTTAACCCTCTAGCATCTGGGACATAATTCCAACTTCGTCTTAAAGTGACAAC
AGACTCTTTTTTCAAACAAAGGACATAATTCAAGACAAGTGCAAACAGAAAGGGGAAGAG
CGCTTCAGCTGTCTGCCTCAGGAACCCGCAAACTCTCAAATACGGGATTACAAGGAGATG
GAAAGCTGCGCCAACTCCGTGACACTTAGCTTCCTCCCCAAGTCCCTTCCCGCAGATCTT
GCGACCCCACGACTGTCGCCGGAGGCTACCGGGACGACCTGGACCCCACTACCCGCATCC
GAAAACTCCAGCTGGGGCAGCCGCTGAGGCAAATGCGGAGAAGTCCTCTGAGGCCCTCGG
AGATCACAGAGGTCGGTCAAAAGCCCCGGCCCCGGCTCCCCTCCTCGAGGACACCCTCGC
GGTATCGCAAGGCCTCAAGAGCCCGTCCCGCGGTAGATACAAACTGCCCGACTGCAGCTG
ACATTCTCGCCCCAGAAAGGGGTGGGAGCCTGCGCTCGGCGAGGCGCGGGGCGGAAGCTG
GAAGAGATTCCATCTACGCCCCACCCAGGCCCCAGGGCCGGGCGAGGCAGCCCCGGAGAT
TAACGGGCAAAACCCCAGACCCCGCTTGCCTCTTTCTCTCCCCGTGAGGGCCCGGGAGCT
CCTCCCACCTCCCTGCAACCATCGCTCACAAGAACCCCCGCGCGCTCCGCGGAATGCCGC
ATTGTGCCCCTAGGTCAAGTCCCCGGATGCTCGCCTCCCCTGCCTCTGCCCGAGCTGTGG
TCCCGCCCACCGCGCGCTTTGCGTGCCACGTCACCGCTTGCGGAACTTCCGGAGGCGCAG
CGGGCGATGACGTAGGTGGACGTGCCTCTATATGAGGTTGGGGAGCGGCTGAGTCGGCTT
TTCCGCCCGCTCCCCCTCCCCTGAGCGCGCTCGGAAGCACCCCGCTCGGTTCGGAGCTCG
GGCTCCTGGTAAGTTGGGCGCGTCGGTCTCCCTCCGGCCGTCACATGATCATCTACGGGA
CCTTATCAGCCGTGAAGTCGTGACTGCATTACCTTCCTAGCGCGCGCAGGCGACAGAGCG
TGCGAGTTGGGACGAGGACGACTGACTCCGCGCTGTCGTGGGCCTGGGGACGCCGGCGGC
CGTCCCGGGAGCGGGGAGGGCTCGGTGTCTGGGGGTCGCGGCGCGTCTTGAGTGCCCGGG
CAGGGGCGGGGGCCTCGTGCGGGCCGGCCGGCACGGGAAATGGCGCTGGCCTTGGCCCCG
GGCGCTCGGTGACGGGCGGGTCTGTGTCCTCGAGCAGATGATGAGATGTTCTCCGACATC
TACAAGATCCGGGAGATCGCGGACGGGCTGTGCCTGGAGGTGGAGGGGAAGGTGAGTCGC
AGGGGCCACGGCGCGGGCGAGGCGAGGCCGGGCAGGCTCGGGTTTCCGCCGCTCCCCCGC
CCGAGGTTGTGCAATCCTCTCCGCTGCCTCCTGGCGGAGGAGACGCACTTTCCGGGCTCG
GGTTTTTCTAGAAAAGTGGAGGCGGAGCTGAGGCTGGAAATAGGTCCGCCGCCTGGGCGC
CCATCCTCCCCCCGGGCCGTCCGGGACAGGTTGTCTGTGGTTTGGGAGCCCCAAGCCGTT
CAACGTTTGCCTTCTCCCTGCTGGCTCGTCACCCCGTAGCAACCCGAGACCCCACACGAA
ACTTCCACTTGGTTGTGAATGACCCCGTTTTCGTTCCGGTCAATAGACAAAGAATTTTTG
TTGAGTTAAGATGTTCCAGGAAATCAAGGAGTCATAAATTTTTTTCCGCTTAATGACGTT
TTCGTGGTTTTCAACAAGAACGAAGAATGTTTGGAAGGATAATGAGTTTGTGAACTGCTG
GCATGGCTGATTTTTTGGATTTTTGGATGTGTTTATGCCAAGGTCAAGGATGTCTTCTGC
AACTAAGTTATTTTTTCTTAATGCAGATGGTCAGTAGGACAGAGGGTAACATTGATGACT
CGCTCATTGGTGGAAATGCCTCCGCTGAAGGCCCCGAGGGCGAAGGTACCGAAAGCACAG
TAATCACTGGTGTTGATATTGTCATGAACCATCACTTGCAGGAAACCAGCTTCACAAAAG
AAGCCTACAAGAAGTACATCAAAGATTACATGAAATCGTAAGTGACACTGGCACAGCCAG
CTCATGGCTGGGATGCTGTAGGGTTTAGGGATTGACTGACTTTGAGAGGTTCTTTAGCAG
CAGCAGGCGCACTTGTGAAAGGCCTTTTTTTTAATTGATGAGCTCACAGGGGTGGTTGCT
TTTCTATAAATAAACTAATGAGAGCGTACTGGAGCATGCAGTTTGGTTTTGGCTTTTCAG
ATAGTACTTTGGAAATAAGTTATTATGAGATTCAAAATTGTGAACAGTCTTGAAACATCT
GTCCTGTGAACTAGTAATTTGATTGTGCTGTGTTATTTTGCTCCCTGACAGCTAGTTGCC
CTTTTCAGTATGTGTTTGTTTTCGTTTGGATTTTTTACTTAATGAGATTTATTTTGCTCA
GAACTCCATACGTTAACCTATTAATAAAACATTGTTTTAGAATCAAAGGCAAACTTGAAG
AACAGAGACCAGAAAGAGTAAAACCTTTTATGACAGGGGCTGCAGAACAAATCAAGCACA
TCCTTGCTAATTTCAAAAACTACCAGGTAAATACCTTAAATATTTGGATCAAAGGATTGT
ACAATTTTAGCTGTGAGAACAAAAAATTAGTTATTTGATGAATCTTTGATGTAATTAAGT
TGTGGATATTTTTCTGGGCTTTTGAGCAGTTTAAATAATTGAGATTCAGCTCTAGCAGTT
GAGGCTGTAGAAAGTAATGTTCCCTGTTCCCAAGGGTGTTTCCAGATCTTGTCTTCTGAT
TCCAGAATCTCATCCCTACTCGCCTCCCAGATCACATTTCTCAGTTCCTTTCTTGAATTA
CTTGTTAACCTCTTAAGTGGTCTTCCAGTTTCCTTTTCCTTTACAATTCCAATATGTCTC
ATTGCCACTGGAGCTCTTTCTGATCTGAGCTTGTTCTGTTGGGAAACTGCAGTGACTTCG
CCTTACCTCTAAGACATGAACGAAAAACCCATCACAACCTCGCTCTTAAAGTTTCCAGCT
TTTACATATTTTCTGGCCATAAGAGAACTTTCCCCCTGTGATGTGCTGTTTCATTGGTAG
CCTTATGTTCCCTGTGCTTGACTGTACCAGGCTTTTAGGGTTTGGAATTGTGTATGTGGG
GCTGAGAGAGAAGTTTGCAGAAAGCCTAAAGTGTTCCTGGATTGCTCTGTACTCATGCTG
GTCATTATTAGTGCTTTAATTGGGTGAACAGAAGTTTGATTAGTGAGCATTTTTTCTTCT
AGGGATTAGCGCCTTTAGTTGCTGAAAGTCTGCTGATGAAATTGTGGTGTTCTCAACCAT
CCTTTTTTTTTGTCGTGGTTTGTTTTGATATGACATGTCTGTATATAACGGTCTAATTGT
GGGTATTTGTTGTTTGCTTCCTAAGTTCTTTATTGGTGAAAACATGAATCCAGATGGCAT
GGTTGCTCTGCTGGACTACCGTGAGGATGGTGTGACCCCGTATATGATTTTCTTTAAGGA
TGGTTTAGAAATGGAGAAATGTGTAAGTATAAGGAAGTGGGTTGAAATCAGTAAAGTAGA
AATGGAGATATCTTAGGTGTGGTTCTCCTTGTTTCATGCCACTGGGGTAGTTAGACTGGA
TTCTACAGCATTCCTTTTCAAGTGTTCCTCTTACTTTGGGGCTCTAAAGAGGGTTGTGTT
TCACGTGAAAAATTTTATGGTGCAGAGACTTAGAATCTTCTTTAGCTAAAGAAAACTTTA
TCATCAATGGTATTACAAAGCACAGCTTGAATACTGGAGATCAGAGACAACACCCTGTGT
TGATCTTTCCCTCTAGAAATGGCCTGTTGAAATCAGACTGCCTTTTTCTTCCTATTCTGC
CACACAGACATGAGTGTCAAAACCTTTTTCGCTTTGGTTTACTGATAATTGACAACTGGT
CATTGAAAGCCTTGATGTTAACTAGCTATTAGAAGGTAGAGTTTCAAGCTGGCTGCTGAC
TCAATATGGAAATTACTGTAGTAAAATAAATGGATGAATGTCTGCTATGCAAGGAATTGC
TGGAGGCAAAACAAATGAAAGCATTCATTATCCTGGCTTTCAGAGGCTTCCACCTAAATT
AGGAACAAGATAAACTTCAGGCCACACTAAACAAGATTAGAGTCAATGATGGACAAAAAT
GTCTTAGGACAGTACAGATGGCTTGCTAAAGGGATTATGCAGAGAATATCTGAGTTTTTG
TTGGTAGAACAAAGTATATGCGAGTGGGACTTTGCTCAGAATGAAACTTTCTGGAAAATG
TGCTGCCTCTGGTGAGGGTGGCTCTGCATCCACTGATAGACCTTGAACAATTTGCTGTTG
TTCCTTTGGTTTGCACTAGGATGCGAAAGAAAGAAATCCCTGCGCTTTCTGCCTGTCTCT
GTGGCGGCTCAGATTGAATAGGGGAATACATCTGCAGCCTAGAAATGTTAAGTAGCTTCA
TATTGGAAAAAAGTGTTAATACAATTTTCCCTTTTTTTTTTTTTTACAGTAACAAATTTG
GCTATTACTTTGGATCTACACCTGTCATAACTGGCTGCTGCTTTTCATCCACACAACACC
AGGACTTAGACAAATGGGACTGATGTCATCTTGAGCTCTTCATTTATTCTGACCTTGATT
TATTTGGAGCGGAGGCATTGTTTTTAAGGAAAAAACATGTCATGTAGGTTGTCTAAAAAT
AAAATGCATTTAAACTCATTTGAGAGAATGCCTCTTAGTTTAATCCGTATTTAAATCCAT
CTTGTGTAGTGTTCCTGGAGAAGCTAGAGCCTGGTTGTAGACCACTACTAGAAAGCATAA
GACTGCCTTCAGATCACTTCTACAGTGAAAACTACTTCCGGGACTGGAATATAAAAACCA
AGAACCACAAGTCTTAATTCTGAGTTGAAGTAAAGGGAAAGACCATGCTCATAGCAGTGC
CAACATTTGAAGTGGATTCCTCAGACATTTCATCACCTCCAAACGGAAGTAGTTAACCCT
GGAAGAGATTACCAAAAGAATAAAAAGAGACTAATACAGTTGGAAGCAAAGTATTGTGTC
AGCTTATTTATCCTAATTCAAGTAGACCCAAGTTCTAGAGAAATCTAGATGTCTCCTGGA
ATGAATGCTTGTCAAACTCCTTGGAATGGGGTTGACAGACTGGCTTGTCCTGCCACCTGT
CTTTGTATGATTTTAAAGTGGTGGTTACATTTTTAAGTGGTTGAGAAAAAATCAAAGTAG
CTTATGGGATGTGGAAACTTACAAAATCCAAATTTGTGTCCAGTTTTATTGAAACACAGC
TATGCTCGTTTGTTTGTGCATTGACTGGCTCTGATGCTGCAAGAGCAGAGATGAGTGTGA
CAGAGACCTTTGGGCCTCAAATCCTGAACAAACCATGTGGCCCTTTACAGGAAAGGTTTG
CCAGCCTCTGCTTTAAAAGATGAAACTATAGATTGAATATGGGATAGTTGGTGGCAGAGG
AAAAAGCAACTGTCGGGGCAGTATATTGTATCTGGGAAGGCTGTGGGTATCAGAATGAGT
ATATGAAAACGCATCTATTTGACAGACCTGGAGCAGTTACTGTCTGCTGCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1090, 1357..1430, 2006..2196, 2620..2725, 3565..3681, 4669..4750
1075..1090, 1357..1430, 2006..2196, 2620..2725, 3565..3681
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved