Equus_caballus Locus ENSECAG00000010661
snOPY snoRNA Orthological Gene Database
Equus_caballus ENSECAG00000010661
Equus_caballus
ENSECAG00000010661
17
SNORD102, SNORA27
1828..1898, 2168..2295
4301
ATAGGTTAGGTGAAACTGTGTGTCTCCTTGGCAGATGAGTTTTATGAAAAACGTACACT
GGAGTCGCTTTTCTTTAAGATTAAAGAGTGTTAATAAATTGATGACGATTCATGTTAGAA
TAGCCAAAAAGTTAAGCCTGACTTGTATATTTTCCCTTGTGGTAGGAGTGATTGCAAGCC
GTGGTAGTTCTGCTCTTGGATGACCTGAAGCAGTTGAAACGTTTTGCAAAACGATAAAAG
ATCCAATTCTGAATACCTATAGGTGAATTCATCGATACTGATAAATTAGCTACCATTTGC
TGTTAAGCACTTTACCTGTGCTAGGAATTGGTTAGTGCTTGTAGACATTACCTCAGTTAA
TTGTAAAAGTATTAACTCCATTTTACAGATAAGGATCAGGATTTAAATGTAAGTGTCCAG
CAAGTAAAGGGCAGAACCTATGTGAAAATTAGGTCAGTGATTATAAAGTCTGTTTTTTTC
CTTTACATTTCCTAGTAAACAAACAATCTCTCTAGTAGTGGATTTTTGACAGTTAATAGA
TGCTGTATGGGGGAAATAATGCCGCAAAAATTAGGTTGATAAGGGGTTTAATCCACTCTG
TAAAAATGCAAGGCTGAGTTTTGTCGTGTTTTCCAACAAATTATCTTCTAGTTAGTAATG
CCATTGCCCTTTTAATGGGATACAGATAATGCGGTGGAAGGCCTGTTGTGTTTTTATATT
CTAGTAGAGAAAGTACTGGTTTGGATTTTAAAATCTGCTTCTGCTACTTAGGAATTTTAA
TGTTACAGAAACTTGGGTAGTTTTGGCAAAGATCTTGCTAAAATGATGGGGTTTTTACCC
TTTATAAGAAATAATGATCGGTGAGCCACCTTTTTAGATTATCCGCTAATTAATTTTGAC
GTTGCTGCTGAAATGTAAGAATTTGAAATTACAGGGTTTTTGGTTAAAGGGGCAGATACC
AATTTTGCAGTTGTATTTGACTGTTTAATACATTCTGGTTTCAGTAATTCGCCAAAATGA
CCAACACAAAAGGAAAGAGGAGGGGCACCCGCTATATGTTCTCTAGGCCGTTTAGAAAAC
ATGGTGAGTAGGTTCATCCTCCTTGAGAGCAAGCATGGCATACATTTGTGTATTATTAAT
ACATGTGTCTTACGGTTCATATAATGTGTTCTCAATAAATGGCATTAATTGACCAATATG
TATCTAACTTATTTTGTAATAAATACAAAGCATGAATTTTATATAGTAGTTCTTAGATTG
TCAACTAGCAAGATTGTAAAATATAACTGTCAAAGGTGGCGTGTGTTAGTGAGGCTATGT
ATTTCACTGTAGACTTTAATCTTGATACTGACTATACTGATTTTTTTTGGACAGGAGTTG
TTCCTTTGGCCACATACATGCGAATCTACAAGAAAGGTGATATTGTAGACATCAAGGTAA
CTTATAAAATTGGAGAAATAACCTACAGAATAACATTGGAACCTAGAAGTTTGGATTTAA
TCTAATAGTGAGATTTAATTACTTGTCTATATTGCATCTGCTGGCTCCTTTCTGTTCTCC
TAAATGGGGAAAAATCTATTGCCTGAATAAGAGCTCATAAGAGTATAGAATGGCTAATTT
AATTTTAACTGAGAAACCAGAGTTTTAAGTGCTATTCTTAAGTCTAAAATTTTTGTCATT
ATTTAACAGCTAGGGGGAAAAATCATAGGAGTTGAGGTGAAAAGGAATACCTTAGTGCAA
AATGTAATTGTTGTTGGAGATTACTGTTAAAATAATAGTGAAAGCTGTGTTCTTTTGTGA
CTAATGTGTAAATGTATTGACACTCTAGAGCTTAATGATGATTGCCTTTTTGATTGCTTG
AAGCAACGTGAAAAACACATTTCACCGGCTCTGAAAGCTCGAGTTGCCATTTAAAAGAAA
AAAAAAATCTTAGAATATCTTAGTTACTTTAATAAAAATCAGGGTTTAAAAAGTGGGAAA
TTTCCGGCATAACATTTATCTCCTTTCTTCACAGGGAATGGGCACTGTTCAAAAAGGAAT
GCCCCACAAATGTTACCATGGCAAAACTGGAAGAGTCTACAATGTTACCCAGCATGCTGT
TGGCATTGTTGTAAACAAACAAGTAAAGTGAGTAATGGCAGTTTTTTGTGGTGATTAGTA
TTTCCTCATACCCCCTTTTCACTTTGCCAATTGGACTTATGTCTTTATTGGTCATTCAGG
TGGGGGAAAGGAAAAGATCCTTTTAAAACTCAAGCAAACTGAGTGTTTGTCTTGTATCCT
GTCAGAGGAAACAAATTGAAAGAGACTTACTGGAAAATCTTATGGGAGTTAGTATTAAGC
AGTTGTTGTTTTCAGTGTAAAAAGTTTAATAAATTTAAATTTATTAGCAATCTAGTTTTA
GTTAAATTATTTAGTATTTCAGGGTCTGTCACCTCATCAGAAGAGAGGGCTTAAAAGTGG
GGATGTTTGCCTCAAGGCCTCCTCCAGTAAGATTAATAAATGATTCTAATGTAGCCCTCA
CCTTGTTGACTTAGTCTCTCTACGGGTAAAAGGTTGAGGGGCCAGTCCCATGGCCTAGTG
GTTAAGTTTGGCTCGCTCTGCTTGGAGGGCCCGGGTTCTGTTCCCAGGTGCGGACCTATA
CGCTAATTGGCAGCAGTGCTGTGGTGGTGACCCACATACAAAATAGAGGAAGATTGGCCC
AGATGTTAGCTCTGGGCCAATCTTCCTCAACAGAAAAAAAGGTTCATGGCTTATTTAATA
AATGAAACTGCTAGAAAAGTTTTCTGAATTTCAGTTATATTTTTGATGAAGCATTTATGA
GTTTCTGCTCTCTCCAGGGGTAAGATTCTTGCCAAAAGAATTAATGTACGTATTGAGCAT
ATTAAGCACTCTAAGAGCCGGGATAGCTTCCTGAAACGTGTGAAGGAAAATGATCAGAAA
AAGAAGGAAGCCAAAGAGAAGGGTACTTGGGTTCAACTGAAGCGCCAGGTGAGTGCTTGA
CAGAAGGTTTCTTCGTATTGATCTTAGGAACTTTAAAACTGTTCCTCAGCGATACTATTA
TATGAAAGTTAATGAAGTTAGAGTTGAGTATATTGGTTATTTCATTGGTTCTGAGAATGC
TTGGGAATTGAGTTACAGTACTTTACATAATGATTCCCTTGCCTTTTTTTTTTTAATAGC
CTGCTCCACCCAGAGAAGCACACTTTGTGAGAACCAATGGAAAGGAGCCTGAGCTGCTGG
AACCCATTCCCTATGAATTCATGGCATGATAGGTGAAAGAAAATAAAAGACCTCTGCGCT
GTAAAAAATGTTTCTTTTAATTGAGTGTAAGTGTGGTGTCCCTTCCCCTAAAGAAATATT
TAAAGCAATCTTAAAAATTGTCCCCTAAATCATTGGATGATGTCTTTACTATTCAAATTT
AGGGTTTTTTCCCTTGATGAAAGATGTGAGGTAGTTTACTGTGCAGCAAAGAATATACTC
AGTTGGTTAGGAAACTGTCAAATATTATTTATAAAATATAATAATTTGAAACTAGTCTCT
CTAAATTCCTATGAAAAAAATTTTTAAATAAATGAAAGGTTATCTGTTGTATTACAGTTA
AGCTCAGGGAAACTTGATTACTCATGATTATATCATAAACAGCTGTGTTTTAAGGATCTG
GAACTTGCCTTTGAGGCCTACTGCTTAAAAATAGATTGTTTAAAACACTTTGTCCTTTGT
GAGTTACACACCAGTTCTGAGTTGCTTCACCTTCTCATGGAACAGGGCTCAGAAAACAAT
AGTGTTTGGGATAATTTGAAACTAGAATATCATCTTTATTTCAATTAAGAGTAAACATTT
ATATAGCAGTTAATGTGTGGCATTCTAAGTACTTTACATAATTTACTCATAAAAAACTTG
GAATAAGTACTGTTCTGCCCATTTTACATAAGAAACCGAGGCGCAGTTAACTTGGCCAAG
GGTACAGGTGCAAAGTGTTAGGCAAAGATGCAGACCCAGGCAGTCTGCCTCCATAATCAG
ATCTTGATCACTAGTGCCGTATTGTCTTGTATTAATAGGTACATTTTAAAGCTACTTAGC
ATTGTTGGAGCACATTTAGGTTATTCTCCTGCTTCCTGGATATTTTTTACTTGCATCTGG
CAAACATCTCAAATTGACCATATCCAAGAGAATTCATTACATCCTATCCTAGCTGCCTTC
AGTATTCTGTGATACCTGTAGCAGTATTATCAGTTTATTTGAAATGGAAACCTTGACTTC
TCATAACAATATTCCCTCACTAACTAGACTGGAGGACAAGAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1082, 1374..1435, 2014..2126, 2837..2987, 3179..3301
1016..1082, 1374..1435, 2014..2126, 2837..2987, 3179..3265
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved