Equus_caballus Locus TSR1
snOPY snoRNA Orthological Gene Database
Equus_caballus TSR1
Equus_caballus
TSR1
11
SNORD91, SNORD91
7268..7363, 8351..8444
12183
GAAAATCGGAGATGGTGCGCTCAGTCACCGGGAGGTGGTGTCGGGGTGAGGGGGAGGCA
GCGCGCTCCCGGGGGGTCGTCGGGACCCCGGGGCGCGCGCCACGCGGGCTGCTGTCATGG
CAACGCGCCTGCTCCCGCCCCGAGGGCGCGAACTCGCATTGTGAGCGCCAGCAGTAGCAC
CGCTGGGCGCCGGGCGGGGCGGCCGGGAGCGCCCCGCACCCCACGGCTGAGGAGAAAGTC
GCTGGCGCCGGACCTGGCCTCAATCCAGCTAGGCGCCCCCTGATTTCCACCCGCTCGCTT
TCCCGACGGGAAGGGCCGGGGCCCCCTGCACCTCGAGTCTGGCCACGGGGAAGCCAGCGT
TAGTCCCCGGGCTGAGAAAGGCCCCAACTCCATCGTCCCTCTAAGTCCCCTGCCAGCCGG
CCGTCCTCAGTTGCAAAGCTTGTGGGAAGAGGTTCTGCTGCCCTGAGGGCACGAGTGTCG
CGGCCAGCCTCCCTGCCCCTCTAGGGGTCGCCTCGTCCCGTCTGGCCCCTATTGCTCTGT
GGGACGTTGGGGCGCGCACGGGACCAGCGGGAACTCGTACGGAGCCCGGGAAGGGGAGAG
GAGAGCTCTCCACACGATTCGCCTTGTAGACTTCGGCAGCCACACGGGGGCATTGACGGA
CAGAAAAGGGTGCTCAAACTGATAGAGAACACCTGCTGCTGCAAACGGAGGCCTGCGTGC
ACAAATCTAGGTGAGAGGAGGGGCTTAGCCCTCTTCCACACGAATGGAGAATCTTCCATT
CTACATCTTCCTAAGTGATGCAACTTGATAGGGCAGAAAGTGAAAATGCAGGGGAGCAAA
ATAGCCCTCTGCGAGCGAGAACCTGAACCTCGAGTCTACACTGGGCTTTTTGAAGCCCCC
CACCACGCACTGCCGCGTGGGAAAAGTTTACACCCCAGTTTTACGGTGTCGCGGCGACGA
GCCCTCAGAGGTAGATTTTAAAGACACTCGCGAGAGGACGCGGGAGCCCCGCCCCTCCCC
AGGGTGGGCCCGCCCCCATGGGGGGACCGGAAGCGCTCGATCTGGCCCGGAAGTAGTGCT
GTCTCGCTACACGCGAACGGCGGCATGGCGGCCCACCGCTCCGGCCCGCTGAAGCAGCAG
AATAAACCTCATAAAGGCGGGCGGCATCGGGGTCGGGGATCCGCGCAGCGGGATGGCAAG
GGTGAGAAGAGAGGGTTGAAGGAAGGAGGGGTGTTGAGTCGATATTAACTGCTTTTCCTC
ATGCCCAGACTGAGCTCCTACCTCCGGCCTGCACCCCGCGCTAAAGCTCTCTGTAAGGTG
GGCGGACTGGGGTCCTCTTTCTTGACCTTCCTCTGATGCCCAGCACAAGAGCCCTCTCTG
ATCTGCCCTCAGGCCGTCTAGCGCTGAAAACCCTAAGTAAGAAAGTGAAAAAAGAGCTCA
GCAGAGTAGACCAGAGGCATCGCGCCAGCCAGCTCCGAAAGCAGAAGAAGGAGGCGGTGA
GTGAAGCGGGGATTGGGGGATGGTGTGGCTTCACAACCGTTCTAGGAACTAGGAAATGTG
GGCCAGGGAAGGGGCCGGGAATGGAGACTAATCCTAGAGCGCACGTCAGGCGTGCAGGTC
TAGACTCAGACTAGGGCATTCAGTGCTTTGGTCCGAGCGCCTGCCACCCCCGTGACATGA
ACGTCACCTTTTACAAGAGAGTTGCTGGCTGCGAGGGGCAACCGCACCGTTGGAAGTGCA
GTACTGAGGACGAAGTACTGAAACATTGAGATGTTCTCTAATCCGTACCCCCAGGTTCTG
GCAGAGAAGAGACAGCTGGGCAGCAAGGATGGCTCTCCTCATCAGGTACTGGTGGTGCCC
CTGCACAACAGGATTTCCCTGACAGAGGCCTTTCGGCTGCTTCAGGATAGGGACACTGGA
ACAGTACACCTGAATGAATGGGGAAGCAGCCATGGCTTTGTGCTGTTATGCCCCCGCTTG
AAACATCGGTGGTTTTTCACATCTGCAAGGCCAGGTTGGAGTATACCACAATATTTTCTA
TCATTACATTTTGAGTAGTAATATTTTTTGAGAATAATGTGCTGGTGTCAACCATCTCTT
CCTACTGACTTTGTCTTCTCTCTCCAGGGGATCTGCATACTGTCTTAGACATGGCTAAAG
TAGCCGATACCATCCTCTTCCTCCTTGATCCACTAGAAGGCTGGGACAGCACCGGGGATT
ACTGCCTTTCCTGCCTTTTTGCTCAGGGCCTTCCCACCTATAGTAAGTGAGTTGGGAGTA
TTGGAGGCCAGGGAAGGAAGTGAATTAGCATTTATTGTGCACCTATAGTTTGTGGGGCAC
TGTTTGACACTTGATGCAGGAATACAACTGGTGGGTTGTATTCAGCTGGTAGTGGATTGT
ACATGTAGGCCTCAACTTGGTATGTTATTTACAAATTAGATATTGAGGTGCTTTTTTATT
TCTGGGCTGACCTTTGCCCACAGGAAAAAGAATATGAAGTTTGGTTTTACTGTGAAATTT
CTTGAGGGTAGCTGAGTTTTGTTTTTTCCAGTGATCTCTGGGCTCACAACTGAACTGTTA
GCTTGGTTGTGAACTGCAGGGGGCATTTCCATATAATGAAGCAACAATTCAAGAAGTCCT
TTCTCTTTTACTTACAGCACTAGCTGTCCAGGGGGTTTCTGGCCTCCCACCGAAGAAACA
AATAGATGCCAGAAAGAAGTTAAGTAAAGTAGTGGAGAAGCGCTTTCCTGATGACAAATT
CCTCTTGTTAGACACTCACCAGGAGGCAGGGATGCTGCTCAGGCAGTTGGCTAACCAAAA
GCAACGGCATCTTGCCTTTCGAGATCGGCGGGCCTACCTGCTTGCTCATGCTGCAGACTT
TGTGCCTGGCGAAGAGAATAACTTGGTGGGCACCTTGAAAATCTCAGGCTATGTTCGTGG
GCAGACTCTGAATGTAAATAGCTTGCTGCATATCATTGGACATGGTGATTTCCAGATGAA
ACAGATAGATGCCCCTATGGACCCTTTCCCTTTACATCCCAGAGTGATCAAATCCCGGAA
GGACCCAGGCATGGCGATGGAGGTGAGATTGATGTTCTTGAAGACTGAACTGTAGATAAG
TGTGTAAGCTGGCACAGGATGGGAACTAACTTCGGGAGAAGGTAGTCTGCACACTAGACT
ACTAGTAGTCCCTGGAGGTGACTGCTAATTTGAAATAAGGCAGTAGTCTACAAATATGTT
GACCTGTCATATATTTATCCAGCACTTTGTAGGTCCCTTGCACAGCAATTGGCTCTGAGT
TTATAGAAGATACACAAGATGCAGTCTCTTTCCTCAGACAACTTAATTAGATCTGAAAAA
AACGGCAAACACCCTTGGAATAAAGAATAAGAAAATGTGTTGGAGCTGGCCCAGTGGTGT
AGTGGTCAAGTTCACATGCTCCGCTTTGGCAGCCTGGGGTTTGCGGGTTCAGATCCCAAG
CGCAGATTTACACACTGCTCATTGGGCCATGCTTTGGTGGCGTCCCACATACAAAATAGA
GGAAGACTGGCACAGATGTTAGCTGAGGGACAATCTTCCTCACAAAAAGAAAGAAAGAAA
GAAAGAAAGAGTGTAGTTGAGGTACAGACCTGCTGTGGAAATTGAGAAAGTAGACTAGCA
AGCTTCACAGAAGAGATCAAACTTGAGCCAGGTATTGGGAAGGATGAATGTGACGTGTGA
GTTGGTGATGACAGAATATCATAGAAGATAGAGACAGTGTGAACTTAGAGACAGTGATGC
ATCAAAGGGTTTCTTTGAGCTCTGAAGAAATCAGCTTGATAGGAGTGAGATACGTAATAA
ACTGGTAGGAGTGGGACCAGATTATGAAAGGCCTCAAGAACCAAGCAGAGATATAGACTT
CAAATGCTAGGAAATAGAACTATTTGGAAAATTTTGGCAAGTTCAGCTTTCTGTTTCATT
CTGTTTCATTTATCGTTTTTTTTCTTTTTGCTGATGAAGATTCACCTTGACCTAACATCT
GCTGCCAATCCTCTTTTTGCTAAGGAATACTGGCCCTGAGCTAACATCTGTGCCCATCTT
CCTCTACTTTATATGTAGAATGCCTGCCACAGCATGGCTTGACAAGTGGTGCGTAGGTCC
GCATCCGGGATCCAGTCTGGCAAACCCTGGGCTGCCAAAGCGGGACATGCGAACTTAACT
GCTATGCCACTAGGCCAGCCCTTTTTTTACCCTGCCATGTGCGCTGCCTCTATAGCATGG
CCACTGACAGATGAGTGGTGTACGTCCATGCCTGGGAACTGAACCCGGGCTGCCAAAGTG
GAGCTCGCCGAACTTAACCATGGCTGGCCGGCCCTATTTCATTCGTCTTCTACTTGAGGG
CTATGTTATTTCTGGGTCTTTCTGGTTACTGTGTTAGATTTGGTAGGTTTTTGGTTAATG
TTTGACTGCCCATCACTTGCTTTTGGTTTTCAGATTTGTGCTATGGATGCTGTAGCTGAT
ATGGAGGAAGACGTTAAGGTACTAATGAAGGCAGACCCTGATAAACAAGAATCTTTGCAA
ACAGAGGTTATCCCAGATCCAATGGAGGGGGAGCAAACCTGGCCCACTGAGGAGGAGCTG
AGTGAGGCAAATGGTTGGTATTAGCAACTTGTTTGTAATTCATCTGGCTTGGAATTGTAG
ATTTTGTCTAGCTGCTCATAGTCAGGACCCTATAAGGAAGACTAGGATGAAGATATATTT
GGAGATCTCTTACCCCTAAATGGTGTATGTTTGCACTAAGCAAACATTGGACACAGCTTC
ACTCTGTTTCTCAAATTGCTTGTGTTCTTGTTTTCTGATTAACAATTAAACATCTTCAGG
TTCATTGCAAGGTTTATTTAGCTGTTTAAATCGTGCTAGTTTTGAGACAGCTGAATTAAA
TTTGAAAGTGGTCTGTTCTAGTCATAGTGTATACCAGAGTTTCTGGTGTTGGCAGCAATT
TCTAGTGTCTTGCCTAGGTGAGAACACATAGAGTAATTGGGGAATGGAGGTATATAATTT
ACTTAAATCATTTGGGTTTTATAGACTTCTTGAAGGAACGTTCCAAGGTGGTAAAGAAGG
TTCCCAAAGGAACATCCAGTTACCAAGCTGAGTGGATTTTGGATGAAGATGGAGCAAGTG
GTGGGGAAGGAGATGAATATGATGATATAGAACAAGAGGATTTTATGGAAGAGGAATCTC
AGGTAAGGAGATGGGCCCTTAGGCCACTTTTGTGTACAGCCCTAAATGCAAGGCAAAATG
AAATTCTGACTTTGAGGGGGATGTGTGGTCAGTTTCTTAGGGGTGACTTTGTAGTTGCTG
GCAATGAGACTTATTTTATAACTGAGTCTCTTAGAATTGATATTGGGCACTCTTCAATAG
CTCATAGGTAGAGCGGAGGACTATAGACTGGACTGGTGTGGACATCCTTAGAATTGATAA
TAGTTTGGACTAGGTGTCTGGTAAAGTTATTTTATTCTTAGCTTAATGGCCTTTAGGGTA
GACACAAGTGTGCGTTTCTTCTAAAACTGCAATCCTTTATTCTATAGGATGAGAGTAGTG
AAAAGGAAGAAGAGGAGGAATATGAAACTATGACTATAGGAGAGTCTGTGCGTGATGATC
TGTATGATGAGAAGGTGGATGAAGAGGCTGAGGAAAAAATGTTGGAGAAATATAAACAAG
AAAGAATGGAAGAGATGTTTCCAGATGAAGTAGATACCCCCCGTGACGTGGCTGCTAGAA
TTCGGTTAGTCAACAAGTCTAAAATCAATCAATACATTTTTATTTAAAACTTACGTGGCT
CAGAACTATGTCAGTGTGACGCAAAAGAAGAAAAACACATTGTCCCTGCTCCTGAAAGGC
TAACATTCTGTATGGAAAGGTAAGATGTACATACAGGAAACAGTAATACATAATCAAGTT
TTAGACTGTGTGATACAGACTAATACAGTACTTTAATGAATACAGTACTTTTTAATTAAT
ACAGTACAGTATTTTATTGAAGGAGAAATAGTAAGGTTAAATTAGCAAATGCTTTCTATG
TGAACTTATACTCAATTGAAATATATAATGTTTGGAGATTTTGCGGAGTTTGGATAGAAC
AGCAAGAATAAAAGCATGAAGATGTAGGTAATCATGTCTGCGCTGGAGGTGAGTGACTAA
AGCCAGAGTTTATTGTTGGGTATCAGAGAGGTAAGGCTTTTATCAAGGACCTTGTTTGTC
AAGAGCCACTCTCTGATCAGCACCAGGGAGCCACTGTAAATACTTTGTCCTTTGTCAGTG
AGAAGCTTAGGTTTGGTTCTGAAATATTTGTTAGAAGCTGTTTTGGAGTATGGTCTTGAC
TTAGGCTATTAGGTCATTTTGAGAGAGAGTATTAAGAGTTCTTTCAACTAGAGTCTTAGC
CATATTAGAAGTGACTTGAAAGAAAGAGTAAATAGCACCATATAAATTTGACTATTATTT
TCTTTAAAATCTCCTATATTCTAGATTTCAGAAATACAGAGGCCTCAAGAGCTTCCGGAC
ATCTCCATGGGATCCTAAGGAAAACCTTCCTCAAGATTATGCTCGAATCTTTCAGTTTCA
GAACTTTACTAGCACTAGGAGACGAATCTTTAAAGAGATTGAGGAAAAAGAGCTTGAAGG
AGCTGAGGTATCTGCCTTCCGTTGTCTATCCCTATAATTTGCTTTTGTTTGCCAAGGTGC
CCCCTCCTTACTCCTTCTCTCAGGTGAATACCTTATTTAGTTTTGTGCTGCCCATAGCTG
AATTAAAGGAGCTACTGAGTCATTGACAAGAGTGATAGTGGGAACAAAGAGGTATCAGAG
ATGTTAACTGAAAAAGTCTAATCTAGGTAGTTGAGGCATCTGTGAAAGGCAATTTTGAAG
GGTGAGGGTTGACTTTGGGGTAGTGTAAGACTTTTAACATATTTAGAGAAATGTGTCATC
ATTGTTGAGACCTTAAGGGTACCTGTGTGATTGTTTTCTGCCTTCTTCTCGCAGGTTGGC
TGGTATGTCACACTTCATGTCTCTGAAGTACCTGTCTCAGTGGTTGAATACTTCAAACGA
GGAGCACCCTTGATTGCATTTTCTTTACTACCTCATGAACAGAAGGTCAGTTAGTGTCTT
GTGGGAAATAGGGAGTTATGAAATTTTCGAAACAGTTTTGTCTGACAGTCTAAAAGTTTA
TTTTTGACTGATATTTTGCTCATTGGTATATGAAAAATCTGCCTTTCGAATTAGGAATCA
GAGGATGACAGAGAAGTCAATGATGGTTTTACCCAAAAATGTCTGAACCTGTCTGAAGCA
TCTCAGTGATGCAATCTCTGTGTGGTTCTGAGACTTCTCTGAGATAAGTATGTTTGTCAG
ATCAGATTTTAACCAAGCGGGGGCCAGCCCTGTGGCCAAGTGGTTAAGGTTCTGCACGCT
CTGCTTTGGTGGCCCGGGTTCACGGGTTCGGATCCTGGGCACAGACCTACTCCACTCATC
AGCCATGCTGTGGAGGCATCCAACATACAAAAAATGAGGAAGATTGGCATGGATGTTAGC
TCAGGGCTAATCTTGCTTACCAAGAAAAACGCAAAAAGAAAAATATTTTAATGAAGCATT
GGCAGCCCTAAAAATAGAGTGTTTATGCCAAGGTGTAGATAGGTCTCTTTTCTCTTGGTG
GCCAGCAGTCATGTAGATTGAGGTGTATGTGAGAGCTCTGGCATTTAATCAGTGTAAGGA
TTGAGGAAGAAAGGGTTTGCATGAGTGTAGTTTTGAAGTGTGGTGAGTGAGTGATTTGAC
GGCACTAACTTTGTGGCAGATGTTGAGCTCTTGCATGTAGACACGAGGAGGTCAGCTAGT
ATAGAAGGTATAAGAAAGCTCTGAAAACCAGCCTGTGTTCAGCTTGAATGCCAGTTGTTG
GTGGAGGTAAAAAGAAGACTGTGTCTCATCATCTGCACTCCACCGTAAATTGGCATTGTC
AGTTCTTGGAGTGAATCTGAATCTGTTAGTTTTGTTGGCCTTCTTTCAGGTCTAGCTGTT
CTACTTTTAGATAGGAAGTTCTGTGTTTCTTACTTCATCTCCAGATGTCAGTACTGAACA
TGGTGGTGAGCCGGCACCCTGGCAACACTGAACCTGTGAAAGCCAAAGAGGAGCTAATCT
TCCACTGTGGGTTCAGGCGCTTCCGAGCCTCACCTTTATTCTCTCAGCACACTGCAGGTA
AGCAGTGGGGAAGCTTCTGGGTTCTTGTCTATCTTATTGTCTTTTGTGGGGCTGTGACTT
TTGGTGGGGGGTGCACAATACTCAATTTCAAACGTCAGGTCTCTGGGTTAGAGGTATTTT
CAGTACTCTGGCTTAGGAACCGATGATGTTTTTATTCAAAATGTCTGAACCTGTCTGAAG
CATCCCAATGATGCAACTCTGTGTGGTGCTGAGGCTTCTTTGCCATGAGTATTTGTTCCA
GAGTAGGTTTTGAATAGGAGGAGTTAGTGGCTTTAAAAAAATGATGTGTCAAAGTGTGTA
ACCCTTGGCATCTGATATGCATGTGGCAAAGGCTAGGGGTGGCCCACAGTGGGGTAAAGC
AGAGGCGTGTGGCTTTTTTCTTTGCTGAGGAAGATTCGCCCAGAGCTAACATCTGATGCC
AATCTTCCTCTTTTTTTTTTTTTGCTTGAGGAAAATTAGCTCTGAGCTAACATTTGTGCC
AATCTTTCCTCTGCTTTGTGGGTCACCAGCACAACATGGCTGATGAGTGGTGTAGGTCCA
CACCCAGGATCTGAACCCGTGAACCCTGGCTGCTGAAGCGGAGCATGCCAAACTTAACCA
CTAGATCATGGGGCTGACCCAAGGGTGTGGCTTCTGAGATGTTGAGACTGGATAAGAGTT
TGGAGGGTGGAGACCAGGGACACTTTTGTGTCAAAAATAATTGTACTCCTACACATTAGG
GGTGGGAAGATGTTTTGTACTAACTTGGGGGCTTCTGAATGTCACCTACACACTTTCAGC
AATGGCCAGAGGAAGATGATGAAGGCGGTATTAATGGGTGCTCTGGATAATTTCTATTCT
CACCAGCCATGCTAAGTGAGGGATTAACTTATCTTTTCCTTAAAATATTTTATTTCCCTG
TAACTTCAGTATTAAAGAGCAGTGGGGCAGGGTTTCATTGAAGGTAAAAACAGGAGCTCC
ACATAGCTCTCAATATTAGAGGTCAGCAAAGTATGGCCCTTGGGCCAACTCTGTCCCACT
GCTTATTTTTGTTAAATAAAGTTTTGTTGGAACACAGTCATGCCTTTTTTTTTTTAATGT
CTGTGGCTGTTTTGTGCTACAGTGAGAGAGTTGAGTAGTTGAAACAGAGACTGTATGGCC
ACAAAGCCTACAATATCTATTTTCTGGCCTTTTATAGAAAATGTTAGCCAATCCTTGCTT
AAGACTAAGAGCTACCGATTTAGTGGAGATATTCTCCGTAAAGCATTGATTCTCAAATGA
GGTCGGGGTGCTGGGCATCAGAATCACCTGGAGAACTTTTTCATTCAAACTCCATATATA
GTCTAATTGCTAAGATTCTGCCTCCAGGTGAAAAATCACTGACAGGATTGGGTTGTATCT
TTAAGTTGGATTGAGGCAGGAAAATATTTTGAGAACTAGTAGGGAGAAGAAACACAAGTG
TCTTGGTTTTAGTAGTTGGAGTGATACAGCTTTCACAGGCCTCTGGATTACCTATGGTTT
CTCAAAATATATTGGTTTTTGTTTTTTACTTCTTATTTTGTCAGCGGATAAACATAAATT
TCAGAGATTCCTGACTGCTGATGTGGCCCTGGTGGTGACAGTCTATGCCCCAATCACTTT
TCCTCCTGCATCTGTGCTGCTTTTCAAACAGAATAGCAATGGTAAGTTGAGTTCACAGAT
GTGAGTAGGCCTGCAGGTCCTAATGGGTTTAACACTGTTTTCTGTATTTAGGTTTGGGAG
GCAAATGGTATGAAGAAGGTAATGATGGTTTTCAAAATAGCCCAATATCAGCCTCACAGT
AGATCTAAGGCAGGAATGACAAATGGGGTTTTATCTTGCTTGCAAACCTTAGCTAATAGA
TAGAGGCTGCTAAGAGTGCTATATTTAGGACAGATTCTGGGGACAGGTTCAGCAGGAATA
TCACTTAATGATTTTTGCCATGGACCCAGGAGGGCACCATAGTACATCCCTATTTTAAAG
TTTCTATAAGATCTTGCATATGTCTTTAAATGGACTGGAGTGGTAAATGAAGGCTTTGGC
CTGTAGACTCCTGAATAGCTGCTCTGCTTTTGCCCCTTAGGAATGCACAGTCTTATTGCC
ACAGGCTATCTCTTGTCAGTGGATCCAGACAGAATGGTCATCAAAAGAGTTGTTCTGAGT
GGTCATCCTTTCAAAATTTTTACTAAGATGGCAGTAGTACGTTACATGTTCTTCAGTAGA
GGTAGGTGTGAAGGATGGGATCTGATTGCCTTTGTGGGGTGAAGGTTGGGTTTACATTTT
GTGGGTAAGTGTTTCATCTTGGTCTTCCATGTGTTTCATTCTAAGAGGATGTGCTGTGGT
TTAAACCAGTGGAACTGAGAACAAAGTGGGGACGCAGGGGACACATCAAGGAGCCTTTAG
GTAAGAGAATGTGGGATTTTGGACCTTGTCTAGATTTTTCCAGTGCTACTAAATGACTAT
TGGGTTAGAAGACCACTGCTTTAATGTTTTCTACCTTAATTTGACCAACCTGCTGTTTTC
TTTCTAGGTACCCATGGCCACATGAAGTGCAGTTTTGATGGGAAGCTAAAATCTCAGGAC
ACAGTACTCATGAATCTCTATAAACGAGTTTTCCCAAAATGGACTTATGATCCATATGTA
CCAGAACCAGTACCTTGGGTGAAAAGTGGGATTTCTTCAGCACTGCCTGAAGTGGACATG
GAGTAACGGATTCAGTGGGATTCTGTCTCATTATTGCTAATTAGCATTCTAGGGATGGGA
GCCTACACATTGTGATTGGGCAAAGTTTGTATTTTCTACTTTAGCCTAGAGGTCTCTTGC
CCCTTTTTGAAAAAGTCTTTTCTTGCCCTTGACAAGGTGTCTCAGTTAAGTATGAATGTT
TTTCTATTGCTGCTTTGTCCAAAAAACTATTAAATCTTACTGAAATATGTACTCTCTATT
AGGATTTTGAAAGCTGTTTAAGAGGGGAAGATAGGAAGTTGACAGTGACCAGGAAACAAA
ATTTCCAGTTGTCTAGAGACACTAAATCCCATCTCTTCATTTTGCATAAATTAAACTGAA
AGAGATTGATAAGGAGCTGGCCTTTCAGCCTGCTTGACCCAGGTTAGGGAGGTTATGTCT
ACATTTCCACCACTGAGCACAATACAAATGTTTTTTACTTCTGAGGAAACTGTTTGAAAA
TGCTGAGACAGCACAGCAGCCACTCCAACACCAGCTGTAGGTTCAATAAGCAGTTTCATC
CTCTCCCACACCAGCTGGGTTGCATACTGTTGGTACAGAAGGAAGTAAGAATTAGTGAAA
TGGGAGAAGGGGAAAGAGCCCAGTTGGTTGGCCTTTACAATTAAAGGCCAGATGAGGATA
TATACCCAGTCTGAATTTTCTTAATTCCTATATGTATGTGCTTGCCAATGAAGGGCAGGG
CTTTTTTTTCATCCTAACTCTGCTTCTGTCAAGAGGGTTGTCTTAATACATCCAGGGCAC
CCTCCCACATGTCATTAAGTCACCTAGTCAAGTCCCCAGTGGGTGAGTTGCTACTTAGAA
CAGGAGAGAAGTTTCTTTTGTCTGAGAAATTGCTCTGTTCTTTTGTTATTTCTTTTCCTC
TTGGGGCCTCACCTTAATTTCATTTTCTGTGACAGTGAAGACATCATCCACGAGGTCCCT
TATAATAGGCCAGGTGTTTAAGCCAATGCTGGATTTGACACCATCTGCTATGGTTTCTGG
AGGATAGGGATTGGGGGTCAGTTCCCCTTTCAGTTTGGACTGGTAGCAGTCATCTGCATT
CAAGGGTTCAGCAGCATATACCTTTACACTAGGTCTCAGAGCCTGGGAAGAGAAATATTA
GACATCTTACAACTACCCACAGCATTTTGCCTGCATGCCTGCAGTAAAATAGGCAGTACA
GGTAACACATTGCCCAAGTAAAAGCTTCTCTTAGATAGATACAATGAAAATAGGACCTTC
AGGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1200, 1392..1495, 1794..2013, 2127..2261, 2657..3081, 4473..4632, 5064..5221, 5567..5763, 6504..6666, 7014..7124, 8084..8216, 9764..9880, 10300..10440, 10545..10619, 10747..11183
1041..1200, 1392..1495, 1794..2013, 2127..2261, 2657..3081, 4473..4632, 5064..5221, 5567..5763, 6504..6666, 7014..7124, 8084..8216, 9764..9880, 10300..10440, 10545..10619, 10747..10922
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved