Equus_caballus Locus EIF4A1
snOPY snoRNA Orthological Gene Database
Equus_caballus EIF4A1
Equus_caballus
EIF4A1
11
SNORA48, SNORA67
3092..3226, 6380..6523
8311
AGATCTTCAAACTTTTTTTTATATATATATATATAAATGCCACGGTCCTGCTCTGGTCA
ATAAAGGATCCTTTGGAGATACATAGTGGTGGTCTTCCTTAAGGGGCCTCATACTAGTGG
ATATGCTCTTTCTCAGGCTTTCCTCTAGCCAGTGCTGGTAGAGACCCTTTTTTGGGTCTC
ATGATTTCAAAGGCCACGTTTCCATCCCTGCCTCAGATGGTGCCAACACTATGTCTTCAT
CACCCAAAAGAATCCCCCGGCCTGGGGAGCAGGGCTGGAAGAGGGGAGAGTTTTGGTAAG
CCTCAAAAATACGGGAGATTGAGAGATGCTAAAACTGGGGAATAGGGATACTTAAGGAAT
TCGGCCAGGATTCATAACAGCAACCTCAAATGCCCTTAAGCCCAGAAATCGGTTATCCAT
CCCTCCTCCCTCCAGTCAGGGGCACTCCCCCAGCCACTAGGATATGGCTCCTGATTCCAT
CGTCCTTGGTATACTTGGAGCACGGCGGGGTGGCGTCTGAGCTATCTTTGAAGCAGAAGA
GAACAAAATAAAACGTGTGTCCAGTGGAAACGAGCAGATGTAAAGGGAAGTGGTAGTCCC
GGGAGCCCGGAAGTCCCTGGAGGCTAAAACCTCGCCCCCCTTACGCGATAGGGCCTACTA
GGCCACATGACTAAGGCCCTATCGCCTCCGCACGTGTAGAGGTGCAGGGCCCCAAGATGG
CTGCCAGGCCTCGAGGCCTGACTCCTGTATGTCACTTCCGTACCGGCGAGAAAGGCGGGC
CCTTTAGCCAATGAGGCCGCGGGGCGGGCCTTCACCTTGATAGGTGTTCAAGTTATCCAA
TGGTGGCTGCGTGCCGGAGCGTCTACGAACGGACGTCACTCAGAGTTGCTGAGCGCGAGC
AGGCGGGGCCGAAGCGACCGGGCCAATGCGATGGCTGGGGCGGGGTCGGGCGCTCTATAA
GTCGTCGATAGGCGGGCACTCCGCCCTAGTTTCTAAGGATCATGTCTGCGAGTCAGGATT
CCCGGTAAGAAAGGCATTTGCAAGAGATTGTGGCTACTTACCCTTGCCGCTCCCTTCCGA
GGGCCCCGCCGGGGGGAGCTGAGGCCCACCAGGGATGCGGGGAGGCCAAGCGGGAGGACC
CGTACTGGGGGAGTGAGGGGCAGATCCACGGCCGGCGCTGCCACTGGGGCTTGGGCAGGG
GGCCAGGACAGCCCGCCTTTCGGGCCCTAGCGTACGAGGATCACTAGGAACCCTCGACCC
GACGCGCTGCCGTGCGCGGAGCCCTGGCGCTGAGTGGCAAGACGCGGTCGCAGCCTAGCG
TGGGAAAGGTAGAGCCGGCCGCCACCGCGCGTGGCCCCGAACCGGCAGGTCCGGCTGCCT
CACTGCCGGAGGGAGGGCTCGCGCGCGCTCGGGTGCCGGAGGATTCTGACAGTACCACTC
GCTACAGGCGGGGGTGTCTGGGTCCTCAAATCCAGTCGCCTCGTTGCGTTGAGGTGTGGG
TCGGGGAGAAGAAGCCGGCCGTTTAGTGTGCTGGTTTTCTTGACGGCCAGGACTGAGCCT
AACCCCGAGGAGCGGCCGCGTGAGGCACCAGGAGCCCACCCGGCGCCGGGCGGGCGGGTC
CATTTTGCCGCACAAGCCGGGCAATTGGCAAACTGCGGATGGGCAGGTCCACTTTCCTTC
GGGGGTGAGCGGCCTGAGGTACGGGAGGGCGACGCCATTTCGCGACGGGGGCGGGCGGGA
TGTGGATTGTTCCAAGCCGGGGGGGAGATGCCGCTGGGTGGTCGAGGGAGCGAGCACATG
GCGGCCCGAGGTGTTCCCCTCCCCCAGTCCGCTTCGCTTCTAAGTGTTGTGCAATCTCCC
CCTTTGCTAGCTCGGCTGGGGCTCATTGTGCGCGAGGCCGCCACCGCCCGCGGCCTCCCA
CATCCGGGCACCGCGAGGGGGGGAGATGGGCTGGAGGGAGTGGGGGAGGGCGCGGGAGAA
ATGACGTGGGGGGGAAGGGGATGTCCTACCCTCGGATCTGGGAGGTGAAGGGCGGGACTT
CCGGCGCGCTGGGGCCGCGATGGGAGGTGCACGCGCTTGGGCTTGGGGCAGCCAGGCCCG
GGACACGTGGGTCCGGCGGCGGGCACCACCTCCGGGCCCCGTAAGCAGAGAGCCGCTCCT
TCTGGCCTCCGGGTCGTCTAGGAGGGTTACCCCATCATGTCCGGGGCGGCCTGGCCTGAG
CCGCTCCTAGGATGGGGCAAAGGACTGACTCAATTGTAAGGTAACTACTGTGTTTACTGG
GAATTGACGGGGGTTGGGTCAGGGAGTGAAAAGGCTGATGGCATCAGGAAAGGCCGGTTG
CTAGTAGACAGAAGCTGGCTGTCAGGATTTCTAACGTGCCTTAGTCGGCGTACTCATACT
TTAAACCAACAGATCCAGAGACAATGGCCCCGACGGGATGGAGCCCGAAGGCGTCATCGA
GGTGAGATTGGACTCTTATCACCAGTGCCCTTCATCTCTGGGAAAGGCAGTGTCACTAGC
AGTGTTTCCTGGTTTGTGGAGTGGTGGTTCAGTGAGTTAAGATTTGATTAAAACCGGCAC
CCAGGATTCATCTTTAATACATAGCCTAACTCCCAAGTGGTTAAGTTCTCCTCCACAGGA
AGTCTTAACTACAGTGATTTGTTAAAAACATATCCCTGAGAAGATCTATGAAACATGGCA
TTCAAATTGAGTCCAGTCGTCCCTTCTACAACTTCCAGCCTCACAGTTTACAAGTGGACT
GGCTCCTTAGAGTGCTTTCTCAGACCATGTAGAACCAGCTGGCTTCCCTGGAGGGAGGAA
AGGTGGGCTCTGAAGCTTTGGTGCTGCAGGCAGGCATCCTGTTTGCTCCAGCACTAGAGC
ATACCCTCCCCTCTTCTACTACGTGAATTTGTTTGCATCCTTCAGAGTAACTGGAATGAG
ATTGTTGACAGCTTTGATGACATGAACCTCTCGGAGTCCCTCCTCCGTGGCATCTACGCC
TATGGTTTCGAGAAGCCCTCTGCCATCCAGCAGCGAGCCATTCTTCCTTGTATCAAGGGT
AAGATTCCTCTGCTCCAGAACAAGTTCTGGACTGTCCCTGACCTGGGTAGAGTGGCACCT
GGTTGGTGGTGCCTGTCTCATATCAGCCAGGGACAAAGCAGCTCCTTGTTCATCCCAGCT
TGGCTTTTGGTCTGTGCCCATGCCTGGTTCATGCCCTGGACACATGGATTGCTGGTTGAA
TTTCAATAAGGTAGTGTTTCAGCCATCTCATACTTCCTTTTTATAGCTATTTCTAGCTTA
GTTTTATGCTGTACTAAAAGAGTTAATAACTGGACCTGGCTTCCAGATCTGTTCCCACTT
GGGTACTTTGTGATAAGGTGTCTGTGAAGCTCTTTATGTTTAGCACATAGCTCTATTGGT
TGCTTCTTGACCAGGGCCTTGATGTTTCATGATCGCAAAGTGTATGCTCTTTGCCATATC
AAATTTCTGTCCTAATTTCTCTGTTTAGGTTACGATGTGATCGCTCAAGCCCAATCTGGG
ACTGGGAAAACGGCCACTTTTGCCATATCAATTCTGCAACAGATTGAATTGGATCTCAAG
GCCACCCAGGCCTTGGTTCTGGCTCCCACTAGAGAGTTGGCTCAGCAGGTGAGAGCGTAG
CTTCTTTTTCCTCGGCTGAAGAACCAATTTAGAAATGGTTAGCACAATAAAAAACTAGAG
TTATGCTTCCCAACCATCTTGGAAGAACTGAAGTATGGGGTAGGTGGGGTGGGGGAAAAG
ATGATCTGAAGTAAAGAAAGGAAATTGGTAGCTGACTTTCAGGTTTCTCAAGACTTCTTA
GGTTAATTATAAGCTTTTTTCTACCCAAACACAATTAGCATCACTTCCTCCACCCATTTC
CTGAGTCAAATGGGAAGGCTGCTGGGTGGAGCCTGGCTGGCTGGGCAAGTTTGGTGGCTC
TTTTATGAACAAACTCCCTGGCAATGGGCAAAGAGACACCTGATTGGTGGTGTTGCTCTT
ATATCAGTCAGGGGCAAAATAGTTGTACAGTCCTTTGTTCATCCTAGCTTGATGCCTGGG
TTGGTGGCCAGAGCTGTTTCATGCCTAGGGCACAGAAGATCCTCATGCTGGACTGTTCCT
GGGTCTTGGAGGGGAAAGGATCAGAAATACTGGTCTCATAAGTAGATTATTGAGACTCGA
GGAATGTATTTTTTTAAACATCCTGTGCTAAACTTTTGGACAAAGATAATTTAAGCAAGT
GGTCTTAGTAGAAGTCTATCTTAGGGCTCTGCTGTCTAAAACATGCTTTTAAGAGTGAAC
ACATGAGCTACAGTTGGCTTTCAGAAATTAGGAGGTGTACTATGGAAAGAAGCTATATTA
TATTAAAGTTGTTTTAGAGGGCTGTTACTGTGTATCTGTATACTCAGGAGACAAACAGAA
TTCAAATCGTGAGTCTTTGCCACTTTTACTGGCCATGTTATCTCAAATGGATTATTTAAC
CTGCCTTTGTTTCTTGCCTTAAAAGCATATTTATTAATGGTGAATGTCTCAGTTGTTAGA
AAGGATAAATAGATAAGAAACATTCAAAATGGGGCCTGGCACAGTTGTAGCTAATATGTG
AGTACTTGTGTTTTTCTGGGTTCAGATACAAAAAGTAGTTATGGCATTAGGAGACTACAT
GGGTGCTTCCTGCCACGCCTGCATTGGGGGTACCAACGTGCGTGCCGAGGTGCAGAAACT
GCAGATGGAAGCTCCCCATATCATCGTGGGTACCCCAGGCCGTGTGTTTGATATGCTTAA
CCGGAGATACCTGTGTAAGTATCAATTTTCTCGTCTTCTGGGCCATTTCCCTCTTCTTTG
TGCTTTCCCAGTCTTTGAACTTGGCCACACTCTCATTCCCAATGATGCTAGTTTTCCTCT
CTGAAAGAGTTGCTCTGTGATGAACCCCATGCGTGTCATCTGAGCCTGGCTTCCCTGTCT
TCTCAGCCCAGGTAGTGTTCTACTTCCCAGGGCTGTTGTCTGGCCTGGCAGGGGGCTCCT
GGGCAAAGGATCAGTCTTTGTATTCTGAGAGCAGACCACCTGTCCCTCCCCTTTTCTTTA
TAGGGAAAGTTAAGTGTCTTTTACATTTCCCTAGTTGCTACCTGTTGGTATTTTTTCTCT
CCTGTAGCTCCCAAATACATAAAGATGTTTGTACTGGATGAAGCTGATGAAATGCTCAGC
CGTGGATTCAAGGACCAGATCTATGACATATTCCAAAAGCTCAACAGCAACACCCAGGTG
GGAAAAACAGACATGTATAGTCTTGCTTGTATAGTTGATGATCTCTTTATAGATTGTGGT
GTGATTGAGGTAAGGGAACAGCAATATCAGGTGCCAGAGGAACCAAAAAAGAATTCTGGA
GTCTCGGGGCCGGCCCCGTGGCTGAGCGGTTCAGTTCACGCACTCCACTTCATCAGCCCA
GGGTTTTGCTGGTTCAGATCCTTGGGCCCTGACGTGGCACCACTCATTGGGCCATGGTGA
GGCAGCGCCCACATGCCACAACTACAGGGACCCACAACTAAAAATACAGAACTATGTATA
GGGGAGCTTTGGGGAGAAAAAGGAAAAATAAAATCTTAAAAAACAAAAAAAAGAATTCTG
GAGTCTCACATCAAGCCTTTTTATGCATTGGCTTCTGTTTTAGGTGGTACTAGGGAAGGG
GACAGGCATTGTGGACTATCCCCTGCTCTAAGGCTGCTCTTTTTTTCTGTTAGGTGGTTC
TGCTGTCGGCAACAATGCCTTCTGATGTGCTTGAGGTGACCAAGAAGTTCATGAGGGACC
CCATTCGGATTCTTGTTAAGAAGGAAGAGTTGACCCTGGAGGGTATCCGCCAATTCTACA
TCAATGTGGAACGAGAGGTGGGGCCTAGTGCAGGAGGCGGGCCTGGTATTAAGTTGTTGG
GTATAGCCCCTGACTGATTTTTTTTTCTCCCCCCACCCCCACTCCCCATCCCCAGGAATG
GAAGCTGGACACATTGTGTGACTTGTATGAAACCCTGACCATCACCCAGGCAGTCATCTT
CATCAACACCCGAAGGAAGGTTGATTGGCTCACTGAGAAGATGCATGCCCGAGACTTCAC
TGTCTCTGCCATGGTGAGTTTGCCCTACCTTGTTATCAGCAGTGTGTATCAGTGTCCCAC
TTAGAGCCAGTTCTCTCAGAACCGAAGTGCCTACCTCTTCACACCCTTCTATCTCCTGTT
CTAGCATGGAGATATGGACCAAAAGGAACGAGATGTAATCATGAGGGAGTTCCGCTCTGG
CTCTAGCAGAGTATTAATTACCACTGACCTGCTGGTGAGTAGAGGGGAATTTGGAGGAGA
TTGGGAAGGAAGAAAGGAGAATCCAAGGTGATTCCCTCTTCCAAGGGGCCTACTAATGCC
CTTTTTCAGGAAAGTAGCAACTTGGAATAAAATCTGGCATGCCTCAGGTTTTCGGGGGAG
AGGGGATGTTTATTTCCTTTGCCTTCCTTTGGCTGCCTACATATATACATGTCTCTTCTG
GATATATTGTGTTCTCTTCTCGTTCACATGCTGAAGTTGTCGTCTTTTTTGACGTAGGCC
AGAGGCATTGATGTGCAGCAGGTTTCTTTAGTCATCAACTATGACCTTCCCACCAACAGG
GAAAACTATATCCATAGGTAAGTGTTGATCTGGAATACTCACCCACCTCATGCCCAGGCC
TCCCTAGGCTGAAGCTTCTGACTTTCCCCATTCTCCTTATCCTCACTTTCCTTGCTTTCC
AGAATTGGTCGTGGTGGACGTTTTGGCCGTAAGGGTGTGGCTATTAACATGGTAACAGAA
GAAGACAAGAGGACTCTTCGAGACATCGAGACCTTCTACAACACCTCCATTGAGGAGATG
CCCCTCAATGTTGCTGACCTCATTTGAGAGGGGCTGTCCTGTTACCTAGCCCCAGCCAGG
GTTCAATCCTTGGGGGGCTGAGGAGGAGCAGAAGGGGGGAGGGAAGGGAGCCAAGGGATG
GACATCTTGTCATTTTTTTTCTTTTTTTTTTTTCTTTGAATAAATGTCACTTTTTGAGGC
AAAAGAAGGAACCGTGAACATTTTAGACACCCTTTTCTTTGGGGTAGGCTCTTGCCCCAG
GCGTCGTCTCTTCTCCCAAAAACACTAATCCATTTCCCTAACCTAGTCAACCTCCAAACC
CCAGAGGCTCTCCCCACCCCAGCTGAATTCCTCTGAAAACAATTCAAGGGGCTATAATGT
CACAACCTCATTTGCTGGACCAAATCTGGAGGGAGAACCCCTGAGTTAGGTGGCCCAGGG
GATTGTCCCAGGTGGGGGGAGCAGGGGAGAGAAAATGGTAGCCATTTTTACATTGTTTTG
TATAGTATTTATTGATTCAGGAAACAAACACAAAATTCTGAATAAAATGACTTGCAAACT
GCCTGTTTTGGGCTTTTCATTTCTTACCTCCCCTTCCCTCCCACCTGCTATTGGGTACAT
CTCTGCTCCCCTTTTCAGCTAATACTTAGTTTTGTGTTGGGTTGCTTTTTTTGTTACCAC
CTAAGAGTTGACCAGAAGATGGTCATGTTGACTGGATAACGTGACCCTTCTGCAAGGGAT
TGGGCAAGCACCATCATAAGTGCTTCACGTGTCTCAGCGAAGAGGAAGTGATATATGGGG
AGGGGAAAAGGGAGTGGAAAGAAGTTCTAATTTTACATCCTATGGAACTTTTCTCTGGAG
ACCACTAAGGGAGGGCCTCCTGTTTCTCAATTTGTTCTGTAATCTCTTGCCACAACTGTA
AGCGTATTTTGCTAAGGTAGACAAATGGGTCCCCAAGGGTCAACTGCCTTAAGACCCCAT
CTCATTCTGCCCACGTGACATTCTTGACCCTGACGGCTCCCATTTTGAGAAGCCAGGGCC
AATCATCTAACTTAAAAATTTAATGACTAAGAGATTGGTGGCTGGGGGTGAGGTGCATGA
GTCAGGTTGGGGGTGGGATTATCTCAAGTCGAAGACTTTCATTTCCTCCTTTCCCAAAGG
GGGAGAGTAGGGTTGACTGAGCGAGCAGCTGGTACTGAGACGAGCCTAGCTGAACTTTGG
GTGAGGCTGGTCTGTCATGAGGCTGGCTGTGCTTTTCTCAGGGGCCTTGCTGGGGCTACT
AGCAGGTAAGGAGAAAGGGGACTGGAGGGGAGGGAGCCCCTGGGAAGGAGCCTAACCCTA
GGTTGCTAACCAGTCTTTCCTCCGCTGAAAGCCCAGGAGACAGGGAATGACTGTCCTCAT
AAAAAATCAGCCACTCTGCTGCCATCCTTCAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1023, 2412..2460, 2925..3057, 3508..3647, 4645..4813, 5167..5276, 5753..5896, 5995..6132, 6244..6333, 6597..6676, 6782..7311
1001..1023, 2412..2460, 2925..3057, 3508..3647, 4645..4813, 5167..5276, 5753..5896, 5995..6132, 6244..6333, 6597..6676, 6782..6923
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved