Equus_caballus Locus Q6EVI0_HORSE
snOPY snoRNA Orthological Gene Database
Equus_caballus Q6EVI0_HORSE
Equus_caballus
Q6EVI0_HORSE
19
SNORD66
10391..10466
20061
GTCAGTCTGGGAGTTCCAAAGTTCGGGAGGGGACACGGGGGCGGGCAGTGGCTGTCACA
TGACGAGGCGGGGCAAATCCCATGTGCTCCGCGGCGCCGGGCGCGGCTCCGCCCTCTGCG
CCGGTCACGTGGGGGCGCCGGCTGCGCCTGCGGAGAAGCGGTGGCCGCCGAGCGGGATCT
GTGCGGGGAGCCTGAAAATGGTTGTGGGACTACGTCTGTGCGGCTGCGTGGGGATCGGTC
GCGCGGACTGAAGGAGACTGAAGGTAAAGCCGCCATGTCCGGGCCCGACCCGGCCCCCCC
CCCATCCCCTGAGGTAGCAACAGCTATCTTAACCTGAAACAGAATCAGGTCTTTGGCTGT
TGAATGAGAAAACCAGATTTGCCAACGCTGGTCCACTCTACCTGAGGCCAGTTCAAGTCG
CCAGCCCTCTGCTAAGGCCCAAGGAAACGAAAAGAACAGTACGAACCAGGGTAGGATGAG
GAAATTTAATTCCTTAAAGCAATGGTCTCCAAAACGTGATGCATTCTGTAATCTCATACC
TAATCTCTACAGATTTATTTTTGGCGAGTAAATATAAGTGTACCATTTATTTAAGTTTTG
CAGACATAGATAAACACACAGAGACATTACTGTATTAGANNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCGGCC
CCGCCCGCCTCCGGCGACCCTCACTTGCTTGAACCGGCTCCTCTTCGGCCGCCGCCGGCC
TGGCCTTTTACGGCCCGACTCCCGCCCTTCCTGGCCTCCGCTCCCGGGTGGCGGCAGGCC
TCGCCTCTGGCCCCGCGCGAGTGCCCCCGCGGCGGGCGTGCCTTGTGTGCCCCTGGGCCA
GGCCCCGAACCCGGTGTCCCCGGGTGGGGGGTGGGGACACCACGGCCGAAGCTGCTAGCT
CCGTTTGTGATCCGGGAGCCTGGTGCCAGCGAGACCTGGAATTTCCGGTCTGGTTGGTCT
TGGGCCCCGCGGAGCCAGGTTGATACCCCTCACCTCCCAACCCCAGGCCCTCGGATGCCC
AGAACCTGTAGGCCGCACCGTGGACTTACTCTTAACCGAGGGGGTGAGTGAGGGGGCTGT
TTCAGCAGGTCATGGGGGTGGTAGGAGGTGATGCGGGTTTGACAACATGTTGATGGGGAC
ATAAGCTGGATCTTTTCTGCACCTTCACCCTCTTGGCGCCTCCGCGGGGCTCGGTGTGGG
ACTCAGCCCTTGCTTCAACCCCTCCCCCACTCCATTTGCCTTAAGCTTGGGTCCCTTCCC
CTTTCCGAGCTCCACTCTTTCCCAACAGGTGCTGGGGGGGACCCTGATGTGGCACCAAAT
GAAATGAACAAAGCTCCACAGCCCACAGGCCCCCCACCCGCCCCATCCCCTGGACTCCCA
CAGGTAATTAGGGAGGAGTTAGCAGAGACTGGGGTGGGGGTGGGGGAGACCAGGCAGCTG
GGTCAGGAACAGGTTCTAGCCTCTGGATTTCCCACCCCCATCTGTGTCAGGGCAAAGTGC
AGCTTCCTGCTGCCAAAGTGAGACAGGGCCCCTGGGCTGTTCCCAGGGGCTGTCATGGGG
AGGGGGTATGTGGACTGCTGAGGCTCTTGTCGCAGAGCTGCTCCCTTTACTTCACCAGCT
TGGGTTTCTGCCCCACCCGGGTTTCCCCTCTTGCTGAACTCTGGTCTCCCCCCTTCAGCC
AGCGTTTCCCCCGGGGCAGACAGCACCGGTGGTGTTCAGTACGCCACAAGCGACACAAAT
GAACACGCCTTCTCAGCCCCGCCAGGTGAGGGGCCGTGGGGAGGGGAGTAGGGGGCCTGG
GGTGGGGCCATGGAAAGCTTAGGCCAGTTTGGGTCTAGGATGGAAACTCTGGAGGCCCTG
TACCTGCCCCAATTTCCTGACAGTTGCTCTGTGTTCTTTCATGCGGCTCTGTACTTGGCG
CTGTGGATTACTTAGGGTGGCTGGCCCCTTGGGGTGTATGTAGTTCGTGGGGGTGGCATT
ACTAGGGGTCTTGGTACCTTGAGAATTGGGGGCAGTGCTTTGGGCCCTGCTGCCAACTCC
TGCTTTCCTATTTCGTCCTTTTCCTGGGAGGTTGCAATTGCTCCTTTCCCCTTCCATTCT
TTCTCTTGGGACTGTGGTGAGATAAACATTCCAGCTGGTTCTTGCTTTTCTCTATACCTT
AAATTCTTCTGTAAGTGGGGGGATTCTCGTCCTGTTTCCTTCATTTTTTTCCCCTCATCA
CCTTGGGGATAATTCTCTTCTTTCCTGTCCCCATGTGCTCTCAGGGAGGATTCAGGTCTC
TGCAGGTAATACCCCTTTGCTAATCCTGGACCCTCTCCTGGTCTCACCCTTACCCTCCAC
CCTAGTCAGGGGCTAGACACAGGGACTGGGGCTCTTCAGGGTGGGGACTTGTTTGCCGTC
CAGGTCCTCAGTCTGAGGCTGACCGGTGCATGTTAGGGGCTAAATCTTGCACAGCGCGTA
TCTGGAAACTGGGAGACTTGCATGTTAGGGGTTAGTTCCTCAGTACTTTAGGGTGGAGCA
GTGCATGCTGGGGAGTCTGTTGCCCAAAAGGGCATTACTTAGGCATGATGCATCTGGGTA
TTAGGAAGCCTCTGCATAGGGGTAGCCTGGTGGAGGTGACATGAGTACGCGTGGTGGTGA
GGGAGTAAAATATATGCACAGAGTGCAAAGTGTATACTTGAGTTTGGAGAGCGTGTGTGA
GTACAAGAGGCCACTTAATCATTTCTTGGTCAAGTGGGTGTTGGAAGTATTGGTCCCCAT
GCTCCACAGCCCCCAGTACTTCTCTCCAGTCTAGAGACATTGTGGAATGGCCGTTTTGCT
GTCCACTTCCTCCCCTTCCCAGTGCCAACTGCCTTCCTCCCTCCTGACAGCACTTCTACC
CTAGCCGGGCCCAGCCCCCGAGCAGTGCAGCCTCCCGAGTGCAGAGTGCAGCCCCCGCCC
GCCCTGGCCCAGCTGCCCATGTCTACCCTGCTGGATCCCAAGTAATGATGATCCCTTCCC
AGATCTCCTACCCAGCCTCCCAGGGGGCCTACTACATCCCTGGACAGGTGAGGCTGGAGG
CTTGGGGGCTGGAAGCCACAGAACCTTGTACCCCCAACCCTCGCCTCCCCAACCCTGACC
CTCCAGTCCCATCTCTTCTCCAGAGGTGGGACTTCCTTCTGGTCATCGCCTAGAGTTGGC
TTGTCCTGTCTTGCCCTACATTCTCTTTGTAGTCTGATATGGTCCTCATAGCTCCCTCAA
CTCCTTGTCTCCCCTCCTCTCCCTTCCTTCTCCACCAGGGGCGTTCCACGTATGTTGTCC
CGACACAGCAGTATCCTGTGCAGCCAGGAGCCCCAAGCTTCTATCCGGGTGCAAGCCCTA
CTGAGTTTGGGACTTACGGTAAGCACGGGAGGGAGTCAGGTGAGAACAAGTCCCAGGGAG
CATCTAAACTCACCTGCTAATTCCTAAGACCCTTCCCACGCTTATCTCTTGGCCTAAAAA
TGATAGGGTTAGTAGGTAACCCTAGGGATTGGCCTAAATATCTAGCTGGCATGGGGAGGG
GAAAAGAGTCTATCATATTACTGAGAGTTGGAGTCCTCCCCACATCAAGGAACATAGGAT
CAGGCACCAGTTTGAGGGCCTATTATAAACATTCCCTCTGACACTCGTTCCATGGTTGGG
GGGAGCCCATGTAACATGGATTTGGGAGGTTTTTGTAGCTGTTTTTCATTTATATTCTAG
GAAAGAATTAGTCTGTTCTTTATGGCAGTGGTTTCCAAAATTTTTTGATCATCTATCAGG
AAAAATTTTGAGTATGTACCTCTAATACATGTATGTTTTTGTTTGTTTATATATGTATGC
ATAATTTAAATAAATAGTACACTTATATTACTTGTCAAAAATAAATAAGTAGAGATTAGG
GATGAGATTAAAGAATGCATCCCGTTTTGGAGACCATTGCTTTAAGGAATTAACTTTTCC
TCATCCTGGGCCTGGTTCGTAATGTTGCTTTTCGTTTCCTTGCCCCTTAGCAGAGGGCTG
GAGACTGGAACTGGACTCAGGTTGAGTGGAACAGGGTTGGCAAATCTGGTTTTCTCATTC
CCAGCCAAAGACCTGATTCTGTTTCAGGTTAAGTAGTTGTTGCTCCCTCAGAGTATATGT
GTACGTGTTGCTGGGGGTGGGGTGCACACACGGTACCTTATGGGGTAGAGGGGCAGACAC
AGTCCTGGGAGCTGCTGTATGGTGTGGAAGGAGTGCTTGCCTACAAGGTGCGCGTGTGTC
AGTGTCAGGAATTCTTGTAAACGCAGTTCAGACTGGTTCCCCAGCTTTGATAGGCACCTA
ATTCCCTTGGGGAGCAGGGTGGGGCAGAGCAAGGGGCTGGCTGTGGGTGATGAGAGATTC
TAGGAGTGGGAGGTGTTCAAGCAGGCATTTGTATATGGTTGGGCCCTGACGCTGCCACCA
TTCTTCCTTTCTTTGTGCCCCCCCCCCATCCCCCAGCTGGCGCCTATTACCCAGCCCAGG
GTGTGCAGCAGTTTCCCACTGGCGTGGCCCCCGCTCCAGTTTTGATGAACCAGGCACCCC
AGATTGCTCCCAAGAGGGAGCGGAAGACGGTGAGTAGCAGCAAGGGGCTCTAGGACATCT
GGAAAGGGAGAATCAAGGTCAGGCGCATTGTGGGTCAGGGAGCAGGAAGTTGAGGATAGA
GATCTTCAGCTGAGAGTGGGCAGAGAATGGGGATCTGTGAAGTGCTCAGGTTCTCTGTAA
GGTACCAAGATTTCACTGTAGAAGAGGCTCATGGGAAGACTGAAGTGGCAGGTGCAGAAA
TTCCTGAGAGACCTGGGTTCTGGGGTCCATAAGATGTATGTTTGGTTTTGGGTTTCTAGT
GGCTCGCCTCCGAAATGGTGTTTTCTGTGGCCCCACCCCCCCAGTCCTGGAAGCTCTTGA
GGCCTCCGCCTCTGCTCAATCCTCAAGCCCTGGGCGTGGTGCCCAGAATAGGGTGCCAGG
GCTGGGGAAGCCGCTGAGTCACCCTGGCTCCACCCACTGGATCTGGGCCCTGCCCCCAGA
GATCAGGCAGACTAGCCACAAGTGAGCCGAATGGGTGCTTGATGGGGGTCCTGGGCCCCA
GGGTGTGCAGCCACTGACTTGGGGACTGCTGGTGGGACAGGGATGAGGAAGGGAGGGGCA
TTGTGATGTACAGGGCTGCTCTGTGAGGTCAGGAGCCTCTTAGGGGTGGGGGCCAGGGCA
GGGACTACAAGAGCAGCCAGATGGGTTGACAGTAGAATTCATGAGGTTTCTGGCACCCAC
CCACCTGCTCTCCAGTGGTGGGGTGAGGGGTTGACCTGGAGTCATAGGAGTGGGGCAATG
TAGAGAGGTGGGCTCCTCCTGCTTCCCACTCATCCTGTACCTTTCTTTCCCCAGATCCGA
ATTCGAGATCCAAACCAAGGAGGGAAAGATATCACAGAGGAGATCATGTCTGGGGCACGC
ACCGCATCCACACCCACCCCTCCCCAGGTACTGTCTGCTCTTTGAGTGATGCCCGGGCTG
GATGGCTGTTCTGTCCTGGACTCCCAAGTCCTTTGATTTTTTTCCTTCAACTAAGGGATT
TATTTCCCTGCTTTCCTGGATTTCTAGGCAGAGCTAAAGTAGAAATGACTCTAGTAAAGA
AGGGTTGTGGGACTCTTCAGGGCAAACTTGGTAACCCTTTGTGTCCTGCAGACGGGAGGC
GGTCTGGAGCCTCAAGCTAATGGGGAGACACCCCAGGTTGCTGTCGTTGTCCGGCCAGGT
AAGTAAGCAGGTGGGGCAGAGCTTTTATGGGAAAAAGGAGTGTGACAATTTAAAGTGCTG
AGCAGGTGGAGTGACTTGATATGGGTGCCAGAGAGGAATGACTTAGGTTTCAGTTAGTGG
GATTTTGAGGGTTGGTTGGATCTTGGGTGAGAAAGGAAAAGGGTTAGATGGGAGAAGACT
GGGGGAGGGTGTTGGATTGAGAATGCCTTGGCTGGGAGGCGGAGGAACAACAGCGGTGAA
GGACTTGCCTTTAATTACTCGTTCTTCCTTCCTGTGCTGCAGATGACCGGTCGCAGGGAG
CAATCATTGGGGGCCGGCCGGGGCTACCTGGCCCAGAGCACAGCCCTTCAGAATCCCAGC
CTTCATCACCTTCTCCGACCCCATCACCACCCCCAGTCCTGGAACCAGGATCTGAGCCTA
ATCTCACGGTCCTCTCTATTCCTGGGGACACTATGACAACCGGGATGATACAGATGTCTG
TAGAAGAATCAGCCCCCATGCCACGTGAAACTGGGGAGCCATATTGCCTCTCTCCAGAAC
CCACTCCCCTTGCTGAACCCATACTGGAAGTAGAAGTGACACTTAGCAAACCAATTCCAG
AATCTGAGTTCTCTTCCAGTCCTCTCCAGGTGTCTACCACCCTGGCATCTCACAAGGTGG
AAATTCTTCCTGAGCCTAATGGCACAGTCCCATCTGAGGATCTGGAACCAGAAGTGGAGT
CGAGCCCAGAGCTTGCCCCTCTCCCTCCCCCGACTTGTCCCTCTGAACCCCCCATGCCCA
TTGCTCCAACTGCCCAACCTGAGGAACTGCTCAACGGAGCCCCCTCGCCACCAGCTGTGG
ACTTAAGCCCAGTCAGTGAGCCAAAGGAGCAGGCCAAGGAAGTTACAGCATCAGTGACTC
CCCCGACCGTCCTCTCTGCTACTCCAGCTGTTGCTCCTCCAGCTACTTCCCCTGCTCAGG
AGGAGGAAATGGAGGAAGAGGAGGAAGAGGGAGAAGAGGGAGAAGCAGGAGAAGCAGGAG
AAGCTGAGGGTGAGAAAAGAGGAGAGGAACTGCTCCCCCCAGAGAGCAGCCCTGTTCCAG
CCCACCAGAATTTGGAGGCAGCAGTGGCCACCCAAGGTAAGGTGTCGGGGGGTGGGGGGG
GGCTGGAGGGTGTGGTTCTTCATGGGTGGCCTCCTATTTGTGCCATTGTGTCTGGGTCAT
AGAAGCCCTGTGATGGAGCCTAAGAGCTGGATTAAGGAATTTTAAGTCTAGAGACCTTAG
AACTCTGGATTTACTGTGACGAAAGGAGGAACTATCATAGAGTGGCTGCTGTTTATTTTT
CTCAGGGGTTAGGGGTACTCCTTAAGTTATGCTCATTTCTTTTTTTTTTGGTCCCCCTAA
ACAGTGGCAGTATCTGTGCCAAAGAGGAGACGAAAAATTAAGGAGCTCAATAAGAAAGAG
GCTGTAGGAGACCTTCTAGATGCCTTCAAGGAGGTAAGGGAGCAGAAGGTAACGGAGGGG
AGAGGGTGCAGTTTGGCTGTGGAACAATGGTCATACTGCAACCAAAATGGAATGTTTTGC
GGTTACAGGTGAACCCGGGAGTATCAGAGGTGGAAAATCAGCCTCCTGTAGGCAACAATC
CCGGCCCAGAGCCTGAGGGCAGCAGTGTGCCCCTGCGGCCTGAGGAAGCAGATGAGACCT
GGGACGCAAAGGAAGACAAAATTCACAATGCTGAGAATATCCAGCCTGGGGAACAGAAGT
ATGAATATAAGTCAGGTATGCTGAAGGAAGGGTTGAGACGGTCTGACTGTTCTTGTCAGG
GTCCCAGGAGACAACAGTGGGATTGGTTCATCGTGTCTTCCTTGCAGATCAGTGGAAGCC
TCTAAACCTTGAGGAGAAAAAGCGGTATGACCGTGAGTTCCTGCTTGGCTTTCAGTTCAT
CTTTGCCAGTCTGCAGAAGCCGGAGGGATTGCCCCATATCAGTGACGTGGTGTTGGATAA
GGTTGGTAGGCTCGAGGGGGGTAAGTTTGGGCTGGCTGGCTGGGGAGGAGCCCAAGGTCA
TGAAAGAGTAGTGGCTCTAACCTGTTTCTCATACCTTCCCTGTCCTCTTCGCAGGCCAAT
AAAACACCACTGCGGCCACTGGATCCCAGTAGACTTCAGGGCATAAATTGTGGCCCAGAC
TTCACTCCATCCTTTGCCAACCTTGGCCGACCAGCGCTTAGCAACCGTGGGCCCCCAAGG
GGTGGGCCAGGTGGGGAGCTGCCCCGAGGGCCGGTGAGTGGGACTGGGTAGAGGGGCAGA
TGGGCGGGGGAGTGGGCGTGGTGGCTCCCTGTATCTCACTGGGTGCTGGGAAGAAGTCTG
CCCTGGATATGTGTGGTGATGGTGTCACAGGTTGTGCTGAGTAGGTTTTTATCTTCTCTT
GTCCTCACCCTTGCTTAGCAGGCTGGTCTAGGACCCCGGCGCTCTCAGCAGGGCCCCCGA
AAGGAGCCACGCAAAATCATTGCTACAGTGTTAATGACCGAAGATATAAAGCTGAACAAA
GCAGAGAAGGCTTGGAAACCCAGCAGCAAGCGGACGGCGGCTGATAAGGACCGAGGGGAA
GAGGATGCTGATGGCAGCAAAACCCAGGTACTGGCAAGTCCTGCTTTTGGTCTCCATTCC
TTCTCTTCAAGGTCTGCCCTCTGAGCCAGCCTGGCCCTTGTTCAGTCCATCCTCATCACT
AGCATCTACCTAAGTCCTCACTACCCTCTGCTGTCCCTCCCAGCAGCCTCTGTGCTTCTG
AGAACCTCACTGCATCCTGTGTCTCCTCTGTCCGCTCTCCCCAATAGGACCTGTTCCGCA
GGGTGCGCTCCATCCTGAATAAGTTGACACCCCAGATGTTCCAGCAGCTGATGAAGCAGG
TGACGCAGCTGGCGATCGACACTGAGGAACGCCTCAAAGGGGTCATTGACCTCATCTTTG
AGAAGGCCATTTCAGAGCCCAACTTCTCTGTGGCCTATGCCAACATGTGCCGCTGCCTCA
TGGCGGTTAGTTTTCATTGTTTTCTAAACCTTGTGGTCTAGCTTCCCACTTCTATTCCCG
AGACTCCTTGAGTCCAGCTTCTTGGTTCTCCTCCACCTGTGCTGTTGATGGCAGCCAGGA
GGAGGCAGAGCCAGGAGCTCTTCCTGGGTCACGTAGTTAGACTCCTGGAGGGCCTTCCCT
GCGCTGAACTCTTCTGAATGCGATGTTCTCTTTGACATACAGCTCAAAGTGCCCACTACA
GAAAAGCCAACAGTGACTGTGAACTTCCGAAAACTGTTGTTGAATCGATGTCAGAAGGAG
TTTGAAAAAGACAAAGATGATGATGAGGTTTTTGAAAAGAAGCAAAAAGAGATGGATGAA
GCTGCTACGGTGAGAGGAAACCCACCAGCTCCACTGCCCGCCCAGATGCTACTCAGCTGG
AGAATTGGGGGTGGGGACAAGTTGGGGGAGATAGTGGTGTTTTGGGGGTTTCTTGGCCTT
AGGACGTGAGTGCTTGCTGCTAGGCTTAGAAATCCAGATAGAGCAGGAGAGAGTGGTTTT
AGCTGAGTGGTTGGGTATCTTTTGATGTGATCCCTGTCCCACGACTGGCAGGCAGAGGAA
CGGGGACGCCTGAAGGAAGAGCTGGAAGAGGCTCGAGACATAGCCCGGCGGCGCTCTTTA
GGGAATATCAAGTTTATTGGGGAGTTGTTCAAGCTGAAGATGTTAACAGAGGCAATAATG
CATGACTGTGTGGTTAAACTACTAAAGAACCATGATGAAGAGTCCCTTGAATGCCTTTGC
CGTCTGCTCACCACCATTGGAAAAGACCTGGACTTTGAAAAAGCCAAGGTAGGAGTCCTG
GAATATGGAAGGAGATGGGCCGAATGGTGTGTAGGGCCTGCTGTCCATTGTTGAGCTCCC
TCTTGGGCTGTTGTCACTGAACCACAGTGATGGAGCTGAGGGTCTGAGGAGGGCAGGGCC
TATGAGGTGAGGTGTTAGAAGTTCCTGACCTGATTCCTCTGCTTCTCTCCAGCCTCGAAT
GGATCAGTATTTCAACCAGATGGAAAAAATCATTAAGGAAAAGAAGACTTCATCCCGAAT
CCGCTTTATGCTGCAGGACGTGCTGGACCTGCGACAGGTATGTGTCCTCTCCTCCCCACC
GCTAGTTTACTTCCTCTAACCCTACCTCCCCCAGTTCCCAATGTTGGTTTGTCTGGCCCA
CTCTGATGTGATTACCTTGTGACTGGCCTCCTGTCCCCACAGAGCAATTGGGTGCCGCGC
CGAGGGGACCAGGGTCCCAAGACCATTGACCAGATCCACAAGGAGGCTGAGATGGAAGAG
CATCGAGAGCACATAAAAGTGCAGCAGCTAATGGCCAAAGGCAGCGACAAGCGTCGGGGT
GGCCCCCCAGGCCCACCCATCAGTGAGTTTGAGGCTAGGATTGAGAAGGGGGCATTGTCA
GGGGTGGTGCTTTCCGCTGATGACTTCTTGTTAGTGCCACGTGTCTGGGCCACTGAGACC
CCATGATGGAACTGAGGATCTGAGGAAGGGAGGCTGGGGGCAGCTCAAAGGGACCAGGCT
GCTAGGACTTACTCATTATTCCAGTATACTCTCCTTTTTATCCTAGGCCGTGGCCTTCCA
CTTGTGGATGATGGTGGCTGGAACACAGTCCCCATCAGCAAGGGCAGCCGCCCTATTGAC
ACCTCACGACTCACCAAGATCACGAAGGTAGGGGTGTGTGTTTTGGAGGGGTGATGGTGG
TGGTGGGAGGGTAAAGAGAGATCAGAGAGGCATTAAGCACGGATTTGGATCTTAGTGCCC
TCACCCTCTGAGGCTGGGAAGGCGACAGCTGAATTTTCCCTCTTAGACTAACTGGTTAGG
TTGCTAGAGACAGGACTGCCATCTAGGGGGGTATTCGCCTTGGTCTGGACCAGCAGTCAG
CAAACTGACACGCACACCAAATCCAGCCCATTCTCTTCTTCTGTACACCCCACAGCTAAG
AGTGGTTTTTACATTTTGTAATGATTGAAAAAAAATCAAAAAGTGAATATTATGTGATGT
GAAATTATGTAAAATTTAAATTTCAACATCCTCAGTTTTATTGGGACACAACCCCACATT
CATTTCCTTTAAGTTGTTGTCTGTGACTGCTCTCGTGCTACAGCAGCAGAGTCTTGAGTA
GTTGAAGTAGAATCTTTGACCTGCAAAGCATAAAATATTACTGTCTGGCCCTTTACAGGA
AAAGATTGCCTGGGCCCTGGTCTAGGCCATTTGCGGCTGTGTGTCATGATGCTGGCTTTG
ACCAGATCAGACCCATGACTCTCCATTCCCCTTCCTTCCGCAGCCTGGTTCCATTGATTC
TAACAACCAGCTCTTCGCACCTGGAGGGCGATTGAGCTGGGGCAAGGGCAGCAGTGGAGG
TTCTGGAGCCAAGCCCTCTGACGCAGGTATGGAGGCCACTGTAAAGAGCTGGGTGGTTGT
TAATCAGCTCTCTTGAGGGCAGATCCTTGTCTGTGCTGGAGCCTTGTCTCCTCGTGTCTA
CGGGAGGCTTTCAGTACAAAGTGGTTAGGTAATACAGCAGGTGTGTACTTGGGTCTGGGG
ATTAAACTGCTTTAGTTTTGGGACTAAGACCGAGTGTCCTAACCTGGCAAGTAGGAGATA
GAATGTAAGAACATAGAGATTTTAATCTGTGTTTTCTGCCTCCCCAGCATCAGAAACTGC
TCGTCCAGCTACTAGTACCTTGAATCGTTTCTCAGCCCTTCAACAAGCAGTACCTACAGA
AAGCACAGATAACAGACGTGTGGTACAGAGGTGAGGTTTCCTAGGTGTCTTTGTTCTTCA
CATTGAGAGTACTATGATTGGGTTTTGGTTGTTGCCATAGGAATTCTTCCACCTGTAATG
CTCAGAGACCCTGCCTGAGATTGGGGCATATTCCTTATGCCAAGAACAAGGCTCAACAGT
TGCTCAGCATGTTGGATAGTTAAGCGAGAGAGTGCCAGGGCAGTATTGGTGAGAGACGAT
GTGCCTCTTTCTTCCAGGAGTAGCTTGAGCCGGGAACGAGGCGAGAAAGCTGGGGATCGG
GGAGACCGCCTAGAACGGAGTGAACGGGGAGGTGACCGTGGAGACCGGCTTGATCGTGCA
CGGACACCTGCCACCAAGCGGAGCTTCAGCAAGGAAGTGGAGGAGCGGAGTAGAGAGAGG
CCCTCCCAGCCTGAGGGACTACGCAAGGCAGCTAGCCTCACGGAGGATCGGGACCGCGGG
CGGGATGCTGGTAAGGGGCTGGGAGAGGAAGGGAAGGTCAGCGTGTGGGCTGGTTTGGGA
CCATCCAGTCCCCAGACAGTCTTCAAAGCTCCAGACCCTCTTTGCTAGGAAAACTGGAAC
TGGACAGTCTCTGATCTGTTTTTCTGCCTTCAGTGAAGCGAGAAGCCACGCTACCCCCAG
TGAGCCCCCCGAAGGCCGCGCTCTCTGAGGAGGAGCTGGAGAAGAAATCCAAGGCCATAA
TTGAGGAGTACCTCCATCTCAATGACATGAAGGTAGCCAGTGGGAAGGGTCTGTGTGGTG
GCAGAGGGGACAGGGAGTGGAGGGGCAGGGAGTGGAGGGCCGGGGCCAGACAGTAACTGC
TCTCTCTGTCCTGTACCCTGTGCCCCCTGCAGGAGGCAGTGCAGTGTGTGCAGGAGCTGG
CCTCACCCTCCCTGCTCTTCATCTTTGTGCGGCATGGCATCGAGTCCACACTGGAGCGTA
GCGCCATTGCTCGTGAGCATATGGGGCGGCTGTTGCACCAGCTGCTCTGTGCCGGGCACC
TCTCCACTGCTCAGTACTACCAAGGGTATGACTGACTTCTGTGGGCCTCCCGCTTTTATA
TACGCACAAGTTTCCCTGCTTTGTAGGATCCGTGTAACCTTGGATAAGAGTGTAGGCTCC
TCAGCCATCCTGGTCAACATTTCTTTTGGCAGGGATAGGGGTGAACCATCTAAGAACAAG
AAGGTGGCCTTAGCTTGAGATAACTGCCTCGTGTTTAGGAAATGCTCCGCAGTTGTTCCT
TTAGCCATGCCTTGTTGCCCCAGAAGGAGGGTGGGGGCGCAGCTTGTCTCATCTAGAATG
CCCTCACTTTGAATTGTCTTTGCAGGCTGTATGAAATCCTAGAATTGGCTGAAGACATGG
AAATTGACATCCCCCACGTGTGGCTCTACTTAGCAGAACTGGTGACGCCCGTTCTGCAGG
AAGGTGGGGTGCCCATGGGGGAGCTGTTCAGGTAAGCCCCCTTTGGTGGAATTGAAGACG
GGAAGAAAGGCCTGGGAGGGGAGGGGGGTGTGGCAGGTTAGATGCCTGGGTTTAGGGAGG
GATAGGGTAGTGCTGGGAAGGCTTTGGAAGCTATCAACGCTGGATTTTCCTCTTGTAGGG
AGATTACAAAACCTCTGAGACCCTTGGGCAAAGCTGCTTCCCTATTGCTGGAGATCCTAG
GGCTCCTATGCAAAAGCATGGTGAGTGAGAGCCTTTTGGGGGTGACGTGTTCGGGACTTC
TCTTCCACCATGTGGTTTTTTAGCTGCTTGAAGTAACCCTGAAGAGCCTCATGGTCCTTT
GGTGGGATGGGGTTAACGGTGCTGGTAGTGCTGGGTTGGTACCTGGGAGAGGAAATGTTG
GGGCTGGCACTCTCCCTCGGACCAGTTCCTGTTTAGAGTTCTGGAGGAGATGCTGGGAGA
GGCCAAGGGTGGAGAAGAATGGGAATCTAAGACCCTAGGCCCTTGATTGATTGATTGATT
GATTCATTGATTGATCCAGTGCTTTTTAAACATTTACCACATGTTTAGGCACTGGGAATA
CAGCAGTGAATAAAACACAGTTAGGAAATCAGTTGGGAAAGAAAAAAGTAAGAAATACAC
AGATTTGGGGCCGGCCCGGCCCGGTGGCACAGTGGTTAAGTGTGCACGTTCCACTTCGGC
GGCCCGGGGTTCGCTGGTTTGGATCCTGGGTGCGGACATGGCACCACCATGGCATTGGCA
AGCCATGCTGTGGCGGGCGTCCCACATATAAAGTAGAGGAAGATGGGCATGGATGTTAGC
TCAGGGCCAGTCTTCCTCAGCAAAAAGAGGAGGATTGGCAGGAGATGTTAGCTCAGGGCT
AATCTTCCTCAAAAAAAGAAAAAAAGAAATACACAGCTTAATAAAAACAACAGTGTAAAG
TAAAGCGTGAAATAAAATAGTTGAAATGGAGTGTCTTCAGTACTGTGAGATTGCAAAGGA
GTGTCTCTTTGGTAATGTTCATGGCAGAAAGCTTTCCTGGAAGCTGCTTTGTGAACGTTG
GAATGTTAATTGATGATTTGCAAGTGTAAAGTCAGATGGAAAAGGCAAATTGGGTGTGGT
ACTCAGTGGTAGTGAGAAGTTGCGAAGTTCTCATTCAAAAGAGTTCAGCTCTCTGGAACC
TAGAGGAAGGAGACTGAATTGAAAGGAATTGTTCTTTCAGCATCATATTAATCCTTTTAG
GTAGAAATATGTACCAGGATAATGTCTTTTTAAAAGAAAAAGAAAAAGCATGTTGAACTT
ACTTATGTATGTCATTGAATCTAAGGTGCCGTAGCTTGCAAGACATATTCTTTATGCATT
ACTAAGAAAAGACGTGGTCATATTTCTTAAATGCAATACATCAATCGTGAGACAACTCAA
TTTTAGTAGTGTTAAAATGGGCATCTTTAAAATCCATGAAGTACAATAATCTTGTTAAGG
GTTGAGGTCATCATTCTGAATGTGTTATTGTTAAAGAGTGATGCCTTTAGAATCTCTTGC
CCCATACACAAAACAGGCTAAGACTGCTGTTGATTTGAGGGTTTCTGATTTGGGTTGGGG
TCGGGGGGGTATATCTGCTTCTAAAATTTTCTGGACCTGGGAACCAAAAATACATACTTG
TTAGAAGTTGTTCTCTCCCATAAGCATTTGTTGCTTGAAATAATGAAAAACTAAGGTATT
TTAGAAAAGGAAATGTCCCCTGAAAGTGGAAGGCTAGGATGAGATGTTTGGATTCCAATT
GTTTACTCTGGTGGATGAGTTCTTGTATCTTTGGGTAATTATTTGACTGATGTCTCTGCC
TGGTACCAGGCTGTAGGCATGGAGGGACTGTGGTACCTCTTACCTCTGTAGCATCCCTGA
GCCCTAACGGGCACCTAGTGGGCTCACAGTAAATATTTGTGGGATGACATTTGTGAAGCT
GTTAGATTCTTGGAGAGAGAGAGAGAGGGTTGCTGACTTGGTTTTATGCTTTCCAGGGTC
CCAAAAAGGTGGGGACGCTGTGGCGAGAGGCTGGACTCAGCTGGAAGGAATTTCTGCCTG
AAGGCCAGGACGTCAGTGCATTTGTGGCTGAACAGGTTTGCGGCTAGAGTTAGGTTAATT
CTAGCATTTGGGGCTGGCCACTTCTCCCCCTTTCCTCATCTCATTCACATGGGGTACTGA
CTTCCTCACGCTGGGCCTTTTCTCTTGCAGAAGGTGGAGTATACCCTGGGCGAGGAGTCA
GAAGCTCCCAGTCAGAGGCTGTTCTCCTCCGAGGAGCTGAGCAGGCAGCTGGAGAAGCTG
CTGAAGGAGGGCAGCAGTAACCAGCGGGTGTTTGACTGGATAGAGGTATGCTCTTCCTGG
ATGTTGGGAAAGAGGGATAAAGGAGAGGTAGTTCTTGGTCTAGGGGTGGGGGCAGCAAGA
ATGGAGACTTCAGGGCACAATTCAGAACTAAGGTCCATTTTCTTCTCTTTTCTCCTGCAC
AGGCCAACTTGAGTGAGCAGCAGATAGCATCCAACACATTAGTTCGAGCCCTCATGACAA
CTGTCTGCTATTCCGCAATTATCTGTAAGAGGGGCTGGGGAGATGGCAGGGCAAGGGTGG
GCCCAACAGACAAATGGAGGGAGGGGGGTTTGGGTCTCTGCCTCCTGGTCTGAACCAGGC
TGACGGTGCATTAGTCCACTTACCCGTTTCTTCCTCCCTGTAGTTGAGACTTCTCTCCGA
GTGGATGTGGCAGTGCTGAAAGCGCGAGCGAAACTGCTACAGAAATACCTGTGTGATGAG
CAGAAGGAGCTGCAGGCGCTCTATGCCCTCCAGGCCCTTGTAGTGACCTTAGAACAGCCT
GCCAGTAAGAGCCAGGCTGCGGGGCGTGGGGGGGTGGAGGAACCACCAGAGAGCAGGGTG
CAATCACCGGAAAGGTCTCAGCTGGAGAGAGGTGGCTGGTCANNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAGGCTTTAGGTT
AAACATGCCTGGAGATTATGCATTCAAGTAAATAGGTTTGTACAGGGCGACTGGGATACT
ACCAAATGAATAACTCAAAGCACAGGTCCCCGTGTGGGCATGGAGTTGGTACTAGAGTGA
TGAGTGTTGGAAGCTGGGTCCCTGCAGGGTGCTCTCTAGGGGAGTACACCCTAGTCAAGG
GATAAGGAGTGGGAATTAGCTAAATGATAAATGGGAGCACTTGAAACCAAGGACCTATGT
GTAAAGGAAGGCTCTGTGGTAGAGAGAACTTGACACAAGGTAAAAGGACTGTTGGAGGAA
GGCCAGTGTGGGAGAGCACAGCAGCCAGTTGTATGTGAAGCAGGATGGGGCTGGAGTGAT
GGACATGGACCAGGTCTTGGAGGGCTGTGAAAGTCATGGAAGGAGTTGTGAGCTTTAGCC
TAAGGCCAGGAAAAGGCCTTTATGGGATTTTAAGCAAGGAATAAAAAACAAATCGATTTT
AGTTTTAGATCATCCTGGCCATTAGTGGGAAGAGTGGTTTGGAATGAAGTGAGTGTTGAA
TGCAGCAGGATCAGCAGATCAGGAGCCTGTTGGTAGTGGCTCAGCCTTGCTAGTGGCATT
GGAGATAGGAGAGGAGTGGGTAGATTTAAGACATACACTGGCCGAGGAGTGGGTAGTGAG
AGATCAGATGTCCTGTATGACTGTCAGGATGGTTTTAGCAGGTCGGGGAACGGTGTGGTA
CCATTCACTAGCAAGTAGGGAACTCTGGATCAAGTTAAGTTTGGTCATAATTGAGTTTGT
GGTCCATAGGTAGGGGTGATCAGAGATGTCAGGTAGACCGCTGGGTATCTGAATTCATCT
AGAGAGGGAGAGGTCAGGGCTGGAGGCTGATCTGCGAGTTGCTGGCACAGGCTAACAGAT
GTGCAAGTCACAAGGATGTGGGATTGCCCAAGGGAGAGTGATGAGGTCCTGGGATAGAAC
CTTGAGGGGGCGGAGGACCTATACATAGGGACTAAAGGAGGACAGGGCCCTATGAACAAA
GGCTGGAGTAATTTTAGGAGAGGGAAGATGCCAAGAATGCTAGATGTTGCTTGAGATTTC
TACAGGAGCAGACCTCAAAATTGAGGGCCTCTGGAGTTGAAAAACATGGAGCTCCTGCTG
GCAGATAGAGTATTTGCTGGAGCAGTGGACAGAATCCAGATTGGAAAGGACTGAGTAATA
CTTGACTGAGAAAAGAAGAAAGGAAAACAGCAAGTGTAGATAAAATATTTGAATTCAGTT
AATCTCTTGTCAAAAGTTTTTGTTCAGCTGTAAGAGAGTGGTTGTAAAGGAGGCCGTTTG
TGTTTAGGTGGGAGAAACTTGGGCTTGAAAATACAGGGCGGAGTGGATAACTGATTGTAT
AGGGTCCCCAGGGTGGGTATGCATGGGATTTGGAGCACAAGTTTGGGATAAATGATCTGT
TGCCTTTGCTGTAGGATGCGGGTGGGAGGCTGTCCATGGGCAGTTGTGGATTTGAGGGTG
TGCACACCCTAAGGAACATTTTGGCTTACAGCTCCTCACAGATGGCTCAGTTAACATTTC
ACCCAAACCTGGGCTCTAGATCTTATGCTTTCTCCTTTTCTCTATTCACTACTCTGCCTC
CCTTTGCTTTTAAGAATGTAAAGTTGGCTTTGGAAACACTGGCAGTGCACTGTGGGGATT
GGGCTAGGTTGTGTTCAGGGACTATGGGACAAATGCTTCAGCAGGCCGATAGTAGCCAGG
GGTGAGGAAGGAAGGGTCAGAGCAGGGCATGCTTGAGTTGAACCTAAAAGAATTCACTAG
GAAAGTGCCAAGAGAGAGGATGTTTCTGGCAAAGGATATAGCACACGTAAAAATGTCAAG
GCCAGAGAGGGGGTTCATATGTGTGGAAAGTAAGAGGAAATTGTGATCAAGAGTTTGTCA
GGATCTGTAATGAGGGCCAGTGAATGTTCCAAGTTATACCCTTGACTTTTTTGAATGATA
CATCTGGGACTTGTATGATTCCCCAGATTCAGGAGCACCAATCTTGCATATAGTTTTCCC
CATTAAATATATCATGAGTGGAGAAGTTTGAAGCTGCTGAGGTGAGGCTGGGCAAGTTTG
TAAGGTTTGGCCAAGTGACTCATTCCTACACGTGTCTCTTAGATCACAAGATTAGTGTCC
TGTCAGAGACCTGGTCACTCTGGAATGGTCAGACACACAAATATCAGGATGATGGGTCAG
GACCTTGTTTTTAAGTGGAGCTTGGGAGGGATCCCTGGGTGGGATGGGGTGGCTGTAGGC
AGCACGCCTCTAACTGCTGTCTTGCCTGCTTGCAGACCTGCTTCGGATGTTCTTTGATGC
GCTGTACGATGAGGACGTGGTGAAGGAGGACGCTTTCTACAGCTGGGAGAGTAGCAAGGA
CCCCGCTGAGCAGCAGGGCAAGGGCGTGGCCCTTAAATCTGTCACAGCCTTCTTCAAGTG
GCTTCGTGAGGCAGAGGAGGAGGAGTCAGACCACAACTGAGGGCGGGTGGGGCCGGGGAC
TTGGAGCCCCATGGACACTTGGATGGCCCAGCCAGCCGCCTGGACTGCAGGGGGGGTGGC
AGCAGTGGCGGCAGCAGTGGGTGCCTGTAGTGCGACGTGTCTGAGCTAATAAAGTGCCTG
AAGAGCCAGGATGGCTTGGGGCTGCCTGGGGAACCCCCCTACNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1242, 1468..1562, 1858..1944, 2444..2464, 3050..3226, 3458..3557, 4656..4768, 5574..5666, 5871..5937, 6222..7055, 7324..7412, 7508..7694, 7787..7920, 8034..8192, 8361..8546, 8747..8944, 9162..9308, 9531..9767, 9952..10056, 10182..10341, 10546..10646, 11263..11365, 11627..11729, 11957..12189, 12333..12451, 12572..12744, 13045..13170, 13318..13399, 15176..15274, 15390..15524, 15662..15743, 15883..16023, 18695..19061
1503..1562, 1858..1944, 2444..2464, 3050..3226, 3458..3557, 4656..4768, 5574..5666, 5871..5937, 6222..7055, 7324..7412, 7508..7694, 7787..7920, 8034..8192, 8361..8546, 8747..8944, 9162..9308, 9531..9767, 9952..10056, 10182..10341, 10546..10646, 11263..11365, 11627..11729, 11957..12189, 12333..12451, 12572..12744, 13045..13170, 13318..13399, 15176..15274, 15390..15524, 15662..15743, 15883..16023, 18695..18876
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved