Equus_caballus Locus ENSECAG00000008928
snOPY snoRNA Orthological Gene Database
Equus_caballus ENSECAG00000008928
Equus_caballus
ENSECAG00000008928
11
SNORD42, snoZ17, SNORD42, snoZ17
1510..1576, 3088..3159, 3792..3856, 4045..4116
5292
TGTTATGGCGTTCTTCGCTTTGATCCCATTGGAATCTCTCCCCACCAAAGACAACTTTT
CCTTTTTGCAGTTTTGCAGGATAGAAGAGAGGGTAGCACACAACAAATCTCACCTTGAAA
GGGGAAATCTCGTTCCAAGAGGGGAGGGGAAAGGCAGAAAGGGCCGTGTGGAGGTGGGGT
AGGCAGACCCTCAGAGATGCAAACCTGACAAACCTGAGCGTGACTAAACCTTGCTGTGTG
TCGGGAACTGAATCTGAGGATGCAAAAATGACTGGGGCAGGGTAACGAAGACTACTTAAA
GGAGGGGACTGTGAATGAAATTATCCGCAAGAAAAGCTAGCGAATCCTGGAGAAACCTGC
GCGCTGTGTGTTTGGAATATTGGTAGAGTTTCTTCCAGAGTATTACCGGGGAAACGCAGG
AAATCTAATTGTCACAGGGGCAGATGTGGCTGCCTCCTACCTCCTCTGACACTGCTCCTC
CCCTCTGCCTGACTCTACTTTTTCTGCCACCAAATCACTGTTATTAATAAGTCACGTCCC
CTCTCCGGACCTCAATTTCCACAGATGTCGTCTGAGGGAGTTGGACCGGAAAAATTCTGC
ACTAACGTTCTAGAATTTTGCTTCACTTTCCCTGGGTCACTCTAACCATATTCATTCCAG
TTTGCAGTATTATTATCTCCTGGAACTGCAATCCTCTTTGAAGTTGCTCAAAATGAGAAG
CGCTCAGGGTCAGACCGAAGCTGTGGCCAGCTTCACCCATCCGGCGCCGGGCCGCAGCAA
ATAAAAACGTGTCTCCAAAAAACTACAACCCCCAAGAAGCTTTAGCAGCTTACGAGCGGA
GGCGGCGCCTGCGTAGTTCCTCTCGCGAGGAAATTAAACCCAACTACCATTCCCGGCGGG
CGCCGCGCTACAAAATTATCCAATCATCTTTAAGTAAAAAGCATCGCGAGTCTTCGATGA
GATTTGGCTCTATAAGCCCGTGGAACCGGGTCTTGGAAACCCTTTTCAAGAAGATGGCGC
CGAAAGCGAAGAAGGAAGGTGTGTGCTCGGGCTAGGGGCTGCCGCTGGCTGGTCTGGGAT
CCCCGGAGAGCGAGCGAACTGGGAGGACGATGGCTAGGCTAAGGCTTGGGGTGTCTGCTC
TGGAGCTGCTCCTTGCGTTTCGGCCGCGCTGCGGTGCGCGTGGGCCCAGCCGCATGGGCT
CCAGTGAAGGGGGTTGGGGAGGCAAGCGCGGCCGGCACCACCCGCGGGGGACAGCCAGAC
AATTGGCCCTGGGGAGCTACACGCATCTACAGGCCGGAGCTCCATGTCTCCAGACCTATA
AGGAGTCAGTGCCATCAACTTTCTTTTTTTTTCTTCTTGTTAGACGGCACTATGTTCCCT
TCCAGGGTGACTGTGCGATGGTATATATTAAATCAGCACACATCCTGGCAAGTATCAAGC
ATTCGATCGTTGTTAGTTACTTTTTGTTTTTCTTGTATCCCTGGAGTTACTCCAAGTTCT
TCCCAGTATCGTGCACATGATGGAAAAAATTAAACCACCTGAAATTTGTGATGTCTTCAA
AGGAACCGCTGATGCACGTGTGGCCTGGGGTGCCCACTACCGGTCTTGAGGCCGGAAGTG
ATCGATTTCTGAATCTCGCACCCTTATTTTCTTTCCTTCTCTCAGCCCCTGCCCCTCCCA
AAGCCGAAGCCAAAGCAAAGGCTTTGAAGGCCAAGAAAGCTGTGCTAAAAGGCGTCCAGA
GCCACAAAAAAAAGAAGATCCGTACGTCACCCACCTTCCGACGGCCCAAGACACTGCGGC
TCCGAAGGCAACCCAAGTATCCTCGGAAGAGCGCCCCGCGGAGAAACAAGTCAGTACTGC
CCCGTACCCATGAAAAGATGTTTGGGGATTCTCCGTTGGTAATGTGAAAACTTACCAAAC
CTAGAGCACGACTTCTCAAAAACATGTTAAACCTAGTGTGCTTCTCTAATGGGAGTGAGA
GAAGATCATTAATACCCTACTTAACAAGCGGAGACGTTTTTACAGTATTGGCAGGAATTG
TGTAAAACAACCCAGAGTCACTGTCAAGGTTAATTGTTAGGTTAATTATTGCTTCATATG
TGGTCAGGGTTTTAAAGTCCACTTTCTTGGGAGTATAAAGTAGGGCTTAGAGAAATGTTC
TTTGTGTTGGAGTTCAGGTTTAGTTGGTTCCTTGTTGCACCTGTTGCTATAGGGAACAGT
CCTTGAGGGTCAGGATGTGGGATGACTGTAGATTGATAAGGAGATTAATTTATCTGTAGT
GGACAGTGAAGTCCTGCCACAGTGTGTGGAAACTTCTTTTCAATCACTCTTCCAAATTTT
TCCATTCATGGAATGGTTAGGAGGAAATGGGCAAAAGGTTAGGGTACTTGAGTATTTGGG
TGTCATGCTACTGATAACTGACCGTAGGGAGCACAGATTAGAGTAGAGCCAGGGTAGTAG
TTGCCACCAATGGGTTTCTGGTCCTCCCACTGTGCTTCCTAAAAAAAAGGCAGGAGAGAG
GGTTGTGTCCATGGAGGACAGCACTTGACAGACTTTTTACCCCCATTTGGACCTAGAATT
TAATGTGATGAGAGGTGGAGACCTGACCTCTAGCTTCAAAACAAGAAGGTTGTGTTCGGT
GGAATAGAGCCTTGCTTCTCTGAATTTCAGGGGGCATGTTGTGTCATAGGTGTGTTCAAG
CCACTGGTTTTAAGTTTAACCTGAGCTGCAAATAAAAAGTTGCTCTCAAGAATTGATGGC
CAGCCCTCAAGCCAGTTTTCAGCAACCAAAGAGGACAGAAATGGTCTATTCAACCACAGA
GTGAAGCACCAACATTCTTTGGAACCCTAATCTGGGTTTCAGGATTCCGTAGTCTAGCTT
TGTGCTTTTGGGTTAAGTTGTTTAACCTCTCACGTCTCAAATTTCTTCCATCAATTTGTC
CTTCAGAAACGTTGAGGTCAAATAAAGAATGAAGGGGTTTGGAACTCAAAGATGATTCTT
GAATCACTTAAAGGATGAAAGCCCTTCAAGTGAAAGAATGCACAAGGGTTCTGTCCCCAG
GCCGAGGCTCCAGGTCTCTAGGTTTCAGGGTGCAGATGATGACACTGTTCAGCGACCAAA
GTCTGACGAAGATGATAGCTACCTCGTTGTCTGATGCACCTGGGCTCCAAAAGAGGGCCC
ATCTTTGCTTCTGCTGGACCCTGGGCAGGTGACCCCATTTTGCCTCTCCCCCAGGCTTGA
CCACTATGCCATCATCAAGTTCCCCTTGACCACCGAATCAGCCATGAAGAAGATAGAAGA
CAACAACACGCTTGTGTTCATTGTGGATGTCAAGGCCAACAAGCATCAGATCAAACAGGC
TGTAAAGAAGCTCTATGACATTGATGTGGCCAAGGTCAACACCCTGATCAGGTGAGTGGG
GCCCTGTGGGATGGAGAGGAGGCTGGTGCTTCAGTCAGGAACCAAGAAACCTGAATCGCA
TGAAATTTCTTGATGCTGCTTTTGGGGTCAGAAGGTGGTTTCACAGTGTGCTAGCCTTGA
GAAATGAGTAGCCCCTGCTGTAATTAGTTCTATGTGTAGAGTGTAGGCTTTTGAGCTTGT
CCTGCCTCTGGGACTTAATTTGCGCGTTTGGTGCTCATTTGCTCATTTTGGTGCTCTGGT
AGAGGCAGGCCCTAAAGTGAGATACAATTTTATGTCAGACTACCTCAATTTAGGTCTTGA
AACGTCCTGTGGTGTTTCCCAGAAAACGTAATTGGCTTCCTTTGTGGCTTAGTGACTTCC
CTAGTCCCCTATGCGCAAATGATGGAAAAATCACTATTTGGAAAAGAATGACATGAGCAA
AGGAACCACTGATGCGCAAAAGACTGGGGGAGGCAGGGGCCTGTGCTGGCAGTGAGGGGC
AGCGGGGTCTAAGGGCTTCCTTCTCCACCCTAGGCCTGATGGAGAGAAGAAGGCATATGT
TCGACTGGCTCCTGACTATGATGCTTTGGATGTTGCCAACAAAGTAAGCTTCGTTTGCTA
CAAACTCCTTAACACCTACCCCTCGGGTGCAAATGATGTGTATGTTAGCGACCAAAGCCT
GACCTTTGCTGATTAGGCCTAACTGACTGACTGTACCCCTATCCTTAATAGCCCTACACT
CACCATGAGCCATCATTTTGCTTTTTAACCATGACATTCCAGCTTAATCTTCACATTGCA
GCTCCCAGTAACAAAGCTCCCTTTTGTTTTTCAGATTGGGATCATCTAAACTGAGTCCAG
CTGGCTAATTCTAAATACAAGTTTTTTTTCACTATATATATGCTTCTTGTCTTTATGTTG
ATTTCTGGTTGGGCTGGGAGGAGGCCATACTGAGGTATATACACACCTAAGTAATAGGAC
TTGGGTAAGACTCTTGGTCTATGAACTGTGTTGGAACACTTGGCCCTGACACTTCATCAG
ACTTGTTATAATCCTGGTGGTGGGACCTCAGGTAGCAGAGATATTTGTGACCCAGGCTAG
GGTTAGTTGTCCTAGCACAACTACAACTTGCCTCCTTCGTAGGGGTAAGAGAACAAGCAA
GAAGCTTTATAAGAGCCCCTTCCTTTATCCCTGGAAGAGGCTTTATATGAAACCAACACC
CAGGGTTTTCATTAGCATTCATTTTCAGGGCAGTGTGGGGCTGGCACCATGTCCCCACAC
CCATCTATCATCTCCAACCGGTCTGTCTGCTCCCCTCTCCTTGACAAAGAAAGGACAAGG
ACTTCAGAGGAGTGCTTTCATTAATGTTTTCAATGGTGGGCGCAAGCTTGAAACATGGAG
AGGATGCTCCAGACTTGGGGCTGTCTCTCAGTTTCTGTTGGAGGCTGTTCCTGGTTGTGT
TTGTCTCCTTGCCACAAGTCCCAGGCTCTGTGCCTTTCACTCAGTCAAGAACTTGTCTTT
CTGTTGCCGGCGGGGGACACGCTCAGGGCAGAAGTCCGAGCGGAGGAGGCGGGAAAAGTA
GATGAGGATCATGACATCCAGCATGAGCAGGACACCCAGCAGAAAGGTGCCAAGGGTCAT
CTGGCCCACGTAACGCAGGAAGAAATGGGTGAGGTAGGCCTGAGGGGCCAGGCGGAAGAG
AAAGTACATAACCAAGTTGACATACTTGTTGATCCGGTAGAGGAGGAGATCCTGGGCATT
GTTGATCTTCATCATCATGCGGATGGTGAGGAAGATGTTGCTGACCTCCACCAGCAGTGT
TAGGACGCCCCCACCGACGAAACTGCGCCAAAAGATGCCTGAAAAGAAGGCAGCCATGGC
CTAGAAGACAAGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1037, 1665..1848, 3234..3410, 3933..4002, 4234..4292
1013..1037, 1665..1848, 3234..3410, 3933..4002, 4234..4245
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved