Equus_caballus Locus EIF4A2
snOPY snoRNA Orthological Gene Database
Equus_caballus EIF4A2
Equus_caballus
EIF4A2
19
SNORA63, SNORA63, SNORA4
3800..3912, 4627..4758, 4937..5076
7618
TTGTTCTCAACTTCAGTAAATCAACATTCATTATGTATAGGTAACTAAAACAAAGTCCT
TTGAAAAAAAATGACCCAAATAGACCAGAACCAAAACCCGTCTAGTCCCAAAGCGGCAAG
GAGCTGTATCTGCCAGAAGCATCATTTAAAATCTTGCGTTACAGGGAAAATTACTCCTCC
TTAGTATTATCACATTTGCAAAAGTTTATACTGATTTTATCAGGCATTCCTCACACCTGT
TAAAATTATTAGTTTTTTAAAAAAAGACAGCGAGACAAGACCAGAGGCAACACGAGAATA
GAGTTGGCTGCTCCAGGGACATTTGCAGACGACACTACACATTTTCTCTCGCCCTGCACA
ATATACGGTAAACCAGATTTTCTGGGATGTGCTGGGTAGCCGACATTTTCCCCGAGCAGG
AGTTTGACACTTTCAACATCTTAATGGATGGTCAACGCTCGGGCTTAAGGCCAGGCGGCT
CTTTATCATCAAGTTAAATAGCGGTGGGAACAAGCAGAATAACCCGATTCCCCTCCAGAG
CAGAACGTGGACGAGCCTGCCCCTACGACGCCGGGGCCGGCGCGAACGGCGAGCTCGGCC
CCACTAGTCCGCGGAGCAGCCCGGCCGCCCAGCGCGCCCCAGGCTTCCGCCACCAGGTCC
TGCTCGGCTCCCCCGGGCCGCCGCTGCGTCGGGGACGCGGAAACCCCGTAGGAGCACGGC
GGGCGGGGAACGAGTGATGGGCTGCTGTCTGCTGCAATATTCTTCCGCCGCAAAGCAAAG
AGTCCCAAACTTCCCCCAGGGTCTTGGGATTTCCGGCGACCCTGTAATGTCGAGAAATAA
CCAAATCTGGATTTTCCTGCCGATTGGGGTAGGCTATTTTCTGAGGGAAGGAGCTCAGGA
TCATAATTTTGTGGCTGACCGAAGAGCGACAAGAAAATTCCTCCGCAGAAAACGGGTTCC
GGCCGCGAGCCTATAAAAAACGGGCGGCGAGGTCCTGCTGTCTTTTCAGTCGGGCGCTGA
GTGGTTCTCCGGATCATGTCTGGTGGCTCTGCGGATTATAACAGGTATGGGTCTTTTTCG
GTGGTAGCGTTTTGTGGCGAACGTCGTACGGCAGGAGAGGAGATAGTAGTAGGTGAGTTG
GAGGCAGGGAACTATGGGTTCATAGGCGTTTTCTTGGGGTACAGTACCCCTGTGTCCTTC
GAGAAGCTTCCACGATGGGTAAGGCCCCGGGTTGCGGGGAGACAAAACGAGGCTACGGAA
ACGGAGTGGCTAAAGGCTGTCTTTTTTTTCCCCGAAGACGCTTTGAAGTCTCGGCGGCTT
CCCCGCCCGAGCGGAGCACATTTAGTTAGAGCCGTGGCGCAGCCCGCACCCGGTACAGTG
TAGTCGGGGCCGAGGCCTTCCTGGCGGCCAGCAGCGCGACCTGGAGTCCAGGGCTGTGGG
GGAGGGCGACGGCGGGGCTCCTCCCCTCGCCCCGGTTAGAAAGCGGATGAGCGCCCGGCC
CCGCGGCGGTCGCCGGCGGGCCGTGGGCATAGCCCTCTCCAGGGCCTCGGCCCGCTTCAA
TCACCCGACTTGCGCAGTGTAGGGGGCGGAGCTCAGCGCCTGGAGCTCTCGCGAGACGAG
CCGCTGCCCAAGATGGGAGAGCCCGGGCGCTCGGGCCTGGGGGGAAGCGCCGGCGTGGCG
GGGGCCTTTCTGGCCGTCGCGGGTCTCAAGCTCCGGGCGTGCGCAGTGCGTCCCTGTGCC
ACCGGCTTCCTTAGTTCTTCTAGGAAGTGCACACGTGCGCGGGAGGGTAACGTGGGGAGA
GGTTCTGAAAGCGCTGACTCCGTAATGTGCGCTGAAGGGGGCAGGGGACAGGGATGTGCT
CTAACTGCGGTATTCTTGTCGGTAGAGAACATGGCGGCCCAGAGGGAATGGACCCCGATG
GTGTCATCGAGGTAAGAGCTGTGGGTGGATTTTGAAATTCTGGAAAGGTGGTTTGGTTCA
TCCCATTCAGTTCTCCTCTTTTTTAAATTTACAGAGCAACTGGAATGAGATTGTTGATAA
CTTTGATGATATGAATTTAAAGGAGTCTCTTCTTCGGGGCATCTATGCTTATGGTTTTGA
GAAGCCTTCAGCTATTCAGCAGCGAGCTATTATTCCTTGCATCAAAGGTAAAAGGACTCG
TTGACACTTTTGAAAAATGAACTCAATGTTCTACATAGACCTGGACCATAAAAGGGGAAA
TAACTTCTGGGGGACTAGCACCTGTTTGTATTCCTTAAAGTGAAATGATGGCAATCATCT
TTCGGGACTGACCTGAAATGAAGAATACTCATTGCTGATCACTTGATTATTTGGGCATAA
TTGATGTTCCAAATGGAATACATGGTGTGAACTAGAAGTGACGGTTTGATGGGGGATCGG
TAAATATGTATCCTACTTTTTTTAGGGTATGATGTGATTGCTCAAGCTCAGTCAGGTACT
GGCAAGACAGCCACATTTGCTATTTCCATCCTGCAACAGTTGGAGATTGAGTTCAAGGAG
ACCCAAGCACTAGTATTGGCCCCCACCAGAGAACTGGCTCAACAGGTATTGATAGTGTAG
TTCAAAAAAACTGCTTGCGTGTTGCATAGGTTTCAGGTTTCACAACTGTGAAAGAATTTA
AAGCTTAGTGTAAATTGGTCCTGTCAGAGCCCTCTTAACTACCCATGCATGCAGGGAGTG
TTGAAAGTTAAACCGGAATTGGGTGTGCAGGTATGGTTTTCAGGGTTGTGTAAGGCTGAG
AAACCAAGGCTTTCTGTTCAGGGTGGATGAGATCCGTTCCCGTTTTTGAGTTCGAATGCA
GTTGTGCAACATGAAAACTGCAGTGACGTGTTCTCATTTGACTGTCTCAGTAGTTTGTGA
TGCATCTGTTGCATGCTATGTTTTCAAAGCTCACTGCTATATTGGCTTTGAAGTAAATCT
TGGTAATAAAATTAGGCTTTATTTAAGATCAAGGTTATGTAAGTCATAGTACCCTGTGGG
AAAAATTGAAGTATCAACAGCTTGTCTTAGCTGTAAAGGCAGAGCTTGTTGGCTGTTTAC
ATTTTCCCACACAGTGAAAAATAATGTAGGAAATGTTTTTAGTCATTTAACCTAGCTGGT
ATCTGGGGCAACAGGATCCCGAGTTTGACAGGGCACAAGAAAAGAAAGACACTTAAAGGG
GATTTTATCTTGAGGCAGTTGGATGAGTCTGCACTTTAAGCTTGGAAGTAAAGTCCTGTG
CATGCATAAAAGCTATTTGCAGACCAGATATTTGCCATTATGCTTTGGAAGTTTAGTCAC
AGAGCCTGTAATTCTGCTGGATAATAATTAAGGCTTTTGGCTTTTAGATCCAAAAGGTAA
TTCTGGCACTTGGAGACTATATGGGAGCAACTTGTCATGCCTGCATCGGTGGAACCAATG
TTCGAAATGAAATGCAAAAACTGCAGGCTGAAGCACCACACATTGTTGTTGGTACACCAG
GGAGAGTGTTTGATATGCTAAATAGAAGATATCTTTGTAAGTATTGCTGTCTAGTATAAT
TTGGACAATTATATACAATTATATAATAGTGTAATTTGTTTCTGCTACTAAAAAGTTAAA
TAGTATCCCTGAGAATCTAAAGATGATAGTATGACTTTGTTTTTAACAGCTCCAAAATGG
ATCAAAATGTTTGTTTTGGATGAAGCTGATGAAATGTTGAGCCGAGGGTTTAAGGATCAA
ATTTATGAGATTTTCCAGAAATTAAATACCAGTATTCAGGTGAGCTTTACTTCACTCATA
GCTGGAGCTTAGGTTTAATTAATGAGGGTACTGTTACAAAACAACTGAAGTGTTGTATTG
TCGTTTCTCCTTGGAGCAATGGATGCATAACTGTCTGGCATAATTTCATAGTAAGACGCT
TAGTCTCAAACATTTTTTCCATATTGAAAAATTGAGTATTGTGTTAACTACTTGTGTGAC
AACATAATCATCGTCTTTTTCAGGTTGTGTTGCTTTCTGCCACAATGCCAACTGATGTGT
TGGAAGTGACCAAAAAGTTCATGAGAGATCCAATTAGAATTCTGGTGAAAAAGGAAGAAT
TGACCCTTGAAGGAATCAAACAGTTTTATATTAATGTTGAAAGAGAGGTAATTTGTTTGT
TAAACATTAAAATGTTAGCCAGATTTTATCCTTCTTGTATAAGCACTGTGCTAAAATTGC
AGAAACTAGGATCACTTCTTGGTTTTTGTAATAATGCTAGCAGAGTACACACAAGAAGAA
AAGTGACTGCACTAGATTGTAAAGACTGGGGTGGACCTCTTTCTTAATGTCCAGTGTCCT
TTGTCTCAAGATTTGGTGCAATATGTCCTTAGGCTGACCCAACAGATGAATTTGTAATGA
ATTTAAATTGGAAAGTAAATTGTTTTAATAACTTTCTCTTTTGGAAATAACTCTAGGAAT
GGAAGTTGGATACACTTTGTGACTTGTATGAGACACTGACGATTACGCAGGCTGTTATAT
TTCTCAACACAAGACGCAAGGTGGACTGGCTCACTGAGAAAATGCATGCCAGGGACTTCA
CAGTTTCTGCTCTGGTAAGAGGTGTTCTAGCCTAGTAATGGTATTTACAATGTCTATGTT
TCCATTAAAGCAGGATTTAGACTACAATATAGCTGTTAAGTGCTGTGTTGTCGTTCCCCC
TGCTCAAAATAAAGTTGTTTCTTAACTATACCTGTCTGCTATACTCTTGTAGCAGCCAGG
GACGCTTGGTCTCATACATGTTGATAAAGTTAAATATGAATTTGACTGGTGATTCTTGAA
TTAAGGTTTTTTAATTTGCAGCATGGAGACATGGACCAGAAGGAAAGAGATGTTATCATG
AGGGAATTCCGATCAGGGTCAAGCCGTGTTCTGATCACTACTGACTTGTTGGTAAGTCTT
TCACTGCTCTTTTTAATATACCAAAAGTGTTTTTTTTGTGGGAAGGTTTTTTAATAACCT
TTACCAACTTAGGGTTTTTGGGAGAGTAAAAAAAGGCCATGCTCCACAGTGGGCTATACC
ACTTAATGTAGTTCACTACTATTTTGTGGCCTACATTACATGGCTGTATAGTTTAATTAG
GATTTGAACAACATGCCATTGTATTTCAGGCTCGTGGGATTGATGTGCAACAAGTATCAT
TGGTTATAAACTACGACCTACCTACCAATCGTGAAAATTACATTCACAGGTGAGTAGACG
GCATTTTGACAGTTAACTGCATTGGTAAAATGCATTTCACGTACTGTTTTTTTCCTACTG
ACTGATGTGTCTGAAAGGTGACCTCAAATCAGGGAATTGATTCAGTAAAAAGACATAATA
AATTGTATTTGGGAAGATTAGTCATACACAGTGGGAAAACAGTCATAAATGATGCCCAAA
TTGTGGACTTAATACATACAAATCAGGTTGTTGTAGATCTGTTGGTCTTAGCTTATTTTT
GAGCTTTATTTTTAGTGATGCTCTTGTGTCCATGTGCTTCCTTGGTGATTCCTCTATAGT
TGGGATTTTCTTGGTGTTGTCTGGTAGCAATTTGAGCAGTCCCTGGTTTAGCTATAGTGG
CTTTATCCCTAAATAAATTGAATTGTACTTTGTTATATGATGTAAAAAAAGACTTTTTAA
AAAATACAGGAGTCGATAGCAGCAGTTGATGACGAGATGGCGCTCAGAAACGGCGTTGAC
GTAATTTAGGACGTGGAATCATAAGCGAAACAGCACACTGTTTGAATAAAGAGCGAGTCG
GTATTTATATTTGTTTTTCTTTTGTCATGATTATTTGATATTTAAAGTTGCTCCAGCCAA
GGCATTTTAGCATATTAGCGTATTAGGTGGTTCGTTTTGTCTGGTTTCCATCAGGCAGGT
AGAAAGCTGTTTTGGAGGTAAACACGTTTTTGAGTAACTTGAGTTATATAACGTGTGAAA
CTGAGCAAAAAAGCAGTGATAAGTTTGGGTTACCATACCAAATACTTGTTTTCCCACTGG
AAAAAGTTGTAAGTTTTAGACAGTAGTTAACCTTGCAGCATTTGTGTTTACAGTTTACTG
TTCCAGAAGTGCGTCGAAATGGATTGCATAACTGTTCTTTTTGTTTTATCCCTGGTATTT
ACATCTGTCCCAGGCTGACATCTGCTCTTGGCTGGCCCACTTTGGTATGGGCTTTAATTT
CACTACCCCAAACACAATACTGTCATCTGCTTTAAAGATAATAATGCTCAAGACACCTGA
TAAAATCTCATTTTGCAGCCAGACAAGCCTTGAATCCTTTTGGCACTAACTGCAAAGGAA
GATTTTTTTCTCTAGATATTGATTAGCAGCTAGTGCTCCAATTAGAAGCACGAACTATAA
CCTTGATAAGTTAAACAGCAGCTGATGGTTAACAAGTGGATCATCATGTTCAGTAGTTCA
TGCAATATGTAGGTAGCAGCATCTTCTAATTGCTGATTTCTTTTTCTTACACAGAATTGG
CAGAGGGGGTCGATTTGGGAGGAAAGGTGTGGCTATAAACTTTGTTACTGAAGAAGACAA
GAGGATTCTTCGTGACATTGAGACTTTCTACAATACTACAGTGGAGGAAATGCCAATGAA
TGTGGCTGACCTTATTTAATTCCTGGGATGAGATAGTTTGAATGCAGTGCTCGCTGTTGC
TGAATAGGCGATCACAACGTGCATTGTGCTTCTTTCTTTGGGAATATTTGAATCTTGTCT
CAATGCTCATAACGGATCAGAAATACAGATTTTGATAGCAAAGCGACTTTAGTCGTGAGC
TCTTGTGAGGAAAGTCATTGGCTTTATCCTCTTTAGAGTTAGACTGTTGGGGTTGGGTAT
TAAAGATGGGGTCTGTAAAATCTTTCTTTCTTAGAAATTTATTTCCTAGTTCTGTAGAAA
TGGTTGTATTAGATGTTCTCTATCATTTAATAATATACTTGTGGACTAAAAGATATAAGT
GCTGTATAAAATCAGCCAATTATGTTAAACTAGCATATCTGCCTTTATTGTGTTTGTCAT
TAGCCTGACTAGAAAGGCCTTTAAAATTGATTTTTTTAGAAAGCATTTGAATGCATTTTG
TTTGGTATTGTATTTATTCAATAAAGTATTTAATTAGTGCTAAGTGTGAACTGGACCCTG
TTGCTAAGCCCCAGCAAGCAATCATATGCTAGGTAGGGTTAAACCCCCAGTAAAATTGCC
ATATTGCACATGTCTTAATGAAGTTTGAATGTTAAATAAATTGTATATTCACTTTAAAGG
TGCTTTGGTCATTTTATTTTCATCATGTTATATTTACAAAAATTCAATAAAATGGCATAC
TAAATATGGTTTTAACAATTCTGAATTAACTGCTGCATCACAGTAGCACAGAGGCTCATC
AACTGCAGATGTTCGTCAGCACCGTCTGCTAAGCATTTGTCTACTTCCTACAAAAAAAGA
TGAGTAAATTAAATATCCCTTCCAGGTATAGTTAAAATATTTTGCTGCAATGTGTCAAAG
TGCCTACTTACAGCCAGTTTTTCTGTAATAATGGACTTCTGCTTATCAGAAAGGTTATCA
TTTTCTACAATCACGTCATGAAGTTGATTTACAAGCTGAGTTGCTGCATGACCCTCATC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1063, 1885..1930, 2014..2146, 2425..2564, 3347..3515, 3649..3758, 3983..4126, 4436..4573, 4821..4910, 5129..5208, 6474..6618
1035..1063, 1885..1930, 2014..2146, 2425..2564, 3347..3515, 3649..3758, 3983..4126, 4436..4573, 4821..4910, 5129..5208, 6474..6615
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved