Equus_caballus Locus ENSECAG00000014311
snOPY snoRNA Orthological Gene Database
Equus_caballus ENSECAG00000014311
Equus_caballus
ENSECAG00000014311
11
SNORA21
125474..125607
130495
ACGTGTGAGGACTTCCAGGACGAGGACCACTACTCGTCTTCCCCCGAGAGCTCCTTCAG
CCCCTTTGAAGGAGACCTCACCACCACCTCCTCCTCCCTGTTCATCGACAGCCTCACCAC
GGAAGGTAAGGCCTGAGCCTGGGTGGGGAGGAGGGGAGAGAAGCCACGGGGGGAAGAGCT
GCCACCCTGGAGCATCGCTATCCCTGATGGGGGTTATCACAGATGAGTCGGAATTGCCCC
GTCCCTTCACAGATGAGGGACCTGAGGCTCAGAGAGCTGGGGGTCACATACTGCTGAGAA
GCAGAGCCAGGCTGAGTGAGTGGACTCCACGCCCAGGTTCCAAACATTGTGCTGGCCCAT
GCCAGGGCTGTGGGACAGAATTCACTGTGGCCAGGGGGAAAATTAATGCCCCAGCCCAGT
GCCAGGTATTTTGTATAATATATCCCAGTTAATCTGAACAGCAATCCGCACAGAACCAGC
GAGGTCTCAGCATCTGTGAAGCAGGCATGAGCTCAGGCCACACACTCAGACGTGAGAGAG
AGAGTGCCTAATTTTTCTATAACTTTGCTTCTGGCTCTTGACCCTCGCTCAGCTGGGGGG
CGGGGGGTGGAATTCCACCTCAGCCACCTGGGGCTTGGCTCCCTGCTGCTGTGACCTGTG
TGGGCAGAAGGTCGGAGTGGGCAGCTCTGTCCATCTTGGGCTGCTGCTGATCCGTCCCTG
CTTCTTTGGGCCTGACTCTCCCCAGGGGTTTCCCTGCCATCTCGAGGCCTGGGTGTCTCG
AAGAAGCTGCTGGAGGTCCATCCACTGGGAAGCACTGCGAGGTGTCTGGGGAAACCTTGT
GCAGACCCGCCAGGATTCTTTGGCTATTTCTGAGAAGTTCCTCTCTCTCATCCTTTTTCA
ATGCATCACATGTTTTAGCCCCTCGCCCTTAGGCTACAACTGAGAGACTCGTAGGTTTTT
ATCACCTCCCCTGAGCCAGATACCTGCTTGAAAGGGGCACATGGAAAAGAGGAAAGGGGA
GAAGAGCAGAAGTTAATATTTTAAAACATTATTCAGCCACAATCCCATTTTTTAGATACA
GAAACGGGCTCATAGGGCCAAGGTAGGTTACTCAGGGTTACATGAGGAGTAAGGGGTAGA
ATGTTCTTTCCATGGCGTCCCCTGCCTTCTAAATGCAGCCTAGAGAATTAAAGCAGGAAC
TCATGGATCTGGCCAGAGGGAAGTTATATAGGAAAGTGAACAAACGATAGGAAGAGCCAA
CCTTTTCGGGGGACTGACCATGTGCCAGCTAGAGTGCTACCCTTGTGCAGGCATTAATAC
TCACTAGTCCTTCGAACAATCCTGTATGTTGATGCTCTTTTATCCCCATTTTATAGAGGA
GACACTAAGGTTCAGAGAGGTCGATGACTTGCCCAGGGTCACACAGCCAGGAAGAGGTGG
AGTCAGGTCTCATCCAGCTCCAAAAGCAGTGATCTTGCCCCTCGACTCCACTGCTTTTCT
TGGTGCTGAAAGAAATAGAAAAAAGTCTTCAGGGATTTAGGGGACAGGGAAAAATAGTGA
AAAGTGGAGAAGTGAGGCAGAGTCGGATGACACCCATCACTCTGAAGTTGCCTGGGAATA
ACAAGGAGCTGGTTAAGGCACAGGTATTGAAAGTAGCATCATGCTGGTGCTGTGGGGGAT
TAAATGAAACAGGAGCAGGAGGAGACCTTGCCATCAGCAAGTTAAAAATCCAGTCCAGAG
GTGGGAGTCTACCCCGCGCAGTCTGTCTCACATACAGGGAGATGTGAACGAAGAGGTTAC
AGCACTCCAGCCAAAGGGCCCCGCCTGGGCAGGGCAGGGTTAGAGAGCAGAGAGTTAGCT
GGAGCAGGTTGCTGGAGGGTGCGTGGACCCCCTGGCACCAGCCAGGCAGAGGAGCAGAGA
GGGCCGGGGGGACCAGGAGGTATGGGGGCTGGATTTTAAGAGTTGCTCACTTGCAATCAA
ATGCTACCCCCTTCAGTGACCGAGAATGTCCTTGGAGTGGCAAGCCTCCACCACAAAGCC
CATGAGTTTTATCACAAGGAAGGACAGGCCCACACCTGGAATAACCGTGTGCAGTAGGAG
GGCTCATCTGATGAGCAGCTGAGCGGAGCACATTGATAGCAGCAAGCAGTGACAGCTGAC
TACAGAAAAACGATCACTCACGCAATAACCTCACACTCGTTTATTTCTGTGTGAGTTTTC
TAGGACTCCACCACAATCCATTAGTTAGGGAGCCAATATGCATTCCATGGACCGCCAACA
AAATGGCAGCTGGGAACCAGCCTTTGGTGAGTGAGAGAAAAGCTGTTGTGGGCACAGTGT
GGTCACCTTCGGCCGCTTTGTGGGAGGGACCAGCTGGAGGTCCTTTTGTCTGCAGGGGTA
GTTGTGGACTGGGCTATCATGGATTTCAATGATCTACATTCAAAACAAGTTGATTGGAAT
CAAGGTAATTTGCCCAATGATATTTAGGGTTACTTTAGTCAGTTTTAATTAACCAATTCA
TTATTTTCAACTCTTGCAGTAACAAAATAGACTCAGAGTTGTTTCTTTTTTTTTGAGGAA
GATTAGCCCTGAGCTAACTGCCACCAATCCTCCTCTTTTTGCTGAGGAAGACTGGCCCTA
GCTCCCATCCGTGCCCATCTTCCTCTACTTTCTATGTGGGACGACTGCCACAGCATGGCT
TGCCAAATGGTGCCGTGTCCACACCCGGGATCTGAACTGGCGAACCCCGGGTCACCAAAG
TGGAACATGCACACTTAACCGCTGTGCCACTGGGCCAGCCCCTAGATCTCCATTTAAATC
CCCTGTTTATCGAAATCCCTAAAGAAAGATCCTTCTAAGTCTACAACTGTCTATTTGTCT
TGTTTTACTTTCAGTTTTTAGGGGTGCTTTTTAAATTTAATTTTTTGTAGTTATGTAGTA
ATTAAATGATAGTTTACGTGGTTCCAGAGTCAAATCTACAAAAGCAGGTATATTCAAAGA
AGTTTAGTTTCTAGTTCTCTCCCCATTCCCTCTTTCCTCTGTAGGGAGCCATTGACAAAT
TTTCTTGTGGTTTATTCTTCCATTATCTGATGTGATTTTTTTTTATATTTTAAGGTTTAT
TGGAAATGTACAGCACAGCAGGGTGCCGTATCCAGGCACTGGGAATGGAAAGAGGTGGGG
TGCTGGGGGCTCACAGTCTAGGGGAACAGTGGGACCCAAGATGCTGCAGAAACAGGTACC
AAATGCAAGTGGACACAGAGGAAGACACACCCATCTGTCCTCTGGGAAGTGACAGGGCCA
GGGCCAGGACCGGGGTGAGGCAAATGAGGCACTCCACTCAGGTATAAAATGTAGGAAGAC
ACCAAAAGAAAAAAGCAATGATCATAAATAATATTTTAATGTAATATTTATAAAAATCAA
AATGAATGCCAAAATTCCATGATGAATAAAGTATCAAAATTTTAAATAAAGACAGGATCG
GACCCTGTTTCGCTGGTGTCACCCTAAGCCCAGCCCTGCAGAGGGCATTTCAGAAGTGGG
ACTTTTGAAAGAGGGATGGTAAAGGAGAGGAAGGGCATCCCTGCAGGAGGAACGGTATGT
ACAGCTGCTCAGAGGCCTGAGAGATCTCCAAGGTCGGGAGAGCCTTGGGCCACTTGTTAT
GGCCACTGCCACAGGGGTGAGTGGTGGCAAGTAACAGGAGGAAAGAAGACAGGAGACAAA
TTGTGAAGGGCCTTGAGCATCTGTGAACGAAAGGGACCCAGTAAAGCCTTTAAGATGACC
TGGATTGTAGAGGGGCTGGAGCGGGAAGGGAAACGAAATGCATGCTGGGGGCCATAAGTT
GTGGAACGGTTCGATTTGTTTCAAGTTTTGGTGCTTAAAGCAGCCATCTCCAGTCATCTA
GAACCTTCTCCTGACCTGGAACTCTTGCTCTCCTTTTCCCATATGACTCCGTGGGGCAGA
GCCACAGGAAGGCCAACCACTGGGACTTATCTAGGAAGCCGCAGGACATGCACCTTGAGG
TGCAGAGAGTGTCGGCGTGGAAATCTGTCCTCCACACCGTCCTCCAGGCAAATCTGCTCT
GGTGACACACACACCCTCCTCAGATCCTTCAGCGTCCGCATGTCCCTGAGGAGAACGCGA
AGGGTCCTCGATTTGGCTTTCCAGACAGCCGTGCCCCCACCCCAACCTCACCCTCACCAA
CCCCCACTCACCTCCTCTCCGCCCTCCAGCTCCGCTGAACTGCTGCTTATTTCTCAACTG
GCCTAGTTCTTGCTGACTCGGGGCCTTTGCCCACACTCTTTCCTCTGTCTGGAACCCTTT
TTGCCAGCCCCATATCTCATCCTTGCTTGACTCCCTTTGTCTGGGTGAGGCCCCAAGTTA
GAGCTTCATTGTGCTGGATTTTAACTGTCTCTCCATCCCCCGCACATGTTAACTCCCTGA
GGGCAGAGACCTCCTGAGTCCACCCCCAGTGCCTACTCCCGGTGCTCAAACTCGTAGTAG
TAAACACTCAATAAAGAGTTCTTGACTGAATGAACGTAAGACTAGGAAAAGTTGGCTTGT
TCATGGCCTTCTATCATTACACTGCTGTGTGACTTTGAGTAAGTCACCTCCCCTCTCTGT
GCTTCAGTTTCCTTGCCTCTAAAATGAAGGATGGGACTGAATCTCCCTAAAGTCCATTTG
GACCTAAAGTGACAAAGGCCATAATGATTCCACTAATCTTGCGCCTTCTCTCCTTTCTCT
TTGAAGATGACACCAAGTTGAATCCCTATGCAGGAGAAGATGGTGAGTGCAGAGCTGCCT
GCCCCTCTTCATCAGACCACTGCCTCTTGGACCCCCCAGAAGAGGGGTGCAGCTATCACT
TGGCCTCTTTGCTTTCATTCCAACAGCAGCCGGAGTTTCCCAGGCCTCCTGCTGGGTGGG
AAGGCAGAGGGGCTTCTGGGCAGGCCCCCTGGACGGAAGGAGCTTGTGTCTACCTCCGGG
CATTTCTCATCTCAGCCAGGAACGCCCTGCAGTTCTTCTCCCGGCCTCTCTGCTCTGGAA
TATTCACCGCCCTGAAAGGAGCAAGAGGAGGAGGGAAGGGCTGTGCTAGAGCAGGCGTGG
CAGTGTGGGGCCTGTGGCCATTGGCCTCTTGTCCCCTTGGGCCTCACGGTCATTGAGGGG
TGGAGAGCAGTTTCTCTTATGTCAGGTTTCCTTTGTTTCCCACGCTGAGTGGGCAGAGAG
TACACAAAAGTTGTCCACCACAACTTTTACGGGGCTCCAGAGGTGGGGTCTCCTGCCCCC
AGGGTCATCTGGAAGAAGAATCTCTCTGATGACGTGAGGTGGCCCCACCTCCCCTCCCTG
TACCCAGAGCCAGCTCAGGCCCTCCTGCAACCACTGCAAGGGGGAGACGGAAATGCCTTC
CAGCTCCAGCGGCTGGGAGCTTGTCATCTGGGTTCCAGCAGCAGAGGAGAGGCAGTTGAA
TGTGGTCTCCCACCAGAGATGGAGCCATTACTTCCCCTCCCTCTGCACCATGTGCTCATC
GGCCCAAGCCCTGACCATTGGATCGTCAGGGTCACTGCAGGCTGTGGGCTGAGTGCCAGC
TCAGGGGAGGCTAGCTTGGGGCGTGTCACGTCAACCCCTGGACCTGTTGGCAGATAGAGG
CACTAACCATGCACTGGAGTGCCCAGGGTCGTTTCTGTCCTGGGTTTCCTCTGCAGAGAG
GAAGGGATGGGGAGATCAATGATTTTGGATGCTTACAGCATCCTATTAAAAATCCCCACC
CCCTGTTGACTCCCATCCCACCCACTAGCTGTGTAAAAAGGATGTGATATTTCTATTGCT
TCCATGCTTACCTGTTATCTCTACTTCATTATCTCCACATCCCGTTAGGGTAGGGAGAGG
AAGCAAATAGCCACCCAGGTAATATGAGGGAACAAGGCTGCTTGGTGGCTGACACTGACT
GCGTCCTTGGGCAGATCCCTCCGCTGCTCTGTATGTCTGTCACCTCAGCCACACGAGGAA
GGGGTTGGACTGGGTGAGCCTCCAGCTCTGTGGTCTATGGAAATAGTCTGCTCCTTGGGA
TGCATTTCAAATGCTTGGGATGTTCTCAGCGAGTGCTTGCTGGCTTAGTAGCCCTTAGAG
GACCTAGTCCATTTCTTTTACTGAGCTCCTACCATGGGTCTGCATTTTTTCTAAGAGCTG
AGGACACAGAGATGAATAAGACACTGTCCCTGCCCTTTAAGAGGTCACAATCTGGTAGTG
GACAATGACAGGTAAAAATATGGTCATTTTGCTATTGCAACAGCTGATACTTTTTGAGGT
CATCCAGGATGTCAGCCATGGTCCTCAGCAGCTGACATGAATTACCTCATTTTAACCCTC
ACAATAACCCTAGCAGGTAGTTATTATTATGATCCTTGTCCTGCAGAAGTGATAACTGAG
ACCCAGAGAGGTTAAATAATTTGCCCAAGGTCACACAGTTAGTAAGCGGCAGAGCCTGGT
TTTGAACCCAGGCAGCCAGACTCCAGATGCCAAACTCTTCACCATCACGTGCCCTTTGTG
AATTCCTTAAACGTGCTTATGTGGCACAGATAATCAGAGAGAACTTCTCTTACGATCCTT
GTTAGATGCTTGGGCAACTTTTAAGTGATTTTGGAAAACCACCTGAACCGTGCCAAGAAC
CGGGTTAATGCCATACTCATGATGATTCCACCCACATCCCATCCCACGTTTTCACATATT
TGATGAGTAGACCGGAAGGTTCTGTTGGCTTTCATCTCTGGGGCTTTGTCAGAACCCGGA
CTCCATGGCCCCACCTCCCTTATTCCCCAGCAGCCACTCTCTGACAACTCTCCACAGGCC
TTCAGGACAACCTGTCCCCCAAGACAAAGGGCCCCCCCGTGCACCTGGGCACCATTGTGG
GCATCGTGCTGGCGGTCCTCCTTGTGGCGGCCATCATCCTGGCGGGCATTTACATCAATG
GCCACCCCACCTCCAACGCTGCACTCTTCTTCCTCGAGGTCAGTGTAGAATTCCGTCGCA
GCTCTGCCGTCTGCTTCTGCATCAGCCTTTCCCCGGCCATTCGGCACCCGCCTCTCCCCA
ATCATCCCTCACCCCCACATGCCTGGCTCATGTTCCTACCTGAGGAAGCTTCACGGACTC
CCTCCTGGCACACGGCACACTGGCTGGCGCCCTTTTAGTCCTAACCCCTGGGGCTCTGCG
CCTCAGAACATCAGCAGCCCTCCTGTTCCGCTGGACAGCGCATCTGCTTTTGCTCCCCTG
TTTGTGAAATCAGAGAGCCCCCAGAGGAAAGAAAGAAGTGCCAGACATGTCCATTTAGTG
GCCGTGTAGGCAATCCCTAACGATTTATGGTCTCTCACGCCCAAATTCCAGGCCTGGTGC
CTATTCAAAGCCACAGTGGAACCGAGGTCTCTGCCTCTTTGCCTGCTGTTGGGATGTCTA
GATTAGAAGTGACAAGTCATAATAATCCCAGGAGTTGCTCTTTCTGGGAGCTTTCACTGA
GGATGCTACGGTTTTGAATGTCTCACAATTCGGAAGAGCCAGCTGAGGTGCAGCCTGGGA
AGGAGGCCCAGCCCTCCACTCTCAGCTGCTCACCACTCTCCACGTGGCACAGCGGTGGCG
CCTCTGTGACCGCAGTCTCCACACGGTCATGAGCCCACTGACCTCATTACCCAGAGGCCT
AGGTGGTTCCCTCGTCTCTGTTTAGACAGCCCCTGTTTCTTGTGAGTCCTAAGCAGTCAT
TCAAAGTCATAGCCTACATGGGTATCACATGGGGGCCCCCAGCCACAGGGATGCTGACGG
GGCAGGTCTGAGGCGCACCCAGGAAGCTGCGTTTCCATAGGCCCCCCACGCTGGTGCAGG
AGCTGTACTGTCTGGAGGGTTAGCTCAGCATTCCTGGAGCCTCCCTGATCGTTCCGCCTC
TTACCCGCCCCCTCACTCTCCACATTCTCAGGGCTCAGCTCCACGTGTTGCTGAGGCCTT
CGCCTAGTGTCCTGCAGTCCGCGCAGAGAGGGGTGAAACGGCCTCCTTCCAAACTCGGGC
TCCCAGCAGGTTTCCCAGTGGCCAAGGGGTCACAGTGGGGAGCCTTTGGGGGGAGGACCC
TGACCTTCACCTGGCTCACAGGAGGCCCCCAGTGCCCTTGTAAAAGAGTGTTGGTGCCCA
GTGCTGTCCCTGAGGGGGGGTGTCCCCAGTTGGTGAGGTCGTGCCCGCTGACTCTGCGTC
TGTCCCCTGCAGCGGAGACCCCACCGCTGGCCGGCCATGAAGTTCCGCAACCACCCCAAC
CACTCCACCTACACAGAGGTCGAGCCCTCGGGCCACGAGAAGGAGGGCTTCGTGGAGGCC
GAGCAGTGCTGAGGGCATCGGCTCTCTCCTTGGAAGAGTAGGAACGAAGACCCAGGCACC
CCAAAAAAGATGAGTCAAGGCAACGCAGAGAAGTGACTTTCCCTGGCCTCCTCCGAACAT
ACCCTGGCTGGGAAGATGAGACAGTGGTTTGTGGTGCCAGGGCACCCCAGATATTGAAGC
AATGGGCAGAAAAGCAACCCCACTGAGTTGGTAAGGAACAATAACCTGATTTCATCCTGT
TTTGATGCAAGGGGTCTCCCTTTCCGGGTCTCTCGGTGGTCTACTCTGTAGCTGCCCAGA
AGCCCCTCCCACCCGGTCCTGGTCACCCAACAACCCTGCATACGACACAAGAGAACTAAA
CTCTAGATTGGGGCACCGTGTGCCAGGGTCCATAGACTCAAGAGCTGGTCCTCGTGGCTA
TGGATTCGTTTGTGTGTTCAGCCCCAGCTTCTGTGTCTCCAGGAGTCTGAAGAAGGAGTT
CTTCCCAACTGTTACACACAGGTCTGACTCCCCCAGCCCTCCATCAAGGCTTCGCTCCTC
CACTTGCCCTATCTGCTGAGAACGGGTACTTCTGCATCGAACGTGTGTGCCGCCCGCGTC
TCAGCCGTCACGCAGCGGTGGCCCAGCCTCGGCCTGGCGAGCCGAGCTGTGCGCGGCCAC
GTCTGCAGCAGCTCTTTATTCCCTTGGCACGTTTGGTGTCCGTTACATTCACTGGCCTGT
TCTGGCGGTGCCACTAAGTCCCTCCAAAGGCAGGGCTTGCCTGATGAGCATTTTTCCTCC
TCTGAGCTGGAATTTTATAGCCATTAAAGATGAACAGGGTGACGAGAGGGCTTCTTGAGA
CTACCCAGCAGGGAACTTCACTTGGATTCTGTTGAGAAGCAAAGCCACCAGAACGGTTGG
GACAGAGGAAGCTGGCGCTGGAAGGAGGGACTTTGTATGGAAAACCTTGACCTGGACAGT
TGCTGCCATCTCCCCAACTCTGCTGGGTGTTTCTGGGGCAGAGAGTTTAGGCTCCCAAAC
TTAACATAGTTTTAAGGGAGTTCTGTCCAGCGATGAGTTGGGGCTCCTTCTGAAGTGCAT
TTAAAATTAAAATCTATAGCTTGCCCTCATTCAAAGAAAAAAATAGCAGCAGCAAATAAA
CGTTAAAATCACAGTCTCTACTTAGTCACGTCCTTTTATGCATGTCACTGGGACGCTGCA
AAAGAAAGAAGTTAAAGTCCAAGGCCTCGGGAGGCGGGGGTGGGGGGTCCACAAATAACC
AGACGCATCCAAACACCTGGCTGATGGTTTTCCAGTCGCTTCTTGGTTTATCCTGAGGAC
GCTAACGACAATCCGAGGGAAGCACAGACCTTGGCAGTATGTATGTTTGCTTCATAAACC
AGACAAGGAGGAGATGGGGAGGGTCTGAATTTGAGAAAGAAAAAAGACAATGCAGCAAAG
AGAATAGTGTCTTTTTCAAGCTTCTGATGGACAGAGAGGTCTGTAACAGCTCTCGTAATG
GGAGAAGCACAGCCTGGCGCTGAAATGATCTGGGCTCCCCGCACTCCTGGCCGGCAAAAG
GGTGATTTTTGCTCTTGCCCGACCAGTAAAGCATCTATGACCTTTATGTGTTTAAAATGG
CTAGAGGGGCCATTTGTTTTGTGGCCAGTGCACAGCCCCATTTGTCCCATTCCCAAACTC
CAGCATGCTTCCTCCCAGTGGGAGCTCTGCCAACCGCTCTGGATTCCTGAAGGGAAAGAA
CACCGAAAGTGAAGCAAGGGGCAGGAATGCGGTGAAGCCTCTGCTGTAACCGCTGCAGCT
GGAGAGAGATAGCACTAGGTGCCTCTGGCCCCAGTCAGGGCGCCTGGCTGGCCCCTGGGA
TGGCAGTGGTGAGGGCAGTGGGGCTGTGTGGCAGCAGGTAGCCTGCTTGGTTTACAGCAA
AAAGAACTAAAGATGTGTCCCTAAGAGAGACCTCTGGACACTCAGAGCCTCTGGATTTCT
TGAGCCAAAACACGCAGCCCAGTCCCCAAGGAACAGAGCCGGCATCCCAGAGTGAATGCT
GGTTCCCAGCTATCCTTAGGATCTCTCGTGAGATAAGCGTTTCTTAGATAGACCCAGGAG
TTTTATTCCAAGGTTTAGAGCAGGTTAGATGGGTAGCTGTAGAGAGGGACCCACTCAGAG
AGTGAGTGACCAGAAGGGGACACAGGGGTCTCATGGTCAACCCTCCAGCTTTGGCTGACA
ATCCGGGAAGACAAAGTAGAACTTCATACACTGCGCGCCATCAACCACAGGGAGCGCGCA
GACGCCCAGGCCCCTCCGCCCCCCGGGCGTGCACCATCTCCGAGGAAAGCAGGCGGGCGG
CAGGTGCCTTCCCCACACGGTGTCTTTGGGCATGTGATGCTACTGTGATCCTACTTGGGG
GATGGGAAGGGTCCGTGAAAGTTCACCACTGCGACAGGAAGCTTCAACCCTGTGAAACAG
GGCTCTGGGAGCTGTCTGTGTTGTACCCAGAAATCAGAACCTCTCAGGGAGGCTCTGCTT
TACACCAGAACTCTTAAGAGAGCAACAAGAAAATGGGACTAAGAAGAGGAATGCAGAGGC
CCGGCGTGAGAGGGGACCCTGGATCAGGCTATAAGCACAACCCCATGCTCCTTTAGTCAG
TGGCCCCTAACTTATGGACTTATCCAGTAAGGTCCCAGGGTTTCTGACTGTAGAACTTGA
GTACATATAAAGCCAGCCATCAACCCCAGCATCCAGGAATGCTCCAGGTAGAGCAGACAG
GGTTTCCCAGCTTGACTGACTGCCCGTCTCCCTCCCACCATAGGGAGGGTGAAGCCCGAT
ATATCACCCACTCACCCCAGCAGGCCCCTGACTCGGAGGTCACTTCTTCAGGTCTCAGGC
TGGGGCCTGAGGTTGAAAATGTCCTTTTGTCACAATCAGAGCTTCCTGATGGGAAATAAT
TTTTAAATGTGTGTGTTTTGCTAGAGCTCTCCTGTGTAATGTATGCTGTGTGTATACATA
TTCAGGCATATATATACATAAGTATATGTGTGCATACACATGCACACACACATGTGCATT
TTATTGCTAAAAACATTGGCTGAAGCTGTAGCTGTGCTCAGCCTGTAGCTTGGTTTGTTA
AATGAAGACAGCGGCGAGAGCTGCCAGCCAAGCACACTATTTGAAAAGCAGAGTGTTCAC
CACCTGAGCTGGTCACTCATTTGGTTGTGGGAAGGGCGAGGGCTGTCTTCTCTGGGTCCT
GGAACAAATAACGGACTTTCACAGAGCACGGATACGGGCTGCACCCAGACTCCCTGGCCT
TGAGAACCAACACCAGGGAGAGTCACAGATAAAATGCAGCCAACCTCTCTCCCTCTTTCC
ACTCCCCCCTCACCCCAAGAAAAACCCACCTGAACTTACTGCACAATTAGAGGGATCTGG
GGATTGAGGGCACTCGAGCTGTCCCAAATGCACTGATTCACATATTTAGTGTAAATTCTC
TGCATGGACTCTCAGTGTTAATAATAAAAGGCAACATTCTTTTACGACTTCTGCTGTGTG
CGAAATAAAGGGTGAAGGATTTTGAGTGACATTCTGCAAATCACCACACATACCCTAGGC
CTGAGGACTGACGTCTTCTCTAAGGACCTTCCCTGAGGAACAGGGGCGGAGTCTCCAGCA
AGCCGCCCATCAGGGGTGCTCTTCCGGACGCCGGTCCCGGCTCCAGGAGACGCAGTGTGG
AAAGAGGCTCTAGCTGCTTACTTACTTGGGGTTTGCAAATCCCTGGAAGTAAACCTCATG
GGTTTCTAATCTACTACTTAGAGACAAAAAATAAATCTGCCTAAGTTGATGCTGCCACAT
TTCTGGATGCTTTGTATTAGAACCACTTTAGCAGCCTCATTGTGTTTTTATTACTTTGCA
TTTTTTGCTCACAAAACGTGGTTAAGCAAACCAAAACAGAGAGGAAAAATTTGAACTCCT
CACAGCCAAAATCAGCTATGCCAAATTTCAGGCTCCAAACAAGCCAATTTATAAATAAAC
ATGCTGTGTTTGCCAAATAAGGAGGAATGTGTTGGAGAAGGCAATGTGGAGTGGTGGAGA
AAGTGCCGAGCTCTGCGGGGCGAGAGAAGGCGGGAGCTGTAGCCCCAGCCCTGTCCCTGA
GAAGCTGTGTGATGGGGGCCAAGTCACCTAACTTCTCTGAGCCTGTTTCTGCCTCTGTGA
CATAAGGGGGAGGGGGGACCAATTGATCTAAGGTGGGAAAATGCTCCTCTCCTTAGCAAA
CACCCTCGCCTATGGTGATGTTTTTTTTCCCAGTTCACACAGCAGCTCAGACCAAAGCAT
CCCTTCCTTTCCACTATCCTGTTAGAGTGACCAACTTGTTCTAGTCTCCCTGGGACTTCT
GTGGTTCTAACACTGAGAGTCCTGTGTCCCAGGAAAGCCCTCAATTGAGGGCACCCTGGA
ACAATTGTGTTTTTGGTTTGTGTTTTTTTTTTTTTTTTTGAGGAAGATTAGCCCTGAGCT
AACATCTGCTGCCAATCCTCCTCTTTTTGCTGAGGAAGACTGGCCCTCAGCTCACATCCA
TGCCCATCTTCCTCTACTTTATATGTGGGATGCCTACCACAGCATGGCTTGCCAAGTGGT
GCCACGTCCGCACCCAGGATCCAAACCGGTGAACCCCGGGCTGCTGAAGCGGAACGTGCG
CACTTAACCGCTGCGCCACCAGGCTGGCCCCATCCTGGGACAATTGTTAATCTATCCTTG
GAGTCTATTCTGACTCCATTGGCTGAAGAGATGTTCATAATCTCAGGCATTTGTAGAGCA
TTTTAGAGTTGGACCTAGCTATTCAAAGTGTGGTCCTCACAGGCAGCGTCAGCATCCCCT
GGGGGTCAGTTGGAAATGCGGAACTCAGGCCCACCCACCCCAGACCTACTGAGTCACAAT
CTGCATGTGAGCAGCTCCCCGGGTGACTCAGGTGAAACGCATGACAGTTTAGGAAGCTGT
CCTAGGAAACAGTTTTACCTACATGATTGCAGCCTGTTGGGGCGGCTTTATTCCCCCCCA
TTTCCCAGTGGAGGAAACTGAGGCTCAGGCAGGTGGCTTACTTGTTTATTTATCCATTTG
ATCCATACTCATTAAGCACCTACTGTGTGTCAGGCACCATTATGTGACTTGCCCAAGGTC
ACACAGCTAGTAAGTAGCCGAGACAATCCCCAAACCCATACCTCAGGCGGCGCCAGAACC
ACAGTTTAATGTGGAAGCTGACTGCAGCTCAAACAGGCCTCCCAGGGCTGTAGAGAGCCT
CAGAAAGATTCATAGAAATAACTTCAGATACCCATTCTTGGCTCCCGAAACTGTGAGCCT
ATCAGCTATTTATTTACACAGTCCCAAGAGCTTGCAAATGTCCTCATTGTTACCGCCTCC
CTCTCATCCCCCTCCCATACTCCAGCGACCAACCGGCCCACAGGAAGATTCAGAAACACT
CTCCATAAAGTTTCACACAACACCAAGGCCTTACCTCTGTGCTATTTATCTTCTTGAATG
GAGGGCAACTGGTTACTTCATTTGCCACAATGGGGCTGGAAGGAAGAGAGATGGGAGGAG
AAGAGAGGATCCTTACTTGAACTGCTAAAACCAAAGAGAAATGCTTTGGGGGACGATTTT
TCCAAAGTTCATGAAATGTTTTTACATTTGGTCCCTAGAGATAGCTAAATCATGCGCATG
GTTTTCCACAGAGCTGAAAGCACTGAAAAAAAAAAATCTGAATATGGGCCAATAAAATGT
CATCATGCATTCCCATCTTGGGTTAGAACCTTCCCGTCCAGCTCCAGTCTTCCTTCTTCA
AAGGTATTTATTCAGAAATTGACTGTCACCACCACGGGATCAGATGGAGTGTCCAAAAGG
AAGAACATAAGACTCACTGTGTCCAGCTGAGAAATGTCTGAAAATCCTCAAAAAATAACA
GATGTAGTTTCTCCTCCGTTGATCTGCCCTCCGGTCCCCTCAGTTTAGATCCCATTTTGA
ATTCACAGACATGCTGCTCTCAAAAGACTCGGATGCGGTGGGTCAAGTGTCTAACAGCAA
TCGTTTCGCCTTGACCCCCCTCTCCCAAGGAGCAGTAAGTAATTCCAGGAGCCGCTTCTC
AAGGCCAAAAGGGCAGCCTGCCCCAGGGCCACCCCCTGCCCTCCCCAGAGCTGCCGACAC
CCCTTCTGTTCCTTGGGGCTCTTCTCTGCCAAGCCCTCTGTGCCCGCTCCTCTTCTGCCT
CCAGAGACAAGCATTTACCCCTCTTTCACCGCGGAGGAGGAACCAAGACTAACAAAACTG
GGCATGAACAAAGCTTATTTACCAAAGTCCTGGTCTATTTACTTTTGTCCTCTGAGATGA
CAACGATGGTGGTGTGGTGGTGGTGGCTCACATTTACTAAGTGCTGATCATGTTCCAGGC
ACTGTTTTGGGAGATTTCTTTGTATCATCGCCTAAGGGGCAGGTGCTGTTGTCATCTCTA
CCTTTGGAGGAGGCCACTGAGGCACAGAGTGCGAGGGAATTTGCTCAAGGTCACCAGCTA
GGTCACTCAGGCAAGGTAACTAGAACTCAGCAGAAGTCAGCTTCGGTTCCTGAGGCCAGG
CCTTGTCCACTCTCCTACCCTCGACGCCTTGACCCACCCTCTAGCAAAGGCCCTGTGGAC
CCTTTCCTCCATGGAAGCCTCATTTCCCAGCCAGGAAGTGGAATTGGGTGGGAGGAGGCA
TCATGGCCTCAGTTTCGAGGGGAAGTTTTAAATCTCTGAGGCCCCACAGATGGGATGACC
CCCAGTTCACTAGATGTTAACTCTCTAGAAATGAACCCTCTTGGGGTGCTCCTCCCATCC
TTTGGGCCACACGTCTTGGAGACTGTTACCTGATGTTTTCCAGTCTGCAACAGCCTAGTC
TACGAGAACGGCTCTCTTGTCCAATCCCCCAATCCCTTAATTTTACAGAGGGAAAACCGA
GGCCCAGGAAGGCCAAGAATGACTTGCCCAAGACCACACAGGCAGCAGGAGAGCCCAGGC
TGCTGGTTCTCAGAGTTAGTGTGTGTGGTGGACAAGTGTGTGAGCTCTGAGGTAAATGCT
GGGGATGCCACACGCCATCTCTGTGACCTTGCACAAATTACTCAATGTCCCTGCTCACTT
TCAACATCAGTTAAATGGAAGTGATGAAAACAACAGCGCCTGCCTCACAGGCTTTAGGAG
GATTAAACATTCCAGAGTTGGAGCCAAGCACGGCACTCAGGAAGTGCTCGAGAGTCTTGG
CTCCTTTTTCACTTGTTAATTACTAAATGCAACATCACCTATCATCCAGGGGGTTAATGG
ATTTTCTGGCACTTTCTGCTGCCTTTATGTTTGGGCATCATTTCCACCAGAAGGAGGAGC
TCTTCTGGGTGACCTGCTCAGCAGGCAGTTATCAAGCATCTGCCTCTCAGAAAGCCTCCC
ACTTACCCCAGGATGGGGACAGACACCCACCACCATCCCTACGATGGGGCGGCTCTCATC
ACTCTGAAGGAAGCGGGCATTGAAATGTCTCACTACTCTTCGTTCTTAGTTTTTCACGTT
TATCTTCAAAACACTAACTCACTTTGGATGGTGAAATGATGTAATCTACACAGAAATTAA
ATTATAATGATGTACACCTGAAATTTATATAATGTTATAAACCAATGTACCTCAATAAAA
ATAAATTTAAAAAAGAGAAAAAAACTAACTCATTTTCTTGTTCTTTAGGGGAAAAAAGGA
ATATGATAAAGGGATGACATGGAATTCAGCCTGTAGAAATCAAACCCTGGATCCTTCCCT
CAGGATTAATTTTGAGGGAGGGTCTCAGTACCCGAGGATAATTGTTTTGTAAATAGACCA
AATGAGGCACTGGGTTTACTTTTCTAGTTCCTTTCAAAGCTAAGTTAGATTAATTGTTGC
GACTCCTTTCTAAAGACAGATTAAACTAATAAAGCACCTACAATGAGGTTCTGCACGGAA
GAGGCACTTAGCATGTTTGTAGAAAGGAGGAACGTAGAACAAGAGGCATGCCTCTTAACC
CACACAGAAACTCCTCTTTTCCTCACCTGAGAAATCTCTCTCATGGAGATCTTGATGGAA
AGAAAGAGATGAAAGCCTTCACGTTCTTTCAAAGGTACATAAGGCCAAGACAAGTGCCGA
TCTGGCTCTATCGCGGGCTTGAGCCTTCAGAGTGATACCAGCCCTGATATCAGTTCCCCT
ACATTAAACCCAGCATATGTGGGATTAAAACCAAAGCTCTCATCCCCTTTCACTGCTCAT
TCCTTGGCTTACTGGCACCAGAATCCACTATCCACTGCGGACAACCAAGAACACCCACCT
GCAGATTCCCTTATCTCACCATCCTCCTTCCTGCAAACAGCCTCACAGGGCCAAACACAG
GCTGGCGGGAAAGGACCAACCAGCCAGGCCCCAGTCTCCTCCTCCCTACAAGCAGCTGCA
TTCCTTACAACCTTTAAAAGCCCTTGCCTCCCATCCTTCGGGGAGATGAGACAGTCAAAT
TTAAGGGCTCACTCTCATCTCCCGGCTGACGTCACCCAAAAAAAAAAAAACCCTTTCCTT
GCCATAAGCCTGGTGTTCCAGTTTTTATTTGGCCCCTCTTGTGTGATGAGTAAAGAACCT
GTGTTTGTAGCAGGTAACACAATGGGCCTGAAGGTGGGACAGACCTCCCCGCCTGCTGGG
AGGGAACCTCTAATCCCCAGGTCCACAGAATAACCAGAAAACCCAAATTCAGAATCCTCA
TCTCTCCTCTTGCCTGCTTCCTCTCTTCATGAGAGGAGAAGGTTGGTGTCGCGGCAGCCC
CCAGAAGGGAGACTGCAGATCCCCAGGCATGGGAACACTTCTGCCTCACACAGGACCCAG
GGCTGGGTCCACTGATTTCTGGTTATTTGGCAAAAAAGTGCAAATTAACTCTCAGTCCTC
AGCACCCAAATATATGACTCATAGGCAGCGCGCTAGAAAGGACACAAAATGAGGAAATGC
AGAGCAAAGTGCCAGAGGCTCTGTGAGCATTTCTGGAACGAATTCCTTCCTGGCCCGGTC
TCCGTGATCCAAATGCCCAGTTTCTGGGGAAAATCACTTTCTGCAACACAAACACCCTAG
GAGAGTGGGAGGCAGGGGATGGTGGCCCTGGGCACATTAGGATCAAGCCCCCAGAGGCCA
CAAAGGAATCTCTCCTTTCCTTTGTTTATGCAGTTTTACCAAAAAGGCCCTTTGAGTTAG
TAATTCTGCCTTTGAGACCTCAGAGAAGCAGAAGAGCTCCCTCTGGGCCTTCTCTAAGGT
TTCTCCTGGTTCTTCTCCTTGGATCTGATGGTTAAAGAAATAGCCACACAGTGATTTCTG
TTACTTCCATCTGAGTTCCTTCTTTTCAGGCAACTGAGCAGATTTGACAACTAGCAATTA
CAAGAACCTAAATGTGCGCAGGGCTCTCGCGCCATATATATTTCCTCCACCTCGTAAAAC
AAAGCTCCTCATCAGTTTGGCACGTATGGGGGTCCCTCTCCCGCCTCCACTCTCACTCAT
GATAAAAGGATCCCTTGTTTAGGGCTCTGCAGCTTTCAAAACACTTTCACATGTTCAAGT
CTCTAAGGCAAGGCAAGCAGAGCTCTTGCCATTGGCGCCATCAGAACACCCCGCTGCTGA
TGCTCCCCCAGCCCACGCCCAAGCACGATGCTAAATTCAGTACAGGTATAGCCATACTTC
AGACTGATCGATCTTAGTTTTCAAAACGCTTTCTGAATACAGTATCTCATCTGAGCATCA
TAGTTCTCCTTCAGGGTTGGCAGGGTGGAAACTAGTATCCCATTTTAAGGATAAAGGAAA
CGGAAGCTCAGAGCACTGAATGATTTTCCCCAGCACTACTGTCTCTGACCAGAAGATCAA
TCAGAATTTCAACTCCACCCACTACTAGTAATATAATGACAGCTAACATTTATGGAGTGT
CTTTCATGTTTCAAGCAGCGCTAAGCATCTCATAGGCATTTCAGCCAGAAGGTAGAAAGG
AAGCCAGTGACTTTCTCTCACCGCTGGATTCCCAAGGATGTCAATCCAAACGCACTTCTT
GGGCACCTACCCTGGGCCCAGCAAAGTGAGGGCTTTGGAAATACAAAAACTAAGAGCTGG
TCGCATTTACAGTACTTACGGTAGAGTCAGTGAGACAAGATGAGATTGTGCAAAACAGAG
AACAATGCAACCTAATCCATATTTATGGCCTAAATTGTAAGCAGGCCAAACTCTCAGAGT
TATGGTAGCTCAAAGGAGAACTAAATGGAAGATTTACAGCTTCACTGTTCAGTATGGTCG
CCAGTGGCTACAAGTGACTATTGAGCACGTAAAATGTAGCTGGTCCCAAGTGAGATGTGC
TATAACACACACTTTAAATTGTAAAAACTTAGTACCAAAAAAATGATTGTGAACATATCT
CATGAATAATTTTTATATTGATTACATGTTGAAATCATAATGTTTTGTATATGTTGGATT
AAATAAATTATTAAAATTAATTTCACTTTTTAATATGGCTACTAGAAAATTTTAAATTAC
GTACGAGACTCACATATTTCTATTGGACAGTGCTGATTCAAATAATGATCAGTCATCGAC
ATGTTTTAGATGCCTAACTAAACGCTAAGCACTCTATGTGCATTCCCTTATTTAATCTTT
GCATTATCTCCACAATTTCATTATTATTCCATTTTACAGATGAGGAAGCCATGGTTTAAA
GGAGTTAAGTATATAGCTATTAAAAAGGATAAGTTAGAGGGTGCGCAACAGTTAAGTGTG
CACGTTCCGCTTTGGCAGCCTGGGGCTCGCCAGTTCGGATCCTGGGTGCGGACATGGCAC
CACTTGGCAAGCCATGCTGTGGAGGTCTCCCACATATAAATTAGAGGAAGATGGGCATGG
ATGTTAGCTCAAGGCCAGCCTTCCTCAGCAAAAAGAGGAGGATTGGCAGCAGATGTTAGC
TCAGGGCTGATCTTCCTCAAAAAAGAAAAAAACCTATGTATTGCAATGGAAAGTGTCCAC
AATAAGTTGGTTTTTTAACAATGATCATCCACTATCATAAAAATAAAACATACCTATATA
ATTTGCGTGTGTGTGGGTATGTGAGGAAGATTTGCCCTGAGCTAACATCCATTGCCAATC
CTCGTCTTTTCGTTTTTTTTGGCTTGAGGAAGATTAGCCCTAGCTAACACCTGTGCCAGT
CTTCCTCTACTCTGGATGTGGCACGCCTCCACAGCATGTGTGATGAGTGGAGAAGGTCAG
CACCTGGCATCCAAACCCATGAACCTGGGCTGCCGAACTGGAGCACACAGAACTTTAACC
TCTTGATCACAGTGCTGACCCCCTATATAATTGATTTGAAATAGGTCATTAAGTGACTTG
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGAGCTAGGCTGAAAGTATGAGCTGCTTGTACTGGTCTCTAAGGAG
AGACCTCAAGTGCAGTTGCAGCAGGCTCCTCACTGCTTCGTGGGGAAGGAGCCCCAATCC
GCCCTACAGCCCACTCCTCCCACTTCCCCTGCCCAGTACTTCCTGTGGACTGACCCACGT
AAATCTTGCTTGCTTGGTGTGCACTGCCTCCATGATGTGGTTGTGGGACCACAGCTGCAG
CAAACGCCTGAATTTCCATTCATGGGAAGGCCTCCCACCGCTGAAGGGATAATTATTTGC
CTGCTGCGCTGACAGGTTCCCATCTGGTGAAGGCTGAACACTGTGTCTTTAGAAAAGACC
CCAGAAAAGGCAAGCTCCTGGCCCGGCTTTGACAGATTCCCTCAGCTACTCTAAGGGGAA
GAAAGAAATTGCTGGAGTAGTGTTTGGAGGTAGGGCGGAGAGACAGAGAAGAGAAGAGGG
AGAATCTGGGATGCTAATGAATTCCTTGTGATCTCACTCTCCTCATTCCAGCACATGCTC
CTCTGCAAAAATTGACGGGGCTGCCTTGCCAGCCGGAGCCTGAAAATGTGGCCAGGTAGA
CAGAATCCCAAGTCCTAGAGCAGCCTGTGAGATGCTGGCTGCCTGCTAACAGACGAAGGT
CCAGGGCAGAAAACAAGAGAAGGCATCGACAAATGGGGTCCCCACCCCCACCCCATCCCT
GACATTCTGCTTCCGGCGTCTGCTTTCCTGGTCTGCCCCTCTCGCAGTGATAACAGAGCG
GTGGATCCAGGAACATTTACAGCCAAGAGAAGTGGCACCAGCAAACCCTGCCACTGCCTC
TCCCCTCCTCTCACTGCCACTTTCAACATCAAAAAACAATCAAAGAAATGCCCTTTAGGA
GCTTTAATAAAGAGTCTGAAGTCTATAATTGGGATCCCCAGTTCCATTTCATCTACTGAA
CCTGTGGGAGGCCCTGAGTGGTCAGGCCTGCAGGCCAGCCATCTGCCAGCAATCACGATT
GCAGGTTGTTCCTAAGAGTTGGTGCGACTAGCACAGCTAGGCTCGAGTAAACCTACAGAG
GCATTACTGATTCAGCCAGTTCCTGGCTTTGCCCTCAGTGCTTTGTACTCTCGCAACAAA
TTTGTGAGCCAGGAGTTATTATTATTAACATTTTAGAAATGCAGAAATGGGATTCAAAAG
AATTAAACGACAAGATTACCCAGCCAATAAAAAAAAAGAAAAGAAAAAGGCAGAGAGGGG
ATTCGAACCCAGGTTTATCCTGCTCTAAAATCTGTACTTTAAAAAACAAAACAAAAACCC
AAAATTCTTATTATGGAAAATTTCTAACATCACCAAAGCACCACAAACTAGTAGCATGAA
CTGCCATATACCCATCACCAAGTTATAGTAACCATCACCACGAGGCTGCTCCTGTTGCAG
ATCTACGCCCATCCATTCTCCTTTATCGGGTTATCTTGAAGCAAACATTAGATATCATGT
CATTTCATCCATAAATAGTTCAGCATGTATCTCTAAAAAAGAAGGATCCTCAAAATCTGT
GCTCTTGATTTCCTCAAAATAATGACCCTGGATGAGAGATTACCAAGAAACCGCCCAGAA
AAGTTGCAAGATTTATATCACCCCCAGAGGGGAATGAAGCATTCCCTGGCTGCCTGTGGC
ATTTCGGCATAATGTGGGGAGGGTACAGTCATTATCTGCTAAGTCCAGGAATGCCCGCTG
GCAACGCAACCTCATGTGGACCTGCCCACCTGGCCACATGGACAACCCATTCTTACCTGT
TACCCCAGGTGACATTTACCTAAAGAAAATGTTGCCTAAGCAGTTTTTTCCAGCTATATT
ATCTCAGAACTTGTTAGCCTGTGGGCTGTCCTATGTGCACAGACAAACGTCAACATTTAC
TCAAAACATCTACTGTGTGTCAGATGCTGAGTTAGGTGTTTCCATATGTATCAGGAACCT
AACGCTTGATTTTTTCAAATTTTAATTTGATTTTTGTTATTCAAATTTCCATTTGGTTCA
GAATTCCATCTTGCACTTGAATATTATGGAAGGGACTACATGTAACCCCTTCAGGGGCTG
AATTCATCAATCAGCAATGTTTCTTGAGAATGTGTGTGAGTGTGTGAGCATATGCACATG
TGTAAGCTATCCTGCAAGTCATCCTGGAGGGTACCAAGAATAGAATACATTTCTTGCCTT
GTACTGCAGAGGAAGAAATTTCACTGTATTCAAGTCTGCAAATACTTAGTAATCTCCTTC
TTCCACATCACAGTGCCTGTCCTAAGGAACTTGGAAGTCTAGTAGGATGGATAAGACAAA
GTACACAAACAAGTAGATCTACAAGGCAGAACATACCAACTGCCACAGCAGATGTAAAAA
TAACACGTCATGCGAGTTGAAAGGCAGTAGCAATAATGCGTGACTGGGGGAAATCAGCAA
AGTGTTGATGGAGGAGGTGGCATGTGAGACACAGACTGTTTCCCAGGGATCACGGTTCAC
TCTACACGCCATGAACAACAGACTGTAGAGGCCACTTACTGGGTTCTATGCTCCAGTTTC
TCCTTACCACAACACGGGTGACGGTCCTTACCGAGCATAGCCGGCTTTGGTCCCATCTGT
GTTCTTCTTTGATGAGTCCAAGGGGTCCCCCACTGTTCTGGGCTGTCTGCCCCTTACTGT
GAAATTCTTGTTGCTGGTAGTGATGGTTCTCGAGGTTTGCTTGTTAACCCCAGGAAGCTG
GGTGATGCTGCAGCTCTCTGCGTCTCCAGCAGGCGGGTTTGTTCATCGAATCATTGGTTT
ATGGCACGCCATGAGATGACAAGGGGGTTTGAAGCACTCTTGGAAGAAGAGTTTTACCCT
CTGGGGGCAGGGCTGAAAATAGACTCATGGTTAGGGTTTTTACAGGCAGAGGTGATGGGG
GAGGGACCTGAAGAAGAAAGGCACAGAGGCAGGAACAGAGAGTGCCAACTGGAGGATGGG
CTGTGGTGGAAGGCAAGACAGGGAGAACCAGGGAGGTGCATCTGGAGAAGCAGGCTGGGG
CATTTTACAAAAATGCTTAAAACGTGCTGAGGACTTACACAGGCAATGGAGAGCTAATGA
AGAGATCTGGCAGAACTGTCACATACCTTAGGAATGTTAATCTGGCACAGCAAGTAAGAT
GGATTGGAAGGGAGGGGAAAAATGGAAGCCAGGAGACCAGCTAGAAGGTTCAGGGTGTAC
AATCTGTACTCATCTGCTTACTGATCCACAGCCCCCGCTGGAAAGTGGGCCCATGAAATA
AGCCTTCTACTGGCTCTAAACATCTTGGGAAATAGGCCTGCACTGCATTGTTTGTTAACC
AGTGCCTGACACACAGTAGGTGCTCAATAAATATTTGTGCCTGGCACATAGGAAGTATTC
AATAAATATTTGTGAAAGAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNGGGTGGGGGATTGCATGCTACCTGAGGAATTCTA
AATTGTGTCCTTCAGGTGAGAGCGCCAGTGAAGGGTTTTAAGCAGGGAAATGATGTCATC
AGATTTGCATTCTAGGCAGTCACTCTGGAGAAGCCTTGGAGGCAGTGTGGAGGGTGGATT
AGAGGGATGGATTAGAGCAGGACGTTACAGGAAGCGGGGAGACCAGTTAAGATGCAGATG
TAGTGGCCCAGGCAAGAAGGAATGAGAGCCAGCCTGGACCAGGGCAGTGGCATTTACAGT
GGAAAAGAGAATGAATATAGTTATAATATAATATAATATAATATAATATAATATAATATA
ATATAATGTAATATAACATAACATAATGTATATGAAGAAAGAACTGGCCAGCCTTAAAGG
AAGAAGGAGATAAGGAAATAAGGAAACAGAAGGGTCTAGAATAATTCCCAGGTTCTGGCT
TAAACAGAAGCGGAAAGAGAAGCAGACATTGGTGGAGGTGGGGAGTTGGGTAGAAAAATG
AGTTCAGGACATATTGGGTTGAGAAGCCCAAGGGACATCGGGTGGAGGAACCCAGGAGGG
AAAAGAGAAAATGGTCTCTCATGCAGCCTTGAGGAGCACTGGCATTTAAGGAGCAGGTGA
AAGGGAAGAGACCTGAGAAGGAAGTCAAAGGAGAGGCCACAGAGGCAGGAGAGAAAAAAA
GGAGAAAATGATTTCCCAGAAGATGCTGAGATGAAGTGGTCACCTGGGAAGATGCTACTG
AGAGTCAGTAAAAAAGAGCACCACTGGGGCTGGCCCGGTGGCGTGGTGGTTGGGTTCGTG
TGCTCCACTTAGGTGGTCCAGGGTTCTCAGGTTCAGCTCCTGGGTGTGGACTTATACACT
GCTTGTTGGCCGTGCTGTGGCGGCATCCCACATACAAAATGAAGGAAGATTGGCACAGAT
GTTAGCTCAGCAACAATCTTCCACACCAAAAAGAAAAAAAAGAGAGAGAGAGAGAGTACC
ATCTTTGTTTGCTTTCAAGAGGAGGGGAGATGTCTTCCTCCAGGCTGGTCAGGGGAGATT
TTAGAAAATAGAAGGAAAGTGCAAAAAAAAAGTTTCTTTCAAGCTGAGAAATGGAAGGAG
AGAGGGTTGAGTCCATCTCCTCTCCTCTTTGCTGTGTTTTCTTGACTCTTGCTGCAATGA
TCTGTGCATTCAAAGAAAATAAAACATGCTATTTGATGAAATGTGGACAATCAGATGTTG
AAAATGTTTCTATTATTTGCTTCAAAAGTAGACACGCTGAAAATGGAGACCATCCAATAT
GATCATGCTGTCCTTAAAAATGTTCCTTTGATAAACGGTAAAGTGTTCTGTTTACCAGAA
ACGTTAACGAGGAAAATAAACCACAAGGCTGTTTAGTAGTATTTCAAATTTGAAGTTAAA
ACCATAAGAGAAAACAGGAGGCAAAAATAATGCAAAACTGCGTGAACATTGCAGATCTCA
GCTGCCCTTGAAATCTTTTTTTCTGCCGAACGTTATATAATTCTTCATCAGCCAAAGATA
TCTGTTTCACATGCTAAAATTCAGTAAGCACATGTCATACTTAAAGGATGGGGTATTGAG
AGGAAAGAATAACATAAGGAGATGGAAAAAGGTTTGGCGCATAAAGGTAATGCACACAAA
GGCCTGAGTATTTTCCAGAGAAACTTTAAGAATACTATTGAGGGGCCAGCCCTGTGGGCA
ATTGGTTAAGTTCGCTCACTCCGCTTCAGCACTCGGGGTTTGCCAGTTTGGATCCTGTGT
GCGGACCTACACACTGCTCATCAAGCCATGCTGTAGCAGCATCCCACATAGAAGAACTAG
AATGACTTATAACTAGGATATGCAACTACGTACTGGGGCTTTGGGGAGGAGAAAAAAAAA
GAGGAAGACTGGCAACAGATCTTAGCTAAGGGCCAATCTTCCTCACCAAAAAAAGGTTTC
TTTAAAAAAAAAAAAAACACTCAGCTTTGGAAAAAAAAAAGTATATTATTGAAAAATAAG
TGATGCAGACTTCCATTTCAGATGGTATAACCAACTCTCCTGCTGAAAGCTAAAAATTCT
GGATGAAATACTAAAAATATCTTCTTCTAAGTAGGTGAATGAAAGTAAGGAATATTCAGC
CAAAACTAAGTGACAGTGGGAATGCAGAGAGACAAATGCAGCAATTGCCAAACCAGTTAT
CTCTCAGTTTTCAAGAACTTAAGGAGCTCCAGGGACAGGAGACAGAGCCCAGGGTCTGCC
TATGGTGGAGATTCTAACTGGATACCCTCCCATACAGGTGAGGCCCTACGAGCTATGCTT
TCACTGTCAGGCTAATCTAGAAATAAATCTAATCCTTCTACCTGGAGGGTCTGCAACCAA
AATGAGCTTTCTTGATTCTTGGTATAACATGAAAGTGAAACAAACTCCTGAAAATGTGTA
ACCAAAAGCTAGCTTTAACACAAGTTTGCAGCACAGATTCATATTGGTAGGATGGTCTGA
AAAGCCTCCAGCAGAGAATTTAATGTGAAGTGGTCCTACATGCCTGAACTGCTGGAAGAG
GCAAATGCAAATCCTCTCTAGACAAACCCACCTTTATTTCAGGCCCCCCCAAATTCCCAC
AGATAAAGTTTTAAGAAATATAAGCTCAAAGTCAAAAATCACAAAACCCAAGGAAACTAG
GCACCTTGAGCAAGAAAAGCAGAAACACAGGCGGCAGAATCAGATTCACGAAGACTTTAG
ATATAGGAATTATCAGAAATATGATATAAAATAACTATTTCAGAGCTTTTAAGAAACAAA
AAAGGGAATTAACAATGTGAGTCAATGATAGACTACAAAAATGATCAAGCAGTTTTTAAT
AAGTAAATACAATTCTGGAAATGAAAAATGTAATAATTAAAATTTAAAACTCAGTGGACA
GATTTTAATAGCAGATTGGACGCACTGAAGAGAGAATTAGTGAACCAGAAGACATCTGAT
GAAATGACTCCAGCTACAGCACAGTGAGAATTCTGTACCCACTGAAAATCTAAAGAACAA
AGGTAAAAAAAGAAGAAAGATTCTCAAACAAATAAAAACTAAAAGCACTCGCTACCAAAG
ATCCTCACTCAAGGAAATTCAAAGTAGGTACTTCAGGCAGAGAGAAAGTAATCTCAGCAG
GAAGGAATGATAAAGAAAGGAGTGAAAGGTGATAAAGGTAGTAAAATAGTCAAATATTAT
CTATTTTATCTAATCTACTATTGACTACACAAAACTATAATAATGTTCTATGGCATTAAA
AAACTAATAAAAGGGTACGAGCTGCCATCTGGTCTCCGGGGCTGTAGTGCAGGTCCAGTC
ACAGCTCTGTGCCATCCCATGGCCGTGGACCTCAACAAGGGCCACTAGGTGACCAAGAGC
CCGAGCAAGCCAAGACACAGCTGCAGCCTCGGCACCTCATCGAGCACACAAGTTCCTGCA
GGACATGATCCGAGAGGTCTCCGGCTTTGCCCTAAACGAGTGGCGCACGGTGGAGCTGCT
CAGTGTCTCCAAGGACAAGCCGGTGATCAAGCTCATCTAGAAAAGGGAGGGGACACACTG
CACCAAGAGGAAGCAAGAGGAACTGAGCAACGTCCTGGCCACAATGGAAAAAGCAGCTGC
CAAGAGGATTGAGCCCCCCACCCCTACCCCACGCATAATAAGAACTTCACAGAAAAAAAA
AAAAAAAAAACACTTACAAGATGGAACTAAAACACATAACCCAGTAACATAAGTCAGAAG
GTGGGTGATTGGAATTAAAGTTTTTTAAGGTCCTTACAGTATTCGGAAGAAGGCAAAAGG
ATAATGATTTACTTAGGACTTTGATAAGTTAAATATGCAAGATACATTTTTAGATCAACC
ACTAAAAGTCCAGGAATATTTAGCTTTCAAATTAATAGAGGGGGAGAAATGAGGTGATAA
AAAATAATCAATCAAAAAGGAGTTAAGAGAGAAGAGGAAAAATAAGCATAAAAAGGGAGA
ACCAAATAGACAACCACTAAAGAAAGAAAAAGAATATATCAGTAATTGCAATCAGTGTAA
TGCAATAAACGCTGCAGTGAAAAGATTCTCAGAGTATTGAAAAATCTAGCTCCATAGTTT
TTAGAAAACCAGGTTAGAACATAAGAATACAGAAAGGTTAGCCTCAAAAGAATGGAAAAG
ACACACTAAGCAAATCTAAAGTAAGAAAAAGCTGATACAACTACGTAAGTATCAGACAAA
ATGTACTTGAAAGCAGAAAATATTACTAGATATGAAGCGTCACTACATAATGATAAAATT
ATACTGCAAAAACCCACAGACTAAAAGAGGAGACTGAAAATCCATCATCAGAATGGGAGA
TAGTCATACTTTCAAGTGATCAATAAACTGAGCAGCCAAAAACCCCCAAATCAGTAAGGA
TTTATGGAATTTGAACAGCACAATCACCAAGCTTAATTTAATGGACACATGTAGAACAAT
GCCAAAGCAACGTTCCAAAATCTTACAAGGACAGCACAGGGAAGGAAAATTATATACCAA
GTTCACTCATGAACATAGATGCAAACATCATAAGTAAACTATTAGCAAACTGAATTCAAC
AATGTTTAAAAGGATAACACGTTATTATTAAGTCGGATTTACTCTAGGAATGCCTTGGAA
TTTAATATTAAGAAATCAATTAATTATTTATTTTCTTCCATGTGATAATATTGTGTTTTT
GTAGGAAAATATCCTTATCTTTAGGAGCTCCATACTGAAGTATTTTACTGTAGTATATCA
TGATATCTGCAGGTTACCTTCAAATGGTTAAGAAAAAAAAATATATATATCATTTACATT
GTGTGTGTGCATATATGTTTACGACACATGGAAAAGCAAAACTAGTAAAATGTTAATTTT
TGTGCCTAAGCCATAGATACATTTGTGTTCATTGTACTATTCTTTCAACTTTTATGTGCA
CTGGAAATTTTTCATAATGAAAAGTTATGAAAGAAGAAAACCAAGTAATAAAATTTCCTC
CATTAACTGAGTAAGGGGAAAAAATGTTTGACAAAATTGAACATACATTCATGATTTTAA
CAAAGGAAAACTATTAGCAAACATAATGGTGATATGTAAAAATCATTTCCTTTAAGACTG
AAAACAAGACGAGGATGGCTGATTTTCAATATTGCACTGGAGACCACCAGATTAAGAGCA
AGTATAAAAATTGGACTGAAAGAAACAAGACTGTCATTATTCATAGATGATATGATTATT
TACATTGAAGATCTCAAAGAATCTACCGATATATTAGTAGAATGAATAAGAGAATTTAGC
AAGCAAGTGTATTAGAAACAAAATCAGTAAATGAAAATCTAGGGCATTTCTATACACCAT
GTACTAATAGAAATTGTACTTTTAAAAGATATCATTTATAATAAAATCAAAAATATGAAG
TACATAGGAATAACTCTAACAAAAAATGTGCCAGACTTCTATGGGGAAAAATGATAAAAC
TTCATTAAGAGATATTAAAGAATACTAAAATAAACAGAGGGCTATACTATGTTCATAGAC
TGCAAGATGCGCATTAATAAAAATGTTGTGTCCTCAAATTGATCTATAGAGTCAATGCAA
TCCCATTTGACAGTTTAATTATTAAACCTTTAAAAGGAAGGAGATTCTGACACATGTTAC
AACACGGGTGAACCTGGAAGACGTTATGCTAAATTAAATAAGCCAGTCACAAAAGGAAAA
ATATTGTATGATTCCACTTGTATGAGGAACCTAGAGTAGTCAAATTCATAGAGAAAGAAA
GTAGAGTGTGGATGCCAGGATGTGGAGGGAGGAAAGAAGGGGGAACTAGCGTTAGTGAGG
ACAGAGTTTTAGTGTGGGAAGATGATAGAGCTCTGGAGATGAATGGTGAAGATAGGTGCA
CAGCAATGTGAATGTACTTAATGCTACTAAACAGTACACTTAAAAATGGTTAAAATGGTA
AATGTTGTGTTATATATATTTCACCACAACAAAAAATGGTTGAAGAGGAGGAAGAAAGGA
GATGCAATTGGAGAGTCTTGATAATATTCTTTCCTGGCCTGGAAATAGCTTCACAAGTGT
TTGTTTTTTGGGTTTTTTTTTGGAAGATCAGCCCTGAGCTAACATCTGCTGCCAATCCTC
CTCTTTTTGCTGAGGAAGACTGGCCCTGAGCTAACATCCGCGCCCACTTCCTCCACTTTA
TATGTGGGACGTCTACCACAGCATGGCTTGCCAAGCTGTGCCATGTCCGCACCCAGGATC
CAAACTGGCGAACCCCGGGCCGCTGAAGCGGAATGTGCGAAGCCACCTGCTGTGCCACTG
GGCTGGCCCCACAAGAGTTTGTTTTACTGCTGTTTTTTAAATTAAACATATATGTTTTCA
TGTGTGATTTTGTATTCATGCCATATTTCTCTTAAAATTTTAAGCACAAGGGCTGACCCT
GTGGGCTAGTGCTTAAGTTTGATGTGCTCCACTGTGGCGGCCTTGGGTTCAATTCCTGGG
TGCGGACTCACACCACTCATTGGTTGCCGTGCTATGGCAGCAACCCACAATAAAATAGAG
GAAGATTGGCACAGATGTTAGCTCAGGGCAAATCTTCCTCAGGGAAAAAAAATTTTGAGC
ACATATATACACACAAATATTAGAAATATAAACATATGTGGTGAAACTATAATGAAAACC
AAGAGAACTTATAAACACAAAAACACTAAAACTGAATGGTGGGCTACACACTGAGGTCCA
TTACATCATGATTCTTTATTTCTTACATATATTTTGCAAATACTCTTTTTTATTCATTCA
ATATTTAATAAACGTAGTTTAAAAAGGAAACCCTAACAATATATATTTTTTTAAGTTTTG
GCTTTATTTGCAAGTTTGGCACAGCGGCAAACACTGAGGCTGGCTACTTAACCAGGCTTG
TCCAGGCTGCCCTCTTTCCTGATACCTTCGTGGTGAAGCGAGGGGACCACAGTGATCTGA
AAAAGTACTTGTGATGTGACGACTAGACAACTTTAGTACATAACAAAGTATAATTCTCCT
TTACGCAAGTGGTCAAAAGGAGAACATGGCCTCCTTTGGGTCATCCCAAAGTCTCACTGC
AGCTCCTCCAGTTCCTTACGGGGTAGAAATTGGGCCACTCTGTCCCTTGGCTGCATTCAG
CCCATTAGCTTCTCTGTCTTTTTCCCAACATCAACAAAGGAATAACACGTAAAATACAAC
CATGTGAAAGATCCTGTCATATTTGACAAAGGAAACATTTTTCTAGGATAAAATACCGAG
TATCTTTCCTATTCTATCAGAGAGTGAGTAGGGCTTATCCTGAGGGGCCAGAGGGCCATT
TGGCTGAGCCCTCACAGTCACGAAGGACCTCAAATCTAAATCTTTGACCTCATCTCCAAA
GGAGGTCACAATACAGTCACAAAGGCACACAAACAAGATTAAATGAAGACATTGGTTATG
CAGCTTTAAGCATATGTCACAATACGAGACGACACTTCCTCTAGTGCCCTGCGAGTTAAT
ATTTGTTCTCAGTCCTATCATTATCTGGTGACGGCCATGCAGTTCTTGCTTGGTATTTTA
ACTTATTAAATGTAAGTATTTAAAAATTTACTACTGATTGTATAACACTGTTTTGAGGTT
TCTTCATTTTATAATAAATCCGGAGCCTTTAAAAATTAGGGTTGCCAGATTTGGCAAGGA
AAAGTACAGGACACCCCGTTCAATTTTAGTTTCTGATAAACGACAGGCAATTTTTTACTG
TGACTATGTCTCATGCAAAATTTGGGACACGACGCTAAAAAAAAGTCTTCGTCATTTATG
AAAAATTAAAATTTAACTGAGTGTGCCGCATTTTATCTGGCAGCCCTGTGGATGGGAGTA
CCCAGCGTCTCCACCTCTGTGTACCCCGAATGGGTGGAAAAAGAAGTAACGTTTATTGAG
CGTCTGCTACGTATGAGCCAAGTGCACGACAAGTGTGACCTCATTTAAACCTTGCAACAA
TCCCATGGGGTACATATTAACACTCCACCTTACAAGTGAACACAAAGCTTGAGCACTTTA
TTCAAGGTGAGACAGCAAACACAAGATGGATGAAGAGTCAAATTCAGTTTTTGCTTCCCA
AATCGGTGCTTTTTCTCCGTCAGTGCACTTTCCATCAAAAAGCTTTCAGATGGCCTTTTT
TTTAATATAAGGTTTTAATCAAAAAGGGAAGGAGTTCTGGAAATACTCCAAAGTCTTTTC
TATCATAATAATATTTCATGTGAAATTTTTTTCATATCTAATTAAATTTGTTTGCATTAA
GTGTAATGTAATGATAAGTGAAATTTGCATAGCCTGACGTATTTCAAGGAATTTATTTTA
GTGGAGAGTTTTGTCTCTGAAAGTTCAGGTAATCTCTTTGGAACTCAGTTTCTTCATCTG
TAAAACCGGAGGTGTTCTCTGGCTGCTAAAGCGCTTTCCAGGTCTCCACCTGGAGGATTT
CCACGCCCCATTTCAGAAAACATTGTCTTACACAGCTCTCTGCTGCCACCTGCTGGAAAA
ACTACAGCGCCCATTTCTGCTAGAAATGTGCTCTCTATTCAGTCATCAGTCAGTCCCCTT
GATCCCGTGGCTTGTACACTTAGTCATTTCAGCCAATTAATGAGAATTATAGTTTTCTGA
GTTTCCCCAGTTTCAGTGTTTTCAATTTATAAAACATTCCAAATGAGTCAAGGCTGAACT
GTGACCCTCCGGAAACGAATTGTTTAGCAGCTTTTCCCAGAAGGGAGTATTTTTCATCCT
TGTCCAGTGTTTCTTGATGACTGTCCTGCCAAATCTACTCGATTTGCTTTAATAATTGCC
ATTTGTGTTGCATTCACAAGGTCTGATAAGGACTATTTAATAGAACAGAAAAAATATTTT
TCTTAAAGTATCTTTTAAAGATTTCTGAAAGATTTCATTGTTGTGCTTCAAGAAGACGAA
GATGCAATGCTCACCTACTTTCACACGCACACACACACAACCTGGAATACACGTATATAT
ATATTTTTAAACCTGGGTGCTTCACATCTAGAAAAATTTTTTTAACTGGAAAAATTTTCC
TAAATTAAAGGCTAAGTGTTGGCCTTAATTTTTTTACATATAGACTTTATATTTTAGAAC
AGTTTTAAGTTCACAGCAAAATTGAGTGGAGGTTACAGAGATTTTCCCTATACTCACTGG
CCACACACACGCACAGCCTCCGCCCCCAGCATCAGCATCCCCCACCAGGGGGGAACATTT
GTTAAAACTGATGAACCTACAGACACATCACTGTCATTCAAAGTCCATAGCTTACATTAA
GGTTCACTCCTGGTGGTGTACATTCCATGGGTCTGACAAATGTCTAATGACAGGTATCTA
GCATTACAGTATCATACACATTAGATTCACTGCCTTACAAATCTGCTGGGCTCTGCCTAT
TCATTCTTCCCTCCGCCCTAGCCTCTGGCAACCACTGATCTTTTACTGTCTCCATAGTTT
CGCCTTTTCCAGAATGTCATATAGCTGGAATCATACAATACATATGCATACAATACGTAT
ACAGATACTTTTCAGATTAGCTTCTTTCACTTCGTAATATGTATTTAAGATTCCTCCATG
TCTTTTCATGGCTTGATAGCTCATTTCCTTTTGACACTGAATAGTATTCCATTGTCTGGA
TGGACCACAGTTTACTTATCGATTCACCTACTGAAGGACATCTTGGTTGCTTCCAAGTTT
TTGGCAGTTGTGAATAAAGCTGCTGGAACCATCCATGTGCAGGTTTTTGCGTGGACACAG
GTTTTCAACTCCTTTGGGTAAATACCAAGGAGCACTATTGCTCGATCATATGCTAAGAAT
GTATTCAGTTTTGTAAGAAATCACCAAATTGTCTTCCAGAGTGGCTGTACCATTTTGCAT
TCCCACCAACAATGTATGACAGGTCCTGTTGCTCCGCATCCTCACCAGGACTTGATGTAT
CAGTGTTTTGGATTTTGGCCATTCTATTAAGTATGTAATGGGATCTCACTGTTGTTTAAA
TTTGCAATTCCCTGATGACATACGATGTGGAGCATCTTTTCATATGATTATTCGCCATCT
GTATATCTTCTTTGGTGAAGTATCTAGTCAGATCTCTTGCTCCTTTTTTAATCGGGTTGT
TCATTTTCTTATAGTTGAGTTTTAAGAGTTCTTTGCATATTTTGCGCGACGGTCCTTCAC
CAGATACATCTTTTGCAAATATTTTCTCCCAGTCTGTGGCTCATTGGCCTTAATCTTTCA
AACAATTAAAACCGTTTCCAGAATTCCCATCATAACAGTAAAAGTGCAGCCCAAATAATT
CAATCCTAAAATATAAAATATACAATTAAATTTATTGCCAGTTAGGGTTGAGTCAGCTTC
AGAGGGTGGGAGCCCATAGCCAGTCTCTTCATATCTGAATCTGAATTATCTCGGGGTTTT
GTTGTATAGCTGCCTGGAGCTTGATGCAATCTCAAGGGTAATAAAATCAGAATCCTACAC
CTTTCTAAAAACTAATCTTGGGGGAGGGCTTCTTTTGAAGGGAGATCAGGAAAAGATTTT
GAGAAAGGAGGGAATGCCCACTAACTTCTATTTGTTCCTTCCGCCTCATGATTTCCCAGA
CAGAGTTATCAACTGGCTTAGATATTTGAATACACTTACTTAATACCATACTCATTAAAA
ATCCAAAACTACTTTCCAATCCTACCCCATCTCTTCCATTTATGGTAAAGTAATATATAA
CAGTGCATAAAAATTTTTTTAAATAATTGCAAATAATATAGGCTTGATACAGACAGCTTG
GAATACACAGAAATGCACAGAAGAAAAAGAAACTTACTTAAACCTCCCTTAGGGGCCGGC
CCTGTGGCCGAGTGGTTAAGTTCTCGCACTCCGCTTCGGTGGCCCAGGGTTTTGCTGGTT
CGGATCCTGGGCGCGGACATGGCGTCACTCGTCAGGCCACGTTGAGGCAGCGTCCCACAT
GCCACAACTAGACGGACCTGCAACTAAGATATACAACTCTGTACCAGGGGAGATTTCGGG
AGATAAAGCAGAAAAAAAAAAAAAGATTCTCCACAGTTGTTAGCTCAGGCGCCAATCTTT
AAGGAAAAAAAAAACCTTAATGTTGCCGTGTAAAATAACTACTGCTGACGTACTAATAGC
GTCATTCCTCCCAGTATTTTATATACTTATATGTACAGTTTTTCTTTAAAAATAGTATAA
TACTGTACATATTATTTTATAGTGACTTGTTAACATAGCACTTTTCTAAGTAAAATTTGA
GGTGACCCAAATGTAAGTACTCGAACTGGCTTCATGCCAGATGCTGGAATTGAAAACTTT
GGGAAAAGACACTTAACTCCCAGGACCTTGCTCTCCTTGTCCAAAAAGTGAAGAATTTCT
GCATTCTCCTGCCTATTTTTGGATGAAATCTTGTCTCCATATTTCATCCTAAGGACTCTG
TGGAACAGCCCCTAGTTCCACATCCCGTTAGTTTATATGTATTTTTATTTCTTGTTAGTA
TATTTTTTCCAGCTCCCTATGCAAATCACTTGAATCTGTCTCATTATTTTGGCTAGCAAT
TTTTGTGATTCAGCTGACTAGACTTTAAAAATAAAGACTAAAAAGTAGATACCCATCTTT
TCAGTAAAAAGGAGCACAAAAGAGAAGCTAAAAAAATCACCAATCGTTGGACTTTACTTT
TAATATTTAAAGAAATAAATGTACAAAAGCATAGGATGGAAATTACCATATTTCAATTCA
ATTCAAACAATTATGATTTAGCAGGAAGAAAAGGTAACAAACTTAGGGACCAAAATAAAG
CGACCTCAATAGAAGACAAGAAATGTCTCAAAAGGATGGAACAGGATTTGGAAATACTAA
GGAAATCAAACTAGACAGAAAATGACTTTGTCCAACGAAGGGACTTAGAAGTGGTTTTCA
CTATTTTCAATTATATAAAAGACAGAAGTCCATCACGAGGCTTCTCTAACAAGAACCAAC
AGGAAATTGGTTTCGTTTGTTTTTAGATTAATTCAGACATTTAAAAAAACTGTTGCTTAA
GGGATGGGAAACCAGAAGACAAAATGTACCAAAAACGGAAAATGTGCTTACCTTTTGTAC
AGAGACTCCTCTTGTATCCTGCTATCTGTTCTTCCCTTCTTATATAGTAATACAATCCCT
ATTTTTTAGCCGGACACACGGCCCTCTGAAATGCTTCCCAGTTAGGAGTAAATGTGATAC
TAAGTTCTGACCAAATCCATGTCAAAGGAAGGGTCCAGAGGAAGTTCCTTCTCCCCCCCT
TTCCTCCTTCCTGCTGGCTGAAATGTGAATATAACAGCTTGAGCTCAAGCAGCCATCTTG
GGCTGAAAGGTGGAAGCCACAGGTTGAGGACATGGAGCAACAAGAGAGAAGGAGCCTGGG
GTCCAGATGACGGTGGAGCTGCCATGCCAGCCCGGATTGCTCATCTCTGGATTTTGTTTA
TGTGAGAAAAATAAACTTTATCTTGTTTAAGCTACTGTAGTTTGGAGTTTTCTGTCACTT
GAAGCCTATCCTAATTTTAAGTGATACACTCTTAAAACCAGAAATTTACTTTAAAAACTT
TATCCTAAGATGAAAAGTGCTCCTTGCAGCATTAAGTAGCAAAAAATTGGAAACAACTCA
ACGATGTAAAACTAATTAAACAAATTTGTATATCTTTATAGTGAAGCACTACATAACTAG
TAAAAAGAACAATATAGATCCGTATTTATTGGCCAAGAAAAATCCCATTAGGAAGAAAAC
GTCACAAAGTATTATCAGGGGTTACCTCCAGATAGAAAGATTATGCTGATTTTTCAGGGG
GATGGGAAGAGGGATTTGTGTATATTTTTACGTCTTTCTGCAGTGAACATTGATTTCTTG
TGGGGATATTGACACTTTTTTCTAACTGTATGTTGTTGGAATCAAAGGACTTTATGGAAT
ATCCTTCCTCAGAAGTTTTTACAAAATGTTCAAGGCAACCAGCTGTTTTTGAATAATTTA
GGGCAGCTCTCCTCCTATTCTGGAATTCAGGGATGAAGATTTTTTTTTTTTTTTGAGGAA
GATTAGCCCTGAGCTAACATCTGCTGCCAATCCTCCTCTTTTTGCTGAGGAAGACTGGCC
CTGAGCTAACATCCATGCCTGTCTTCCTCTACTTTATATGTGGGATGCCTACCAGAGCAT
GGCTTGCCAAGCAGTGCCATGTCCACACCCGGGATCCCAACCAGCGAACCCCATTCCGCC
CAAGTGGAATGTGCACACTTAACCGCTGCACCACCGGGTCGGCCCCTGAAGATATAATTT
TATCGCTATGGTGGCAGTCAAAGGTAAAGGGAATGCTATTCAAGACTTTCATGACATAAA
CTAATAGACAAATGCTCATTTTATTAAGTAGTAAATAATTGCAAGTGATCTTCCTGCCCA
CATGTGGCACATTTGAGAGTCAGTTTATATTTGGATCCTTGCAAAATTCTGAGTATCAAC
TAAAACACCACCAATACCACCTAGGTTTGTGTGGGCATGCATGGGGAGGGGGAGGGAGAC
GCCGGTGCAGCAGGGGCATTGAGAAAAATACCAAGTTAACTAACTCATCTCTAATTTGAG
ACTCCATTGTTAGTGACTTCAAAGAGTTCACAAACTCACAGGATAAGGAAACCTGTATAT
AAGGAACCACAGTTCAAGGCAGAATGAAGAACCCATAGAGAGGTACCAGCAAAGGATGAA
AAAGGTTTAAAAGAAGAAAAACGTTTTTCATTATAGGGATTTTAAAAGTTTGAAGACTCT
TAGAGGAGGTGGCCTGTGACATGGCCTAAGTAAGTATATCTCAAACTTGACTGTGGATTT
TGTTTACATGCAGATTCCAATTCAGCAGGTCTGGGGCGGGGTGTGAGTTTCTGCATTTCT
CACAAGCTCTCAGGTCATGTTGCTGGTCCAGGGACCTCTTTTCCAGAAACAAGGGCCTAA
AGGCTATCTTAGGATGTCAAAAGGTGGAGTCTGAAGAGAAAACTTTCTGAGCAGAGAAAT
CAGTGTGAACACCACCACCAGGGTGACAGCATGGGGTTCCGTTTTGGGGAAATAAGGAGA
GTTTGGGACATAAGCCTGGGGAAATAAAATTTGGCCACACTGAAGCAGGCCTTGAAGGCC
AAGTTGGGAAGCTTTTATTCAATTAGAGGCAATGGGGAGCTACTGAATGCTTTTGGGCAA
AGGAATGATATAATCGGTAATCAAAATTCTCATATAAATCTCTATAAACAAAACAAGCTT
AATTAATCAACAAATACTTGAAGTTAGTGAATTCGGAGTCCATCAGCAAATATGTCTTCA
ATTTTCACTTGCTGTTATGAATAGAAATTAAGTATGGGGCCTTGGAAGGGGCCATGCCAG
TAAGGAGGCCCTGAAGCTTAGGTTTCTGGAGGCTCATGATAGATCCATCTGTGTATCTGT
CCTTCTTCCGTACGTGAAGCATTTAAAAGAGATACAAGGCATCTTAAGGAGTTCACAGGA
GGGAAAGCATATTTATTGAAGAAACAAGCTTCATGCAGGGTGTGTGTGAATCTTAAAGTG
GGTCCTGGAGGAAGATTTAGAAAGGAAGGAAGTCATTTTTGATGGAAGTTTCAGCACAAA
GAGGTGGGGGTGAAAGAGGAAACACTCCCCCTACCTCTTATTCCTCCTCCCCCTCATCCC
CACTGGAGTAGCGCGTTTGTTTCCTTAAGAAGGAACAGAATACGTATTAGTCCAGGTTGG
GTGCTTATGACCAGGAGCCACCAGAAGGCAGAGCCTGCACTTGCACTGCAGTTAACACTG
GGCCGGCAGCAAATAGGCATGGATCAAATCTAACAAATGAACAAGCAAATGGGGGAGAAA
TAGAGGACACTGAAGAAATGGCAGAGGGACTTGAGTTTGATGTGGCTGGAAAGGCAAAGT
CACCGTAGGCCCTGAGATGGAAAATGACAAGGTGGACCCCCAGTACTTCTACCTAAACTG
AATCACTGATCCAGCGGACCCCTGCAGTACTCATGTGAGAGACACATTGCCGAACTCAGC
AGCACACGGCACAGCCCTCATTCTTGAAGCCCGCTCCTCATTCTTGAAGCACTGCGTTTC
AGGCTTCTGTGAATCCATACTCTGCTGGTTTTTTCCAGTTTAATCCATTAGATACTTCTT
TTCAATCTCCTTTGAGAACTTATCCTCCTTTTCCCAATCTCTGAATGTTGATATTCCTCT
AATATAGAAAACTCTTAAATTTCTATCTCCAGCCCAGAGCATTTCCTCCAACCTCCAGAT
TTATACATTTGACTGCCTCCTTGACATCTCCACTTGGGTGTGTCATAGACATATCAAACT
TACTATCTGCAAAATTAAACTCTTAATTCTCCACTAGAAAAACTCCTCCCCACTTGCATA
TCTCAATAAATGAGATTGACATCCACCCACTTATTAAACTCAGAAGCTTGGGACTCATGC
CCATCTCCTTCCTTTCCCTCCAAGCCCCATATCCAATCTATCAGCAAATTCAGTTACTCC
TATCCTCAAAATATATCTCCAACCTCTGTCTCCAGGGCCACCACGCTAGTGCTGCAACAA
CAGCCTAACAGACCTTACCTCTTCCACTCCCACCCGCCTCATTCATTCTCCACATAAAAG
CCAGAGCAATCTTGAAATAATGTAAATCAGCTCATATCACTCTTTGCTTGAAACTCCTTG
ATGATGTTCCAAGGCACTTTGAATAAAATCTAAACTTCTCACCACTTAGGAACTTTGTAT
CCATTAGGCACTCCTGGCCCACTGCCTAGGAGCTGAGACCTTGTCAGAGACCTATAAGAA
ATGTTTGAGACGGGGGAAAAAAGAACTGGCTCCAAAAAATTTCAAAGTCAAAATTAATAA
ATGTTTGTGACTCCATAATATAACATGTCAACTAATCCAAAATTTCAATTCAACTTTTAT
GTAGTTATTTATATATTTTATTTAATGAAGGATGTGGGTACATATTAATTTGTCAGATAT
AATGTGGAGTTGGTTTCCAAAAGCTGGAGTATATAAGCCCTCCAGGGGTTCTAAAATGGT
CCCTTTTTAGGGCCTAAAAGGTCCTGCATATTCCCATCTGTGTCACCTCTTCATGCTCTC
TCTGATGCCACTGTCCTACTTGCTCACTAAACTCAGCCAGCCAGGCCTGCAAATTCCTAG
GATGCACCAAAATCTTCCCTGCTGTTCCCCTTCCCCTCAGGCCTCCATCTGACTCCTTCT
CCTCCATCAGTACTCAAATTAAATGTCACCTCCTCAAAGGGACCTTCCTGACCAGCCCCT
CGCAAGCAGGCACACACAGCCCTCAATATCCTATCTTCCTCCATAACACTACTCTCCATC
TGTGGCGATTTTATTTTGTCTCTTTATCCTATCTTTCCCGTTAGACTCACAAACTCCATT
AAGGCAGGAAACTTAAGTGTCGTGCTCTCTGTTGCATCCTTAGGGCCTACTCCAGTGACT
GGCGCAGAACACGTTTCAATAAATAGCTACTGAATGAATGAGAACTCAATCTTCAGCGGA
GGAGGGCCAAGCTAGAAAGATGAGTCTTGGATTCCATCTTGAGAAGCTTGAGGCGCTCAT
GCTCCTTTGATTCTAGGCACGGAAATAGGTTTAAAAAGGAATGTTTAGAGAGTTTTTCCA
ACAGAAGTTTTGATGAAAGCCCTTGTCACTTACCCTACTGGGGTGGAGGTGGGGAAATCA
AATATTGATTCAAAACGAGGTTGAAGGGAAAGGAAGTGGTTTGGAGCAGACTTGAGGCGC
ATCAGCCTTGGGCTCCTCCTTTGCACCCTCCCCTCCCCCAGACCCTAACGGCTCCACCCC
TTCCTGTCTTCAGCCAGAAGCAAAGGGTGCCTTTGGCCTCGGTGCAGACTCAGAGGACCT
CATTCGTTAATTATTCATCACGTAGGCGGGCCCTATGGGGTGGCACCGGGAATTTTACTA
TTCATAAGGGGGCGGAGTCTCCCTCCCGGGGGAGCTCTCCAGAGAGGGTTCTAAATATTC
ATGAGGGAGGAGGGCACCATGGGAGCCGGGGTTCTTGCTATTCATGAGGGGGCGGGGCTT
CCCTCCCGCTGGGGCTCCTGGGAGGATTCTAAGCTCTCCGGGAGGCCACGGGGGGCGCCT
GGGAACCCGGAACGCTGTACCAGAGCCGGCGGGTGCCGGACCCTCCGTCTTCTCGGCGGG
AAAATCTTGAGGAGATATTTTCTTTTTGAAAGATTAAGAAATTGGAGGATGGTGGGGCAA
AACGACTAAATCCCATTTTCCTGTGATTCTTTAGGCGGCAAACTATCCAAATCTGTGGTA
AAAAGAGATTTTTTTGCCCCAGTACTTTCTTGAGATAGTTTCATCTTTTCATGGACTGGA
GGGGGCGGAAAAGAGACCACAGTGTGATTTGATTCTTAGATTGGCCAGTTTCGCTGTTCT
GGCCTCCCTAGGTTACCGCTCTGGAGGCGTTCGGGGCTAATACCCGGGCGAAGGCGTGGG
TCCCTTGAGGGGGCTTTTCTTAGGTTCCAGCAGGATAGAAGCCCCGGGGAATTGCTGTTA
GACGGTTTTCTCTGGAAGGGGGAAAAAATTCATCCCGAGGGTCCCAAAGCCTTTCACACA
GAGTCAGGAATGAGTGGGGTGGAACGGGGCATTGAAACAGTCATTTTATTACTATTATTT
TGGTCTGTGATTCTCACTCTCTAATGGGGGGTGAGAGGAAACCAGCAATCAATTGGGATT
ACACCTTTAGGATTTTCAGAAAAGTCTGCTGTCTTCCCCCAAAATGTTGAGGTCACAGTG
AGGAAAATAAGGAATTGTTAAGAGGAGATTCCAGTTTGCAAAGAATTTGGGCCACTGTGT
TTTAATCCTCTCAGAGGGTTGAAAATATATGTACTCAGTGGTTGACACACTAAAGTGTCC
CCAGGTATCAGGGGACAGGGAGTGAAGACCCCACAGACCCCACCCAGGCCCACTTGACAC
TTTCCTCAGAGAAACAGGACAAATCCTACGCCAGATTTCTATTTGTTATAATGAAAAAGC
TTTAAAAACAACCTCGTGGAGGTTTAAATTAAGGATTTAGATTCCTCTGCTTGGGGGTAT
TACATGCAGATGCTTGTAGAAGTATATCTAATTGCAGGGAGAGAAATTACCATTTTAATA
ACAAATTACAATGGAAAAAGCAGATTACAAAATGCTGTGAACAGCGAGCCCCCTCTTTTG
TTAAAAAGAAATATTTGTATATAGGTAAAATTCTGGCATGATGTAAACCCAAGTATTTAC
GAGTGAATTTAATTTTCTTCTTCTTTCTGTGTTTTGTAAACTTTTTGACAATGCACGTAC
ATTACTTGCGTAATTTTAACGATTGTTTAAAAATGCCTCCTGATTTTAAGTGCTCCGCGA
GTGCTGAAGCGCAGTGCTGCGGGATGGTTTGAAAGGAGGTTCACAGTATGCTTTTCGCTC
AGCACTAAATTTCTTGGGCATGTTTTCAAATATCTAACTGATTTTAAATTGATGTAAGTC
GGAATGTAACCTTTTAGATGAATAAGTAACAATGTGATTTTAGCAATTTTGTGACAAGAG
GAGAAAGTGCACTTTGGTCAGATGTATTTGTAGCTCTGATGAAATGTCTTAGTTGTTACT
TCAGAAACAGGGAGCCTAGATTGGAGTCGTGGTTATGGTTACGGACGTGTATCTTTTCTG
AATTGGAGCAACAGTGACTCGAAGTCACTGTGTGTGATGAGGAACGTTCTTTTGAAGAAT
TATTTAAAGAATAATAATTATTATTTAAAGAGTAATATTTTTTTTAAAGAATTATCTTTT
AGTGTAAGTAAATGATCAGTGATTTTGATAAATTCCCTCCAGGAAATGTTCATTTTGAAA
TCGAGTTGTGTAGGCCCTTTCAAAGACTTATCAGTTACTATTATTAATCAAAAGTAGAAT
TGAAGGAAAAATTATTATTCATGTATTTATTCTGGTCTTAGTAATTTTACAAAACTTTAA
CTTCCCTGTTTATTTGTGTATTATACCGCACATAATTGGTAATAGTAATGCAACCTTCGT
AATCTGTTAGGGCTAGTAAATTTTAAAAGCTCTAAACTTAAAGTCTATTTTTTATCTCTT
TGTTTTATTGTTTCTAACAAAAGAACATGTCAGTATTCAGTTTGAAACAAATAGAAAAAC
ATTACTACAAATTTTTGAGGCTATATTAATACTTTGATTTTTTTTAGAATGTAAAGATTG
TAAAAGCAACATACTAATTGACAGATATTGAATTTGTTATATTTTTTTGTGTTAAATCTT
TTACTTTTTAAAATTTTGCATATTTCTCTTCTTAGAATATATCTCAGGGGCTGGCTTGGT
GACGCAGCAGTTAAGTGCCCGCATTCCGCCTTGGTGGCCCGGGGTTCATCGGTTCAGATC
CCAGGTGCGGACATGGCACCACTTGGCACATCATGCTGTGGTAGGCGTCCCACATAGAAA
GTAGAGGAAGATGGGCACGATGTTAGCTCAGGGCCAGTCTTCCTCAAAAAAAAAAAAACC
CAAAAACAAAAAAGCAAAACAAAAAGAATATATCTCAGCCAAATATATGTCTCATTTTCT
ACTAAAACTCTTAATCTAACTAGAATATTTGCCTAAGAGGGAAAATCTTTTTTGGGGAAG
GGAGATTGGAACTTTTATTTTTCATTTATCTGTCTTTTTTTTTTTTTTTTTTTTGGTGAG
GAAGATTGGCCATCAGTTAACATCTGTGCCAATATTCCTCTATTTTTTTTGTATGTGGGT
TGTCACCACAGCATGGCTGACGAGTGGTGTAGGTCCACACCCAGCATCAGAACCGTGAAC
CTGGGCCACTGAAGTGGAGCATGCCAAACTTAACAACTAGGCCATAGGGACGGCCCCAGA
GGGAAAAGATTTTTTAATATTTCATTTCATGCTGAGGTGAATGGATTCTACTGGTGGGAA
CTCCGTAAACTGGACATCATACTGAAAGTTTTGTAAATATAGAGAGACAGTTATTGCCCA
CCCAAATATCAACCTCTTCATTTAAAAAAACAACAGCTCTTCATTGCTATAATTTCCTTT
CTTTTTTGTCTCTTGGACTTTGTTTTTCTAACCAGGATAAATTCATAAGATAAGAAAAAG
GATGGCATCTAGAAGAAATACCAGTTTCACTTTGATTCCCAACCAGAAATATAGACGTAG
TAATCGTCGATCCAGCTATTTTTCCAACACCCGTGACTCAGATTTTCAGCCTTTATCAAC
ACTTGGAAATTTTAAAGCCTTGCCGTTGGAAATATTCCTAATAATCTTAAGATATTTGTC
AGGTGAGGTTTGGAGACTCTGAGTAGGCTACATAGACACTGGAATATTTTAATTTTTCCC
AAGAACTAGTTTGCCATCTTAGGGCCTGCTAGGATGTTAATGGTGTTCACATGAAGTTTA
TTTTCTAAAATTTCGTCATTCTTAGGTAGGGGGTACAATGAGAAACTATGATACTCAAAC
TCTTTAAAGCATGTCTTTGATTATAATGACATGGTAACTTGTCTGTTACATCCCAAAATG
TTTCTAATTCATTGAGCACTGGATTTAAAACGATTTTAAGATTTTCCCCTTTTTTATTCA
CTTACAATGTTTATTTTTATTATTTCGTATTATTCTTAATGAGCTAACTTATAAGTTAAC
GTGTTGTACTAATAGTAGTGTTCTTGTATTTAAGCCGCTCATTTCATGTGTGTATATATT
TCTTTTGGTAGTGAAGGATATCAGCATGCTAAGCATGGTGTCCAAAACGGTCAGCCAGCG
TATTATTAATTACATCTCAACCTCATCAGGAAGCAAAAGACTTTTACTACAAGACTTTCA
CAACCTTGAGCTGCCTGGCGGAAGACAAGACTCCACGATATTGGAACACTACAGATCTCT
AGGTGATTTATAATGAGAGTTCTAACAAGAACTATACTTAATTAAGGGGATTTTATTATA
CAATTCTGTAAGGCCCATGAGAAATGGACTATTTCCTAAAATGTGCCTATTTCAATGATA
CTCTTACTCTTCAGTATGAGGACTTTCCCTTAACAACAGTCCCTTACGCTTATCTTTGAT
GATGAGAGAATGCACTTTAAGGTAAAGTGTCAGTTCTTGTGATTTCACGTGGATATGTCA
TCAATGCTTATTGTCGAGGTGGCTTAACAGTTTAGGAAATTGATATATTTTCTATACTTT
GCTTCCTAGGGATCTAACGAGTTTTATCTCTATACCTCTTTTCCCTTTCAACCATAATCT
AGTCCTTAAAATAGAAAAGAAATTTAGATACACTATTATAGAAGATCACTTATTCTTTTA
TCAGAAAAAACTGTTTTCTTTTCTTTAAGCACTCTACACACTAATAAATCATTATGCTAT
GATTAAATTAACCTTCTCAAAGGAAATTCTGTATAATCTTTCTTCCCTTGATTTGTAATC
ATTTGAGTCTTTCACCCCATTCGTTGATTTCATTCTCTCTAAGAGTGCTGAAATAAAACT
CTAATTTTGACTGTCTAATGACACCAATTTAATTATGAAAACACCTTATAATTAACCAAG
CATGGCAGTAAAATCAAAGTGACGTTGAGATTTAAATAAAGGCATAATAGTAAGTTAAGT
GATTGTTACCTTTTAGTAGCCCAAGGGTGCCTAGCTTTAAGACAATAAGACCATATAGGT
GTGTAAATACTCAAAGTGCATTTGACAAGTATATTTAATAAGATTAAATGAATGATATGT
AATCTTATTACAATGTTATTGGTTTCAGTATTTATGATCAGGCTTAGTAAATCTGTAACA
GAATATGGCAATTACTTTTTGCTACTTGTCATTGTAAATATCTTTTTTCAAACATCATTA
GTTGCAGAGAAAACGGTACCTGGGTAAAAGAGATTATTGTTTGGTTTTGATCTGAAAGAA
TTTTTTCTCCCTAACCAAGGCTCAGTTATTTAAACAAACAAAAAAAGCATTAAGACAATT
ATGTGGATAATTCAGTTAAAAAATACAAGTATATATTGATCTTAATAGCTAGCTTTCTAA
AACGGTTTTATTTGTGTAATGATTTCAACCTTCCATTTAATTTTGCTGCAGACATCTGGC
TTATGACTGATTCTTTAGGTAAATGTTTGATGTACTCACCGTTTTCTCGTACTGCCATTC
CTATCTGATCTGTTCTTGTTTTCAGACATAAAATAACATTTTCAGAATCCTGCACTCTGA
AGATTATAAATTTTAATTTGCTTCTTCATACAAAACAGAGCAGATGGCCAGTGTGGAAAG
CACATTACATCTGACTCTGTTTTAGTGGGAACAAAGTTAAAAAGTTGGTCTCTAAAGGGT
ATAGCAGAGCACCTGTGTTAAAAAAATAAATAAGTCAGCCAATATTGGTTTTTATGGTAA
ATTGCAACCCTTAAAAATAGGAGTTTTACTTTAGAAAAGGCAACCAGCTTACAATTATAG
CTTACAGTTCCCCAGCTATGATATGCCATGGGAATGGATGCCAAAACAGGAAAGGAAAAG
AACTCAGCTAAAAACCAAACACTGAAAATGGCTTTTTATGTACAAAAATAAGGAGGGTTT
ATGTTTAAAACTCAATTCTGGTCGTATGTTACCCAAACATAGCAGCTTCTAAAAATAAGT
TAGATTCCCATAGATTCTACAGAGTTATATAAAGTAGTTATTATGTTACATTAAAAAGTA
AATGCAGAGAATATAAAAACTGAAGAAAGTCATGATATTCAGGTATTTATTTTCCTACCA
CATATCTTATTTTTAGTTTGAGGACATTTGCCCTTATAGAAATGTTAACAGTGTATTGCC
ATTTTAGGAAAACCCAACACTTAAAGTTAGAGGAAACAAACCATACACTTCCTGTCACTG
TAGTTCAAGTTACGTATCTCACGGGGAAGCTGAAGGGTGTTTTTTTCCTTTCTTAAATAT
TTGAACACAAAATTCTATACATTCTTAACATGCAAGCTCCATAAAAGGACATATTTGAAG
GAAGGAATGGATATTTCATCCAAACTGGCTGCTTTCTGCTAGCAAAAATGACTTCTAACC
TCTGAATTTTAAGTATTTATGACGTTAAGGTTTTTTATTGGAGAAAGGAATACAAAATCC
CTTTTCCCATTCTTTCCATGTTTTACGTTAACAATTCAAAATATTTTCCTTCATGGACAT
AAGGTTAATTTCTAGAGACATTGGAATATGTTTTCTGTGGAATAAAGACAATGTGAGGGG
CCGGCCCTGTGACCGAGTGGTTAAGTTCACACGCTCCACTTAGGAGGCCCAGGGTTTCAA
CTGCCTGGATCCTGGGTGCAGACACGGCACCGCTGGTCAGGCCACATTGAGGCAGTGTCC
TGCATGCCACAACTAGAAGGACCTGCAACTAAAATATACAACTGTGTACTGGGGGGATTG
GGGGAGAAAAAGCAGGGGAAAAAAAAAGACAATGTGAAGTTTCCCTAGTGTATTTTTTGT
CCTGTTACTGTATCTTTTTAGATCTAAATACTTTTCCATATTTGTCCTGTTGTATCAATT
TCACAATTTTTTTAGAGATTTTATGTCAGTGGCTCTTAGGTGGACGTCAGAGTCACTTGG
TAAACATCATATATTATAAGTGTTTTGCACCCTTCCTCCCAAACTTCCTCTTAAAAATCA
TATCAGCTCACAGTCCACTATGGTATACCATACTTGACCCTCAGGAAACATTATGCTGTG
TTTTATAGATATTCTTAAATTAGTTGCATTGTGGTTCTCATTTTTTCATGTGTCTCTTGC
TTTCTCAGGTCTACTGTTTAAAAGATGTACGTTGCTGCTACCCACAAAGGAAAGACTAAA
GTACATTCACAAGATACTCGCAGAAGTAAGATCATACTTCTGAATTAGTTCACAATCTTG
ATTTCCAGTAAAGATATTTTATTATTAATGTCTTATACTCATTTAAAATCTATCTTTAAT
TAGTATAACCATGAATTAGTACTGAAAAATTGACTGATGATAATCTAATACTTTCCAAGT
ACTTAAAGATTATAAAACACCAAAATGTAGTATAGTAGTCTTTTACTTATTATAAAACAA
TTTTTATATATAACTAAGTGCATCATTTAAGTTATTAAGTTTATCAGAGTATAAAAATAT
TTTTGCCCCACATGGGAATCCTGAGGATGTTTTAAAGTGATGATTTAGATACTTTATTAA
AATGAAATAATTTCAAATCTTAAAATCTTACTGTTTAAATATACAAAAACTTAGGAAAGC
ATTCTTAATATAAAAAGTGACAAACCTTTTATGATAATTTATGACTTGGAAATGTATGTC
AGTGTGTTTGGGCATAATCTCTACATAAGACATTGAGTTTTACTATAAAAACTCAAACAC
ACATACAGTGCTGGCTACTCAGTTCTACACTCAATAGTATGCAAACTGTTTCTGCTGCAC
TGGCTTTTTTCATGTCAGTATTTGCATTGAGTTCAGGTCTATATTACTGCAGCAGCTTTC
CAGATATCTTTCTGCCATCCATTTCTCCACTCCCCCAGACGTTCTGTATGCCGAATCAAG
GTTGTTCTTCTGAAAGCATCACTTTCATCAGATTAATTTTCTTGCTTACAAATCTTTCAG
TGGCTACTCAATTTCAGCAAGATAAGGTCCAAAGTCCACAGCTGGTATTTAGGGTTCTCT
TTTACAATGCAACCTTACTTCCTACTGCTTTGAGCCTAATTAAGCTGGTTATATCTTTCT
TCCCAAAGAAATCTTTTTTATTCCTGCCTCTGTACAACTTTGTGCATGTTGTTTCCCTCA
CCAATCCTTTCCATGTGTTATATCTGAATCCTACTTTAAGACGTTGCTTGTTTCACATCC
TTCGTAAGCTTTTCTGACCATTCCCAAATTTATCTTTTCCCTGCTTTCATAGTGTCTGAT
GTAGTGCTTATTCAGTCATTTTAGCATTTATACACATTCTAACCTGAATTATCAAAACAA
CTTCACGTGTATATATCTTATTATCCTAAATAACTTGTGAGCTCCTTGAAGGCAGAGAAT
TTGTTTTATTTTTCTTTCATAATTCCCTCCTATATAACACAATGCTAATCAGTTATTTAG
TGTATTAGTTATTTTCAGTTAATACTGAAAAAATTCTTGCATATCTCCATTAAATTTGAA
TGTCAAATCATTGTACAGTTCCATTGAAAAGGAGGAATTAATAGTTATTTTATTTACAGG
TTTCCTGTTTTAAATTCAATGGCTGTGCAGCTCCTATGCAATGTTTAGGATTACCATGTT
ATGGCATGTTTTTACAGGTACATTGTTTTAATAAAAGAAGGAAAGAAATGTTTTGAACTG
TTAACAAGTAGAGCATGTAATCTATGTTTCCATAGGTTAATAAAAGTAATGATAATCTAA
AAAGAGAACAAAATAAAATTGTAAAAATTTGAGAATGTATGAATCTAATAGTGTGTTGCC
ACCTCAGATTTTCTTCTCGGATTTCTCCTTGGTAACACATGTTTAACCTTTATTTGCTCT
ATACCAATGTCCTCAAAGTTTTCAGCCAATTGTAAAGACTGGAAATAGTGTGGGGTTGTG
TGTGTGTGTGTATGTGTGTGTGTATAATTAGTTTTAAATCTTGGGCTAGTATTTAACATG
TTATTTTAGAAATCAACTGTATGAAAAAATATTTGTAACTCTGGGAGGTGATAGATATAA
CTAACCTTATTGTGGTAATCATTTTGCAATATATATATATATTATATATATATAAAATCA
CAATGTTGTATATCTTTAACTTATACAATATTATATGTCAATTATGTCTCAATAAAGCTG
GAAAAAAGAAATCAACCGTATGATTTTAAGAACATTTTTGGCAATCTTTTATTGTAAACA
GATAGCATAATTTAATGTTATTCAATTTTAATAATATTTTATTAGTATATTACACTATTC
TAAGCAGTTTACATGTATTAACTTATTTAAAACTTACAACAACCTTATGAGATTTATAAC
AGTTTTACAACAATCTTGCTTATATCCCAGCCTGCCAGCCACCATCTGCACGCCCAGGTT
CCAGGGGTATAGACTCTTCTACTTGCCATTTTCCAAGATAGATTTTTGCTTTTTGTTTGT
TTGTTTTAGGACAGGTAATATGAGCACGTGTATTCATGTAAAATTCAAAAGGTACAAAAT
GATATAAAGTGAAAAGTAAGTCTCTCTCCCAGGCCTGTCCCTCGCCCACCGAGTTCCCCT
CAACAGAAGTAGCCAATGTTAGCAGTTTCCTGTATGTCCATCCAGAGAGAATAAGATTAA
TTTTTAAACTACTGAAGTCCAGTTCAACTATTCTAAGAAAAATTTATGTGATTAATCAAC
CTTTTCAACATCTAATTATAGTGATATACCATTTGAATTTCCTTTTCATATATGTTTAAC
TGTACCTTCTGGTTTGCTCAAAGATAATTATTAAATTTTGTCCTAAGAAGAAGTTTTTGC
TTGTTCACATCCAAATATTATAAATAAATGCTCATAACTGTCACATTAAAATGAGATCAT
TATTATTTGTAAGAAATATCATAAATGATAGCTAGAGGGGATCAGAGAGATTCTACTGTA
GTCGAAAACTAAGCCCAAGTGTGGTCGTGAGTCAGATGTCTAAAGCTGTCCCCCAGGGTT
TGGGCTTTTATTGTTCTCCTCATACTAACAGAGTTCAGGATTCAGTACCATGTGGCAGTT
CTCTGAAGATACACCGTTTACAACCAAAGACAGACTGGATTTTGAAGGATTTCTAGATTT
TGTTTATGTAAAATTTCTTACTAATTTCGACAGTTCTATAGAGATAAAAATTGTACATCA
CTTCGCTCATGTGCTACAACAGTTATGCACATAAGGCTATAGTGACTTACATTTTGATTC
GATGGTCTGAACATCTGCAATGTTTCCTTTATTTTATCATCCTTAGACTTTAACAGCAGG
TTGGGATGAACTTGAGTGCCATCGTGTTTACAACTTCTTATGTGAGCTGAGTAATCTGTC
CCGCAAGATGCAGACTGTTGTCTGCAGCAAACCAGGTAAAGAACTACAATTCAGAAATAA
CATTATACTGAGATTAAAACGGAAAGAAAGCAGAGTTCAAAAGTGTGTTTAAAAATAGGT
TGTGGCATCCATTTGTAGTCAAAGGACAAAGAAATGTAAGGGAATGATGAAGACTGAATT
GGATAGTGAGACAAAAGTGGCATGTGATTAGAGAAAGAGAAGCACTCAGAGGGCTTCAAC
TGTATGCATAATATTTTATTCCTTAACCTGGGTGGAGGATACAAAGGTGTTCATTACAGT
ATTCTTTGATCCTTTATATATACCTGAAATGTTTCATATTTTTAATATTATGGAACCCTA
TAATCTAGCAGTTTCACTCTGAGAAATTCCCACAGTGTGCACCAGGAGACATGTATCAGA
ATGAGCATTGCAGCATGTAACCATGACAAGCTGCAAACAACCTAAATGCCCATTGTCAGG
AGAACGGATAAGTGAATTGTGGCATAATCATACAATTAAAACTATTAGTAGTTAAAATGA
ATATCTAGAGCCATGTGTATTAATAGGGATACATCTCAAAATATAACTTGAGAAAACAGA
TTACCAAATGATACTTTCAATATGTTACTATTTATATACATGTTAAAAACATGAAAAATA
ATTCTATATATTCTTTATGGTTACATACATATGTAAAAAAGTATAAGAACGTAGTTGAGA
GATGTGATAGTTAATTTTGTGTATCAACTTGAGTAGGCCATGGTACCCAGATATTTGGTC
AAATGTTATCCTGGATGTTTCTCTGAAGTTACGTTTTAGATTAACATTTAAATCAGTAGA
CTTTGAGTAAAGTAGATTACCCTCAGTAATGTGGGTGGGCCTCATCCAATCACTTGAAGG
CATTAATAAAAAAAGACTGACCTTCCCAAACAAGAAAGAATTCTGCCAGGAGACTGCCTT
TGGACTTGAGCCACAACTCTTCCCTGGTCTCCAGCCTATCGTCTACCTTGCAGATTTTCG
GCTTGCCAAGCCTCCACACTTGTGTGAGCAAATTCCTCAAAATAAATTCTTCTCTATGCA
CGTACTCTATGCACATCCTATTAGTTCTGTTTCTCTAGAGAACCCTGACTGATACAGGAA
AGACAAAACCCAATTTAAGATGGTGATTACCTCTGGGGAGGAAGGGGAAGAAGACTGGGA
GTGAGATACAAGAAGCTTTAACTGTATCTATAATGTTTATTTATTTTTAAAAATCTGAAG
CACATATAGCAAAAAGTAAAGCTTTGATAAAGCTAGGTGATTGGTATACAGTATTTGTTA
TGGTAACTCTGCCTTTCTGTCATCTTGAAATATTTCATTGTAAAACAAATTATAGATTAA
AAAGACAGATTTAGAAGACCAATGAAACAATAACAAAATTAATTCATGTCCCTACTTGAT
CAAAAATTTTTATTAGCTCCCTGATAGCTTCAAAATAAAGTTCAAACTATTTATTCTAGC
ATTCACATTCTGATCCCAACCTGCTTTTTCAAACTTATTGTCCATTATTCTGTATATCAG
TTTGATATAGACTAGGCATATTGCTCTACCCACTGTGTCTCAGATACCTCTTCTACCTCA
TACCTTTCATTCATCGTCTTTTTTCCTGAAGTGCTCTCTCTCCTCATTCTTTAGGATCCC
ATTTGCCTGGCCTCCTCTATAAAGCCTTTTCTGATCTCCCCAAGCCTGCAGTAATCTGTC
TTCTCTAAATTTCTGTGTTACTTGGCTTAACAAATCAGGGGTACTTGCTTATATATGGCC
TTAGATCATTGGCAGACTTTCCATTTACATTTGTCTTATCTATAAATAATTTGAACATAA
ACGGTATAAAAATGTAAAATAGTGCCTCCATTATGGAAAACAGTCTGGCCATTCCTCAAA
AAATTAAATGTAGAATTATCATATGACCCAGAAATTCCACTCTTAGGTATATACCTAAGG
GAATGAGAACAGGGGCTTGGACAGATGCTTGGACGCCAATGTTCGTTGCAGCATTATTTG
CAATAGCCCAAAAGTGGAAACAACCCAAGTGTTCGTCAGCAGATGAATGGGTCAACAAAA
AGTGGTGGATACACACAATGGACTATTGTTCAGCCATAAAAAGGAGTGAAGTTTTGGTAC
ATGCTACAACATGCATAAGCTTTGAAAACATGCTGAGTGAAATGTCAGACACAAAAGGAG
AAATATTGCATGATTCCACTTATATGAGGTACCTAGAACAGGCAAATTCATAAAAGCAGA
AAGTAGATTAGAGATTACCAGGAACTAGGGGGAAGAGGGAGTTACTGTTTAATGGTTACA
GTTTCTGTTTGAGGTGATGAAAAGTTTTGGAAATAGACAATGGTGATGGTTGAACAACAT
TGTGAATCTAATTGATGCCATGGAATTGTACACTTTAAAAATGGCTAAAATAGCAAATTT
TCTGTTATATACCTTTTACCACAATTTAAAAAAATGAATAATGTAATGTATTTAAAAATA
TCAAATTATATACTTTAAATGGGTAAATTGTATGGTGTGTAAATTATACGTATTTCAATA
AAGCTGTTAAAAAAACACAAGATAGTACTTCATACTCAATAAGATGGTTGAAATTAAAAA
ATTAGATAACAACAGTGTTGGTGAGAATGTGGAGAAATGAGAACGCTTGTACACTGCTGG
TGGGAATGTAAAATGGTGCAGCCACTTTGAAAAACAGTCTGGCAGTTCCTAAAATGATGA
AATATTGACTTACCATGTGATTCAGCAATTCCACTCCTAGATATATCTCCAAGAGAAATG
AAAACATATGTCCACACAGAAATTTGTACATGAATGCTAATATCGGCATTATTCATAATA
GCCAAAATGTGGAGATAACCCAAATGTCTATCAATGGGTAAATGAATAAACAAAATGTGG
TATAGCTACAATGGAATATTATTTGGCCGTAAAAATGAAGTACTGATACACGCCTTATGG
ATGAACCTTGAAAACATTATGCTAAGTGAAAGAAGCCAGTCACAAAAGACCACATACTGT
ATGATTTCATTCATGCGAAAGTCCAGAATAAGGAAATCTATAGAGACGGAAAGTAGATTA
TTTGGTCACTTAGGGCTGGAGGTGGTAAAGGATGGAGCAATAGAAGAGTAATAGCCAAAA
GAGCAAGGTTCCTTTTTGCGGTGATCGAATGTTCTAAAACTGACTTGATGACAGCTGCAC
ATGTCTAAATATACTAAAAATCATTGAATTGTACGCTTTAAATGGGTAAATTGTATGATA
AGTAAATTGTATCTTAATAGAGCTGTTTAAACAAAACAGTCCCTTGATAATCTAACATTT
TTACAGAGGAAAATGAAGTAACGTGTCTTTGACCTATCTAATATGCACATCAACCTTTCT
AGAAAGAATGGTTTACAATTCTTTTGTCTTCATAGGAGGTGCCCGAAAACTGGAGTTAAG
GATCAGACTGTTCTGTAGGAACGTTCTGCTTGATCACTGGACACATCGAAGTGATTCTGC
CTTTTGGTTGACACGTATATTAAAACCATGGCCAATGGTGAATCAGGCAAGATTACTGTA
TATCATCTTTGGACCAATATCTCCTCAAGATGGTGAGCATCCAGTTTTTAAGGGTGTATG
TTACAAAACTGGTTAATTGCTTTTACTTCAGGAAGGGTATCTTTTTGTACCTGCTCGGTT
TCATCATTCCTAGTGACTAAACTGTGGCTCATGACTTCATAGATGTATACTACATGAACT
TGTATGTAACTTAAGTTTCAACACAGAAACTGTTCTCCTGCAAGCCATTACCAAATATAT
TCTCATCATCTCTACGGAAATAGCTGCTTTTCATTTTTAAACATTATCTTAAATTTAAAC
ATTTAAGATTAAACATTAACTTCAGATTATGTTTGCTTCTAGAGGGGACTAGTAGTGCCA
CTGAAGCAAAGTAGTAGTCAGAATTGATGTATTACTTAATTTGGGGTGTGTAATATGATT
TCTTGCAATTTTTTGCCTTTCTGATTAAGATTTGCTTAGATTAATGTTAAAATTAACTTG
CAGTTCTTCAGTTCGCATTGCCTTATGTAGGAGGTAACCAGTTTACGGTATGCTGAATAG
CAGCAGGAAGCCAGTCTGGGATTCAATTTCATTGTGTGTAATTCACAAGGAGAATTGGTC
ATAGCTAAATAATAAAACAATTGACAGGATTACTCTGTTTTGATAGAAATGTTTGGAAGA
TTCTCAATTATGGTATACCCTCCTTTTAGAAGGACATCAGATTTTATTTATCTTAATAAG
ATTACATCAGTTGTTTATTCCAATTTCTGTTATAGGGGTAGCATTATCTTTGAACTAGAA
GCACTATTTTGTTTGGTGAAACTACCTTTTCTTTCTTTCTTTCTTTCTTTCTTTTTGAGG
AAGATTAGCCCTGAGCTAACATCTGCTGCCAATCCTCCTCTTTTCGCTGAGGAAGACTGG
CCCTGAGCTAACATCTGTGCCCATCTTCCTCTACTTCCTATGTGGGACGCCTACCACAGC
ATGGCTTGCCAAGCGGTGCCATGTCCGCACCTGGGATCCAAACTAGCGAACCCGGGTAGC
CAAAGTGGAACGTGCGAACTTAACCGCTGCGCCACCAGGCCGGCCCCAAAACTACCTTTT
CTTTACTTCGTTTAGCTATTGTCACTGTGCTTCCTTCATCACATCAGTGAGAGACATTCA
CATTTACACTATTATCAGAACTGACCTTTCATTATGAAAGTTAAAAGGAAAGCAGCATGT
ATAAGTAATGGATTCGATTATGCAATCCAACTTCCTTTTTAAATAATCCATGAAGTCTTT
ATTACAAGCCAACTATTCTGTCATAGCCTAGTTTTGTTTCAATTCTCATTCAGGACAGGT
GGTTTGGCAGAAAATGATAGAAGATCCTACAGATGATTCCAGTCTGAAAGATTTGGCCGA
TGCTATTAAACTATTATATGACACAGGCACCAAAGAGTGGACAGCAGATGATGTTATCAG
TCTTGTAGATGAGCTATCAGGTAAAAATATGTATTTACTATATAGAGTAATAGAAATTTG
TTATTAGAATACAGTTATAGAATTGTATGGCTAATTCTTTAGGTAACAAATGACTTACCT
TTTGGAAATAACTAAATGATCTAAAATATTTAAAGAATTTGGCATTATGTTTGAAGAGAA
TGCATATAATAAACTTACTTTTCTTCAATTGCAAATTTTATAAGTATGTATTTGTTACTA
TTATTATTTGAAAGCTTCATAATATGCTCATTTTGCAAGTTCTCAGAAACCCCCTCCTCG
GTTGTGTGAGAAAGCCCTCTCCTGCTGGTACAGGAGAGGTGGAACAATTTTTCCCATTCT
TGCATAATTCTTTAGATTCTAAAGTTTACAAGGTTTCTTTCCTTTCACAGGATTAGACCA
CTTTCCCTGTTGATCTATGTGTAGGAGAAATGCTCTGTCTGTATTACTAGTACATTTGTG
AGAGCTACCATGACTTGGCAGTAATCTAGGTCTCCAGCTGAATCCTTTCATTGAAAAACT
AAAGCATTTTTTCCTGAGCTTTTCCCTTGGCACTAATTGTATTTCTAATAAAGTGATATA
ATATTGCATGCATTTAATAATGTTTACTGTAGCTGTTCTGTAATTTCTAATTAAATAACT
GCTCTTCCTCTAATAAAAGTGGTTCCCCGTGAGTGGCTTCTAGAGAATAACGCACGTCTC
CTAATCCTAAGTGGGAACAACATCTGTTTCACTTTCATGGCCAGTAAAGCTGTGAATGGA
CGGGCCATTGACCTGGCAAGGCTGATGGTCTTTTTGGCTTTGGTAAGTAAAACATAAATT
TTTCTCTAGCAAGTTGTTTGACATTATAGTTGAGCACCCAGGGAACTGCCCTGAAGGAAC
TGAAATATATGCAAAACATTTTGAAAAAATAAATAAGTATATATTTTTATAAAATTTTTA
AATATATGTAATAAACTATAGTATTTAGAATCATTCCCTATGTTAACCACTCCTCAGTTC
ATATCTAGATTGTCACTATACAGCTCTGCCAAGTTATATTCTTTTTTTCAAATTCTATTA
AAAAAAATAAAGCATACCATTTGATTTGCTTCAGAATAATCAATGGGAAGCAGGGAGAGG
ATGTGGAAGTGAATGGTGGTAGAGGTGAAAGAAGATTGGTAATTGTTGAAGGTGGAAAAT
GGGTACTGGGGGTTCATTATACTATTCTCTCTACTTTTGTGTAGTTAAAATGCTTTTCAA
AATAAAACAGTTAAAAATAGGGGCCGGCCTGGAGGCGCAGCGATTAAGTGCACATGTTCT
GCTTCTTGGCGGCCCGGGGTTTGCCAGTTCTGATCCCGGGTGTGTACGTGGCACCGCTTG
GCACGCCATGCTGTGGTAGGTGTCCCACATAGAAAGTGGAGGAAGATGGGCACGGATATT
AGCTCAGGGCCAGGCTTCCTCAGCAAAAAGAGGAGGACTGGCAATAGTTAGCTCAGGGCT
AATCTTCCTCAAAAAAAAAATTTAAAAATATATTTAATATCATTCAGTTAACACAAATTG
AGTTTTTACCATAGACCATACACTGTGTGCGATGCTAGGCCTGTGAAAATTAATAGAAAA
AAATCTCTGACCAAAACCTGCTTTCAGTCTTTTGAGAGATATCAAAGTGTATATAAATAA
ATTCAGTGTGATAAGTGCAAAACTTGTGTACAAAATAATGCAAACAGAGGTAGCAGAAGA
GGAGCCAGCCTTGGGTGTGTGGAGAGCACAGAGAAGGCCTCCCCAACCCCAGCAGGTACA
GGCTTTGAAAAGTGAACAGGAGGAGTTCACCACACAGTAGTAGGGGCAAATTCTTCCAGC
ATGTACCTGCATGTGTTACATAGAAATCTCGTTTATTTTGCTACCATCACAGATGCCAGC
TCAACCAGTGCTTAAAAGCAAATGCAATAATCTTTACATTTGGCTGTTGTGAGGAGTTAT
TGAATGTAATCCATTTCTTTCTTTCTTTTGAGGAAGATTAGCCCTGAGCTAACTGATGCC
AATCCTCCTCCTTTTGCTGAGGAAGACTGGCCCTCAGCTCACATCCATGCCCATCTTCCT
CTGCTTTCTATGTGGGACGCCTACCACAGCATGGCTTGCCAAGTGGTGCCATGTCCGCAG
CCGGGATCCAAACTGGCAACCCCCGGGCTGCCGAAGCAGAATGTGCGCACTTAACCACTG
CTCGACCAGGCTGGCCCCTGTAATCCATTTGTTATGAAGCAGAGACAGCATCTTGATCAA
CTCAACTGCTAAAACTTGAATGAAACCTCTGTGGCTCTTCTTAAGATGTGAAGATAGCTA
CTAAATTAACTGTATTCTCAATGTAAATATTTATTTTAATAATTATGCAGATTCATGCAA
AAAAAGAAGAGGGAGAGAACTGGAACTGCATGGCTATATTCAGGGGCCTATAGGCAGTTC
GGGATTATTTCTGAAGGGTAAAATGTGCAAAAGAGGAGGAGGAGGTGAGTTTAGATAGGA
AGGGAGAGGCTGGGTAAGGAAGGGCCTTGTAGACCATTCTTTGGAGCTTGAACACATTCC
CTTCCAGGGAGCTGCTGAAACATTTTAGGAAGGGAAAAGACATGATTGGTTTTATATTTT
TGGAAGGTCACTTTGGCAGTGCTATAGCAAATGAAATGGAGAGGAAGTCACTAGGGGTGG
AAAAGCCTTCTCTAGAAAGCCTTCTCTGATTAACATCTCAACTCTTTTTTTTTTTTAAAG
TTCTTTTTATTTTTTCCTTTTTCTCCCCAAAGCCCCCCAGTACATAGTTCTATGTTCTTT
GTTGTGGGTCCTTCTAGTTGTGGCATGTGGGACACTGCCTCAGTGTGGTTTGATGATCAG
TGCCATGTCCGCACCCAGGATTCGAACCAACGAAACACTGGGCCTCCTGCAGCAGAGCGC
ACGAACTTAACCACTCGGCCACAGGGCCAGCCCCCTAACATCTCAACTCTGATCATTAAT
ATTCCCTAAATTGCCTGCTTGTCTTCCCTTTGTTGGCATTTGCTAATAATGTTCTTAAGC
CATTGTACGTGTGGGGTAAGTCATTTCCCAAAATAGATTGCAAGTTCTTTGAAATCCAGC
ACTGTGTCACTCACTTCTTTCATAGTGCCTCGTACAGTGCTTTACACACAGTAAGTAGTC
AATAGATCTTTCCTGTCAGATGAACATTATTTAGTTACACTATATAGTTTATTTTCATGC
TGTACATTATTTGACTATGTTAGTTAAATTGACCATTTAGAATGTTAGTAAATAAACCTT
TTTCCTTTGTCAGTTTTAGCTATGAACATGTAATCTTTACTTTAAATATTTATCTTTTAA
ATAATAGACAAATAATCCCTGTAACTCTCAAGATGGAAAGCTGATAATACCATAAAGTTT
TCTTGCCTCTTGAAATTGCCTGTTTGTCTGTCACCCTCATTGGACCCCTGGAAAATAGAG
GCCGTGTCTTTGTGGCTTACCATTGTATCTCTAGCTCTTAGCATGTGCTCAATAAATATT
TATTGAATGAATGAATGAACAGAAGTCTTATTTTTCATATATTCAATAACTATTTTCAAT
ATCAGTTCTTACATTAATAAATGATATTCTACGATAGGCTTGACCCAGTCTTTTATTTAC
TTCATACTTTTTCCTGATAAAATTGTACGATTGGAAAGCAAAGGAGCATTAGCTATAAGA
GCATTTCCCATTTATAGATTCAATATAATGTCACGTGTAATAAGTTATATAAAATTGTAA
ACCCTCATTGTTAATATCATTTTCAAATTCTACAGCTTTCTTTGCATGAAGATTTACCAT
AATGCTTTGTATGTCTAAATCAGGTCTGCGAGAAAGAACTATACTGCATGGATTGGGCAG
TGAAAATGATGCAAAAAGTCTGTAATGTCTTTAGCACTCCAGTGGAAAGAAATAACTTCC
TTCAGAGTGTGGCAAATGCATTTGCATGTGTTATAATGGAAATGATGCAGTCAATTATGT
CTGGTGAGTATGCATGGAGATAGTGCAAAGATGTGAGTAAAATGCATACTAGTCTTCACT
TAAGACAGAGATCATTCTGGGTAGACTTTTATTTCTAAACTAAGAATAAAAGAAACAGAC
ATTTTTTGTTTGTTTGTTTTCCCATGAGATATATTTAGTTCCTGGTTTTGCTACTTTTAA
AATTTGGTGTTGGTTTTAGTGAAAAACATAAAGTTGAAGAGTCTGCTCTGAAAGGAACCA
ATTTCAATTTTGCACAGAAAAAAATTTTAACTTGCTCACTTACCAACTATCATAATCATC
ATAATAATATCTTGTATTTGTGCAGTTTCATCATATATTATCTTACAGTTTTATTAGGTA
GCCCACAAGATAATTAACCCTACTTTACAGATGAGAAAACTAAGGCTTGGAGAAATTCCC
TGACTTGCCCGAGGTCGTAAAGTTAGAAGCAATAAAGTGCGGACTAGCATCGTTTTCTTC
TGACTTCTAATTCAGCGCTTTTATAAAATTCCATGATGTCAGTGGTTAATGTCTGACTTA
GTAAAGATCACTAACTAGTTTTCTGTCACACTTTCTTAGGGAAAATTGGAACATGTTATG
TTTCAAATAAATCATATATTTAAAAATTTAACTGTCATTTTCTTTTCTCTATTGTCCATT
CCTGTGTATGGCATATAGGAGACCATGATGAAGACGACAGAAGCTTTTTGAATCTGTTCC
AACTTGTGCATGCTCAGGCTAACTTCCATAAGGAGGTCTTGTATTTGACCATGAATCCTC
TCTCTACCTAAATACTCAGAAAGCCTTGCGTTTAGAGAATACCTCACTGAACCAATAATT
AAAAGAGTACTACTTTTTCACACTCAAAGAATAGCATTCATGGGACGTTTTTTATCACCT
GAGTAACCTAAGAATTCAAAAGCTGCATAGAATTTTAGAAGGAACTGCTTACACCATTAT
TAAGATAAAAATATCATGCAAACTCAAGAATGTATTGAGTTTTTTTGGAAAACAAGCTGT
GCTTCTCCAGATTTTGGTAAACCTAATACCAAATTAAATGGAACATTAATGTCCAAGAAT
CTGGGGCCAGCCAACCTCTGTGTGTGTATCTTTGAAGCAAGAGAAAATTCTGTTTTATAG
TTAGAGCAGACTCAAATTCACTGAATAGTCTGTATCTGTTCACTTTGCCTAGGTTGTATA
GAAGAGCCTAAAATGTTTTGTGAGATTTGCAATATGATGCTTTGGAATATGCAGATATGA
ATCACATTCTTTATCACCTTCTTGGCATATGATTACAAAGAACATTATATTTTGTTCACA
TTTTGCCTGAATTAACCAATCAAAAACCAAAAGAAATATGTGTGTGTGTATACATATCCA
TACATATATATGTGTATGTATATATACATATAAACACGCACACACATATATTTTCTTCTT
TAAGACAAATCATACAAAAAGTATATAAATAGAAGAAGACATATATCGTCTTCATACAAT
CAAATCATCTTTTATTCTTTCCTGGGGATTAGAGTAAAATGTTACAAATAAGAGAAAATA
CAAAGTGAAAGGAAGTAGCTATTGTGCTGCCAGAACAATCTTCACGAATAATTTTCACTT
CTTCCTAAAGCTTTTCTCTCTATCTTAAAGAGTGGAATTTGAAGGAAAAACGGAAGCAGG
GATGGTTAGAGAGGCCCATGAGAGTATGGGAGTTTTCTTTGCTCAAGTAAATGGATCCCA
AGAAGCTCCAGGACTATTTTCAGTCTGACTAGCATTTGCCACCACTACTTTTACTATTAA
ATTAGAAAGTAATAGTGTCTAACAGGACTGAAATAATGCTGGAGCCTTCCTGGATCTCCC
ATTTTCTTCTCCTGGGGTTTGATCACTTTACTTGTGATGAAGACACACCCCTTCCCACTG
GACTTCTCAGACTGGTTTTCTTTCCCTAAACCCTTGACTTAACTCACCTCTGGAGGTGAT
GAAGGGAAGAAACTCTAGAAGATATGGAGATCACCCACAGAAGTGGGGTATAAATTGTGG
GAAATCTCAGTAAGAGATTCATGGGATTGAGGAAGAGTGAAAATTGTGGAGAAAATATAA
ATTGAGGTAAGATTTTACTATATTTCAGTAGCAAAGCACTAACCTTCAATTTTGGTGGGC
CAAAAATTAACTGCCTTTCTTTGATGGATTGTCCAGCTATAATTCCTTTGGTGGCAGGAA
TTTTTTCTCCAGAGTTTAGCCTTTGCATATTTATACAGAAACAAAGACCTTCCTTTTATG
CTGGTTTCATTTTCTTCTTCTTAATTTAAGAATTCACTCACAACCAAATTATAAAGATTA
AAGTTGGCAGAGGGGGCCGAGTGGTTAAGTTTGAGCGCTCCACTTCGGCGTCCCGGGGTG
TCGCCAGTTCGGATCCTGGGCGCGGACATGGTACTGCTCATCAAGCCATGCTGAGGCGGC
ATCCCACGTGCCACAACCAGAAGGACCCACAACTAAAAATATACAGCTATATACCAGGGG
GCTTTGGAGAGAAAAAGGAAAACTAAAATCTTTGAAAAAAAAGTTGGCAGATATCAGAGT
ACAAAATAACACCTTAATTAGCTTTTGCTTTTTCCTCTCTCACTGTTTTTCCCATATATG
CCTTGGAAAGCCTAATCCATTTATTTATCAAAACATCTGTGATTCCAAGTTGAGAATATA
TGCCCATTAGATTATTTGAGGAAAAAAGAAAAATAAATGAAAAAAGTAAAAATTTTAATA
TAAATAGTGAATATTTTAATATTTTACTAAATAGATATTTAATTTTCTTAGAGAAAGAAA
TCTGGCATTGTAAGGTTTCCTTGAATTCCTTTAATTGTCCAAATCTCCACAGCAGTTATT
TTCAGCAAGTTTACAAAAGAAGCATGGTTTCATTTAAAACATTTTTGATCTGGATTTTGA
AGCTCATTACACACTTGAACTGACACGACTGCTGCTGTAAATTTTTTTTAAATCACATTA
TTGCATTATTCTCAATGATTGTGAGATTATCTCACCATCCTCAGAAATTTGGAACATAAG
AAATGTGATTCATTCTTTGGGTGCAGTAGATAAATGATACCATCTTGCTACCCAGAAGAA
GTAAACTGACAAATTCCTCATCAATTACTAATAGATAAAAATAACATATGAAACCAAATT
TATAGTTTCTTCGATTTGAGAGTCCAGTTTTTTGCTGAATACATTTGTCATCAGTAATAA
AGCATGATATCAAATTTTAAAGTGAGAGATTAACTTGCAAAAACTTGTATTACTCTCATT
AGTATTGATATTTAAGTGATGTTATAGGCAGCCGTATGGCACAAAAAAGGAGCATTTGCA
AAATGAATAGCCTGAAAACCCTAGAAGATTGTTCACTTCTATCTCTGGGACAGTCATAAT
AACAATAATGTAAACTACTAGTAGGCGAGACAATTTATCCTGTACCTTTTTCTAAATTAG
AAGATTAACCTGGGCTTCTAGCTTTTTCTTTCCTTCTGATAGTGACTTCCTCAGTCTCCT
TTGACTTTGATTTGTAGGATGGTTTTTACTTCCACTAGAAGGCAAGCTCAACAACACATC
ATTATATTTATCTTTACTATTGTTTCTAAACACACACACCATACCACAAAAATACTAATA
ACAAGCTAATGATGCTACTTTTCATAGAAACTAATGTAAAGTTTATATCTTGTGATAAAT
ACTCCGTGCCTTAAGAAACCACAGAACATCTATTGTTAACACTTTTTTGGATAATTCCTT
CTCATGCCCTTCTGACCCCTTGACTTGAACATATTCACAATGCAGGCAGTAAATTCAAGC
ATTCAAGAAGTTGCCGCGGTGGTTGATCAGACTGCTCTCCACAGCAGGAACAATAGGCAC
CTTATTTCCTGCTTTCCCATCCTCTCATGACTTCGTTCATGCTTTCAGTTCCTCTGTTAA
TAACAAAGATTTTATTGCCAGGATAATTATTCACCTTTGGAGATTAGAGCAAGCATGAAT
GTCCCGCAGAAGGTGCAGCTGGAAGGACCATCTTATGTCAACTTAAAAACCATGTGATTA
TTACTTCAGAGTTCACCTCTTTGAGTGAGTAGTACTCAATTATATGATTACAGATTTTTA
CGTCAATAAACACAGTGGAGGGTGAAAACACGAAGCTGCTACAAAAGCCTCTTTGGTTAT
GAATACCTTGTAGCACTGTGACTTCTTTACCAATTCCACTAGCAGGTAGCTGTGAAACCT
GTAAGAAAGGCTATGGACATGTATATGCTCCTTGGTTTCCTGAGACATCACTAAGACAGG
AAAGACGACCTGAAAGGCAGCTCTACTGGACAGTCTTCTGTAGGTTAAAAAAAAAGTGCC
AAAGGACTAAGAACACATTTTTCATCAAGAGAGCAAATATAACTCTAGAAAATCCCTCAA
GTAACTAGAGACTTAAAAAAAAAAACCCAAAACTTAGTTCCGCTCTTGAAAGGCTTTTAA
ATTAAAGAAAAAAATAATACTTGTTGACATTCTAAGATCACTACTTTCTTAAAGGCACAA
AAACCTGAAAAATATGCACTGTTATTTTTAAAGTATTGTATTTATGGTAAAATGTCTTTT
ATATTTAAATACTTAATATTTGCTGTTTTATTTACTTTGTTATTTATTCATATTAATAAA
ATTAAAATTAGAAACATTTCTAACTTGTTCAGAGTTTGTCATTATGCAAATCATTGAGTG
TGTAATTCCTTTAAATTGTTTCTTGTGGAGGAACTTATTTTTATTTAAGCTGTTAAAGTT
TTACCATGATCAAAAAATGAAATATCTTAATATAAAATAATGTTTCAATTGGCTATATAT
TTATGTATACATATTTATGCTTAATATTATAGTGTATAAATAAATTAAATAGTTTCATCG
ACTAGCAAAAACTCATAAATTGAACAGTAATCTATAAGTAGAACAGTATTCTATACTATT
CTACTATTTATTTGGACACCAAACTCCCAAGCAGTTAATATTCCAATTGGTGCTAAAATA
GAAATGCTACAATTATCATAGTTTAACACCAGTTTCAAAAAACAAAATATGTAATTAAGT
ATTGTGGATTACCTGCAATTTCTCATAACTACAAGATCTTAACAGTGCTTCTCTAAGAGC
AAAGAAGTTCTTAAATATTTCTAAATGTATCTGCCTTAGCATGTTTGCATTTATAATGGA
AGTTGTGCTGATGACTTTCTGTTTCCTCTTTTATATGTGACTTTGGTTTTATTTTTGTTT
AAAATAGATGGGAGCAAAACTGACTTAGAAGAGGCCATTCTAGGCTTAGCAAATATTTGG
AGTGTGATAAAGCCAAAGCATATAATTTACAATTTTCCACTTCACCTCTGCTTAAGTACT
TTATTAAGGGAAATTCCCTTTATTTTTGAGTAATATAAAATTAAAATGATACTTTTAAGG
GATTTTGAAGTTTGAATAATGCTAATTTTAAGCCTTTTAAAAGCAAACAAATTTTCTGAA
ATTTAATAAATCATATCAAGCTAAGTTTCAAACTCAGAAAGTTTGAATTTGATTCCATAC
AACCAGAACAATGAGTCTTAGGTGGTTCTAACTTAGTAACAATTGTCTTTTCACTATTTA
CCTGTTTCCCAAAATATATCCTTTTTCCTAAAATAAAATATGTCACTTTTCCACACAAAC
CCCTTATTTTTATCAAGAAACCATACATTCGTGGAATGGTTCTCAGCATCACGCCACACT
CATCTCTTTGTAAGTGATCTAAAACTGATGTGAGCCAAGTACAGTTCCTGTTTTAGAGGA
CAAGATCACCCTGACACAGATTGTAAAATTAATACAAAACTTTATATTATGGAAGTAACT
TTTTTCAGTGTTTTATTATGTTTTAGGATGTCTATATACAAATAGTTTAAATGTGAAATT
TAAAAACTTTTTATCGAAATGATGAACACAATAAGACTCTGTTATAAACTGGCATAGGCA
CAGAGTCATGAAATTTCTTCTAAAATGTAATTATTTTTTAAAACCATGCTATTCTACAAC
TAATTGAAAAGATGGGTAATCTTGCATTCCTTATATTGTGCTGAAAATCAGTGTTATATA
TCACTGGTATATGACTGAAATTGGCTGATTTTTTCCCTGAATTGCTTAGTGGTTTCGACT
TTATATGGATACAGACTGAAGAGCCTTGACCTCGTAAAAGACTCCAGAGCAAGCTTGGTT
AGAGACTATACCGTGAAGATCTACACCACCATAATTAACCGTGTAACCTGGACCCTCCAA
AATACTGACACTTGCCCTCGTTACCTAGGCAAGGACATAGAGCTGCTATCTTGACTCGAA
GTAGAACATGTCAGTTTGAAACACGAGGTTATGCCAAAGAGTCAGAGGAAGGTTTTAACG
GGAAAGGTCACGTCAAGGACTTCACAGGTAACTGAAGACCATGGCTGAAGGCGTTAGTGC
TCAGAGCCATGCTTCTTGCATTAGTGTGTCTGTCAGATTACCCCCATGTAATATTGCATT
TGTCAATATTCCCTGAACACTTCAGGCAAATTATCACTGAGATACGTTTTGGGTAAATAA
ATATTGTCATTTTCTCCTCATAATGTGGCTGTCGGTGCCAAAAAAAAGTTTTGCAGTTGA
GTTTTCATTATAAAATGTCATTTGGGGAAGGCAGAAAAGGGAACTACTGGCAAACTATTA
AGAGTTTGTTCCGTGGGAATTCTGATCTCAAAGATGTAGCTTCCAAAGATAATCATTCTA
GAACTGGAGAATTCTTAAGTGGAAAGGGACACTAACAATTTTCTAGTCCAACTCTTTCAC
TTGTCAGGAAAAAATGAAACCCTGAAGGTTAAATGACTTACTGAAGGTCACATAATTTGT
TGCCAAGACAAATCTCCCAAAACAGTGTTTTTTCTTGGCCAGAATTTATGCAAGTTTTCC
ATTTTAATTGTGACATATACTGCCTCGATCTTACGTCTTTTTAAAACATGGAAATTGAAC
ATGATGGTATGAATAAAAACTATTAAGTTAATCTTTCTCCTTGTTTATTTTTAAGCTAGA
AAGGAGAATCAAATGTATAACAATTATGATAGATTTTTCAAAAGAATAGATACTACAGAT
TTGGGGCCCAAGTCTACCCTGGCCTCCAAAATACATGGTTTCTTCACCCTAACTGGACAG
AAATATGCTGAAAGGTTTTTTTCCAGAAAAGGAACATTTGACAACATAAAAATCGTTTAT
TTTGGGATAAGAGAGATATTTTTCCCAAATAATAAGATAAGTATAGCCATCTTGTTTCAA
TAATTTATAATTCAGCCAGGCACAAAGAATGAGGATAATTAACTGTTTCTCTCTTAAAAT
GAGAAGCTGGGGCAGAAGTGGTATGGAATGGGGAAGATACGATAAATCTTAAAAACTCAA
ATGACAAGTTCCTTCTGGCTCGAGTGTAAGACAGGGAAACCACACAAGCCCAGATTGTGC
AATCTGTAGAGACAGTGAGTGATAAAGTGACGTCTCATAGATGAACAGAGACAGCGCGCT
CTTGAATTTACAGGGGAAACCCTGCGTGTGAGCGGGAAAGGAAGGAACATATTTTAGCAT
AATATACAGTTGCATTTAGACCTAAGGAAAGCCTATAAAATGAATTCTGAGCAGTTCTCC
ATGGTAACTTGAATGAGTCCACATTTCAGCTCTGTGTTCTCAACACCCTCTATCTACACT
CACACACGCACACAGTATCTGCCAGCAGGGCCCATGAATTCCTCACGTCCCAGCCGAGCG
CCTGTGCCTCTGAGCTCAAAAAGCCCCTTGCTTGACAGGGGTTAACCGTATCCGGGAGGC
TCTGGAAGAGGTCTGCTGGGCAGTAGGACTGCTGCTGTTGATAAGAGGCCTCTTGTTGGA
TTGGAGACCAGGAGCTGTAGGAAACCCAGAAAAAACAAGGCTCAGATAGGAATAGCAGCA
AAGGCGTCAGCTCCCGAGTACCGGTCACGGACTAAGGAAAGAATTAGGAGTTTCTCTCCG
CTCTGCCAAACCCCACAATTGGGAGAGAACAGACACGTCCCCCAAAATCCCACTCCCAAG
TAAATTTCATTTGCTATTCCATCCTCAAGTGAGAATGAGTCGCTAATTAACTGTAGACGC
AGTTACGCAAGCATAATTGTACACCACTCTGCCGACATACAAAGATGTGTTTTACCTTTA
ATTACTGGAAGAAAATGGGTAGTTTGGAGTTTGAGCACCTAATTGAAGAAAAAAATTAGG
AAATAATAGTCCCTCCCAACATGCACACCACTCCCAATCCACTCTACCTAAAAATCCCTT
GCATTGTGGGTTTTACTTTTCGTTTTAAAAACCATTATTTTAAATTAGGTCTCAAAGAAA
GAAGGTGGCATTTCTTATTCTTTTCAGAGTGGTTTGAGAAATGCTACATCAATGCATCTG
AGAAAAAAATAGAAAAACAAGATCTCTTTTAATTTTGTTTTTGAATCAATACCCGAAATG
ACGACCAGAAGCAAAAATCCACCGGTGCGTCAACAAAGCAGGATGCTCGGCCAGCCAGCT
TCATCCTTCCCCCCTGAGCTGTTCTCCTGTGGGCTCCCCGCCGCAGCTACAGGCCGCTAG
AGCAGATAGATAATGTAGGACAGAATGACCAGGCCTATGATGGCAAAGAACATCAGGATG
AAAATATCCAGCATTGTGGAGTCCTTGGCCGAGGAGGCCTCTGGATTCCCGGGAAATGTG
AGCTGCAAACACAGAGGTTGCAGTTAGTGGAGAGAAATGGCTCCCTCTTCCCTCCACTGC
TCAGCCTGTGTTCTTTTCCCCTCCTCCTCCCAGGGCGGGAGACTCAGGGATGCTGCAGCT
CCATCAGCAGCTTACCTCCTCCCTGCCCTCCCCGCCCCCACACCACAGCCAACCAATCAC
AAAGCCCAGGAGTGGGTAACCAAGGAAGTGTCGGTTTAGACCAGGCAGAACCGAAGAGGC
TCAATTTCTCCCCAGGAACCCAATCCCACCCCTTAGTGTCTAAGTGGAGTCTGCATGATA
CAGACGTAGGAGGAGATCTGATCTCTATCCAGATCCCCTGCGAAGGAATCTTCCTGACGG
CCTTTCTTCTTCCTTTTTCCTCTCACATATCCTTGGCAAATTATCTCAGAAAAACAATGG
TTGGGAGTTGGGTGGGCCATTGGCAAGTTGTAAAGGTCACGTTATGGAGGGATGTGGACA
AAGGTCTCGTATGAGTGTCAGTTGACATCTCTGGGGATGGAGCTAACGCTTATGGGACTC
CTATACTGTGCCAGATATTGCACGTGTGGTGTAATTTCAACCTCCCTACAAGTCTTTATA
GATGAGGCTCAGAGACGGTCAGGAACTTGTCTAACGTTTCATTGGAAATGGCAGAGACCA
TGATTCAAAACTAACTCTGCACACTCCAGAGACCACACTCCACTCTCGCCCCAGACCGGC
CCACCCCACCAGTCTGAGGCGCCCCCCAGCCCTACCTGCTCTGCTCAGTTTGCGATGCGT
TTTGCTCAGAGCACTCCAGTTACAGTGTGAGCACTGGCAGTCTCTCCTCCAGCTAGTCCT
TGTCTCTTTGTGGTCGTTACCCACATTCTTGTTCTCTTTTGTGTCCTCTTCAGAGAGCTC
AGCATGGTGTTACCCAGAGGGCACTAAAGACTTCTCAGGCCCATCCCTGTCCAGTAAGAG
CATCCAGAAATGCAAATTCGGGTGGCCTCTCCTGAGGGGAAAGGGTGGTGGGGACTCAGT
TATGTTTTGTGTGTTTTATGCCTTTTTACGAGTCTTATTTCCTGTTAAATTAAAAATCTC
CCTGTGGCAGTGTCCTTGGCTCCACCCCAAACAGTTCAGGAAGGTGAACGAAGCTTCCCG
GGGAGAAGGGGCTGCAGCTTCACAAAAGGGGGCAGGCCAGCGGGAGGCACAATTTGCCCC
CTCATTCCCTGCTTCTCATTTTCCTCCTGCGAAAATATCAGGCAGGCAGCGCCTTTGGAT
GGGGAGCAGGTGTCAGTATTGTCTTTAATTATCCCACCAGCGCTGCCTCCGACACTCCCT
ACACTGCCCCGCCCTGCTGACTCCGCACATCATTCTGCTGACGACAAAGGCTCACTTCAG
GGAAAGCCAGTTTTTGCTCCTTGAGCTGCTTTCCTGAAGCCAGAGGACGCCTCACTAGGA
ACTGCCCTTCCGCACAGAGCAGCTGGACACAAGGCTGACTGGTGGCATAGAGCTGGGGCA
GAAGGGTCTGGATTCCTTTACCACTGTCCCCTTTCCAACCCCACAGAAGAGGCGAGGCTA
CCTGGCCTTCCGGTCAGAGGCCAGACCCAAGGCACCCGGAGCAAAGTGCACAGCACAGGT
GATACTAACATGAGAGGTGCAAAGGGCTTGGGTGCAAGGCCCCTGGGGCAAGGTCACATC
ACGAGGTTGTGAGCATCACAATGAAGGGCCTAAAACCTCCAGCCCTGCCACTAGCTGCGC
GACTTCCCCCAGACCACTGCCTTTCTGGGTTTCTGTGAACTTCACCTGTAAGATGGACAC
CGCGGTAGTTACTTCTCTCACAAGGCTGTTCATAAGATCAAAGAAAACGTGTGTTAAAGA
TGATCCTAAGGCATTGTGAACACGGCTCTGGGTTGCCAGACCACTCTATAGATGGCTGCA
TCCCGTGTCTTATCCCACGGCAGACTGCCCCAGTCCTGTCATTTCATTCCCCAAACATGT
GCGAGCTCCTGCTAGGTGCAGACACTGGCAGCCAGCTAAAACTGCCCCAAGCTGAGCTTC
TTCATTAATTCAACAACTATTTGCGCGGCAGTGCTGTGCCTGGCCCTGGTCAGGCACTGG
GCATTGAAAGACAAATCAGACCCATTACCTGCCCTGTGAGCGCACTGGCCAGTGGGAAGC
CAGGTGCAGTGAAGGAATTCAGCAGTAAGACTGAAAATATGGGAGCTCAGGGAAGCTTCT
GAGAGTGTCACCAACCCGGGCAGGATGTAGCCAGGAGCAGACTTGGGGGGAGTTCTCAAC
CAGGAGGAAGTAGGTGCCAAGGTCTGGGTCCTTCTCTCCCTGAAGGGCTGGCTGCAGGGC
TCTCAGGAGGGCGACGGGCCACCGCCCCCCAACAGATAAGACAGACAGAGACAGACAGAC
AGACACACACACACACACACCCCCCCACACACACGGCAGCACCTCAGAGCCAGAGCCCCA
AACAGATAAGACACACACACGCACGCGCGTGCGCGCACACACACTCACGGCAGCACCTCA
GAGCCAGAGAGAAAACCAAGTCCACAGGTAAAAATTAGATTTTTATTTGAGTCACCAGGA
GAAAGATTCACTTGTGGTCCAAGTCAAATGTTCAGAGAGATTTGATCCCAAGCACAAGCC
CACGAGGGAGAGGACCAAAACAGACCAAGAAAAGACAACCACCCCATATAAAAGGACGAA
TGGACGGCTTCACACACACGGATGAAATGTTTGGACAGAGGCAAATTTCACATGGTCATT
TCTGTTTCTCTTTAAATACAGGTTTGTGGGGTGGTATTTTTTGTTTCCAGCTATTAAAAA
AAAAAAGGCCCAAAAGTGCATATGTGAGGGGGAAAAGGCAGAAATTAAGCAATAAAGTAG
TTTTCCCTGGAGGGACATGAGGAAGAAAACAGGAAGCAGTGTTGAGAATTTGCTTTTCTC
ACCATTGGGCTTCTTGTATTTTATTACTGGTCCACTAAAGTTATATTCACATTCTAGTTT
TGATGCATCTTCTTTCCTGGGATTAGATTGGCTAAAAGACCTCTGCGAACCATAAGAAAA
GACCAGGGACTCAGCCCAGCCCTCAGGTTCTGTGCTCTTCTAGGGATGGAAGGTTCTGGA
AAGGAACAAGGACTCCCAGCAGCCCCTGGGTCCCTCAGCACCAGTGTGACAGTCCCTTCT
CTCCCTGGGGGTGTGTAAGCAAAGGTCCCCTATTTTAAGGATGGAGGAGTAGAGGGGCTG
GTGGCAAGGTCCCTGTGGCTGGCTTGCTTTATTTCGGATGGAAAATTAAGCTGAGTGAAA
ACAGGCTGCTTCTTGCTCCTCCAGGCCCTCCTCCTGGCCTCTCACTACCCTCCCAACTGC
AGGTCCTCCAACAGGATGTGTCTCTGAACTTTGGTCCCAGAATCAATGTTGTGCTTTGAG
ATCAAGAGGAAACGGAATGACCAGCGCCTCCCACAAGGCTCCCCAAATTGTTCCCTCTCT
GCTCCCTCATCCCCAAATAGCCCAGTATAAGACACTCCACCCGCCCTCACTTCAGCTGGG
GCTGAGGAAAAGGGGCTGGTCAGGCAGGGCTCCTCCTCTGGTCATTTCCTCAACCCTCTG
ATTTGGGGTAAATATTCCCAAGTCAGCTCACAGTGAGGACCTGACTGCTGAATGCGCCTA
CGGGCCCCTCCTCCCCTGCAGGGTACAAGGATGCGAAGATGTCCACTGGGGGCCTGGGTG
GACTCAGGGTGACGACGGGAGGGGGAGACCCAGAGGGGTGACAAGAAAGCCCAGAGATGA
ATGAAGCCAGGCAAGGGTCGTCACAGCCACCACCGAGCAGGAGAAGGGACTTGGAGATAG
CACCATCTTTCCCTTCCTCATCCCGGGGTCTGTGATTCCAGTTTTGTAGCCCTGGGACCC
TCTCCCTCTGCGCCAAGGGGGGCTTTAAGTAAGCGAGGGGGAGGCCTGGGGAGAGAGGCC
CCCAGTGATGCACCACAGTGTGGGTGGCACAGGGGCCTCTAGCCCCTTACTCTGCAGCCC
AAGACAGAGATGGGGGAGGAGAAAGTGCCTGGAGGCACGAAGCTGTCCCCCCACCCCGTA
CTCCAGCAAGTACATCACCAGCCCCCCAACTTCTCAATCATCCCCTTGCTTCTGCCCAGC
ACACTGGGGGCGGGGGCGGGCGGCTTCCTCTATTTAGGGATGGAAGGAAAGGAGGAATTT
TCACTCCAAAGGAACAAGGAACTTCTCTCCCCTAGGGCCCTCCTCTTTCACTGTGGGTTT
TGAGGAAGATATCAGGGGAAGGCAGTTCTGTGCACCCTCACATAAGCCCAGACTCCTGCA
GGCCAGTGCCCTGGCCCCTGCTCTCACACTCAGGCTCACACTCATGCTCACACTAGCCTG
TTGCAAACACACATGCTCCCACCCCACACACTAAGTCCTGGAGATACAGAGGGTCCTGTG
GCTTTGCACAGTTCCAGTCCACTTGGCACCAGGCCGGGGAGGGGAGGCTATAGATGGCCC
GAGACATCTTCCCACAAGCAGTAGGGAGGAGTGGCCCACCTAACTCAGATCTCAGGGGCT
GGGCTGAAGGCCAAGAGGCCTAAGGCTTCCTTGCCCACCTTTCAGAAGCAGCTTCCAGCC
AAGGAGGCCAGCCAGGATCCCTGGAGATCAGGGCTGGGGGGAGGGCAAAGGACTGCGGGA
GAGAAGACCCTGTTCGCCTCCTCCCTGCAGGGGTCCCTAGAGTAAGAAAGGTGAGAACTC
AACCCAAGCCGTGCTCCCGGGGAGCCCCTCGCCCATGCTGCCGTGCGCCGGCAGGCAGGC
AGAATCACAGTGTGAGAAGAAACACGCGAGGGAGGATGCAGGAGTCCCAGGCAGGAGCCT
CACTCTCCTGTGTTGTCCTTGAGAGCAGGAGGCTGTGAGAGACTCCCTGGAGGGCCCGTG
GCCCACCCGAGAAGCAGAGGTGAAGCCCGTCTCACTGGTCCCTACGCCGTGGCAGCCCCC
CACCCGTCCCCAGCTCCAGCCCAAGGGCAAGGACAGTGGGGTCTCACTCCCGGGAATGTA
TGAAGCCCTGCCCTGGGGGCCCTGGGGGTCTGGGGCTCACCCCAGCCCTGGAATGTTTGG
CTGTGTGAGGAGGTGGGCAGGAGGGTCTGAGGGGGCAGAAAAGAGAGAAGGCAGAGGCCT
GGGGGCCAGCGGGTCTCCCATTCCAGACCAGCCTCACCGGCCTCACCCCCCCAGAGAAGT
CCACACCTGTTCCATCCAGAGAGAAAACCGAGAAGCTGGTACAAAGGAAAAACCTGCCCG
AGGAAGGAGCCCGCGAAAGTGGCAGAACAAGGCTTCGGTTGGCAAAAGAAGCTGGAGGAG
GGTAGGAATAAACAAGCTGTCGCAGATTTAAAAAAAACAGACACTGAAGGGTGGACAGGT
CACGCCCAGGACGGATGCGATGCCGGATGCGATGCCGTGGAATGCACTGAAGACAGATGG
GGGCGCGTGGTGCCCGGCGGGCTCAGATGGCTTCCACGTAGTTGGCCGGCAGCATCCCCG
TGTCGCCGGTGCGCTCGACGGTCCCGTACATCCAGCCATCGTCGATCTGCTGCACGTTGA
CGATGGTGTCCCCATCCTGGAAGGAGACCTCGTCCTCGTCGGCGGCACTGTAGTCGTACA
CAGCACGGTACCGCTTCTGCAGGGGTGGGGACACAGTCAGCCCAGGGCCTGGCTCCCCAG
GGGCCTGCGCCTTTCTCTCTGACTCTCTGGGACCCCAGAGCAGGGCCTGGGTGGCAGCGA
ACTAGGACCCAGGAGACAAGAAAGGGCTGGGCTCTGCCACGAATTTTCTCACTTCTGTGT
GTCACTTTCTGAGAGTGATCACGCTTTTTACAATGTTTCTGGCTTCTACTAAGGACCAGG
CACAAGACAGGGACTGAGGTTACAACAGCTCTGCCCCACCTCTCGGAACAAGAATGCTTA
GGTCCAACGGACAAGATGCCGGGCCATGTTTAAAACTATGACATGCCCTGTATGCTAGGG
GCCGGCCCGGTTGGTGTAGTGGTGCCCTTGCCTGTCGGCTCAGGTCCACAGGTTCGGATC
CCAGGCATGGATGTATACCACTCGTCAGCCTATGCTGTGGCAGTGACCCACATATAAAGT
AGAGGAAGACTGCCACAGATGTTAGCTCAGGGCTAATCTTCCTCAAGCAAAAAAGAGGAA
GATTGGCAACAGATGTTGGCTCACGTCTAACATTCCTCAGCAAAGAAAAAAAAAAGGACA
GGCCCTATATGCTATTATCTATATTATTATAAGCATCTGTCTTTTTTTTGAAGCTATGAT
GAGTCTGGCTTCACTCCTAAGTTCAGGACAAAGACCTATTCTTGGGAGAAAAATGAAAAA
CCTCCAGGTGACACAAGAGGTGTCTATCAGGTTCACCTTCCAACCTCGGCCAAAGTCTTA
TGCTTAAGCCCCAGCTCTAGGAAATGTCCCATAAAAGCACATGAAATCCAACAGTGGTCT
TGGAGGCAGGCAAGATTCTAACGTCCTCTGACCCTCACTGCCCTTGACATCAACTTGTCT
CTAGGGGCCAGCTCAGCCTTTGTGGGGCCAGGCCCTGGGACCTGTGTGGGGCCCGGCAGT
GGAGCCCAAGTGCCAACTGGTCCAGGGCTGAACGAGCCCCTCAGGACGCTCCTGGATCCG
CCCCCCGCTCCACCCCACTGCTAGAACCTCTGCTCCGACCTTCTGTTCCGGCCTCTGGTC
GGCCCCCTCCGACAGGTCACCCACGGTGATCTCAGGGGCAACTTTCCAAAATGCAACCTG
ACTGTGTTACTCCCCCGGTTTAAGTCCTTCAGAGGCCCCCATCCTCTTTAGCACTGAATT
CAGACTTTTATCTTCAAGCAGCAGAGATGAGCTCCAGCAGCCCCGAAGGCTGTGGGAGAA
GAGGTCACGCTCCTCATGAAGTGAGTGCGGTCTCTCTCACCACGCACGCTGCCTCTGCCC
CGGCCCGAGTCCGCCATCTGTGCCTGCAGCCTGCACAGCCCCCTCACTCCCCTCCCTGCC
CTCTACCTCCCACTGCTCTTCTCAACCAGCTGCAGAGCAATCCTTTAAAAACCCGTCAAA
CCCATCATGCTGCATAGCTTGCCAGTCACAAAGGCCTTCCTGTGGCCTCTGTGTCCTTGC
CTGACCTGACCTCATCTCCTACCCTTCCCCTCTCTAGTCCCCTCGGCCTTCCTGCTGGTC
CTTGAATTTTCCTACCATATGCCTGCCTCAGGGCCTTTGCAATGGCTGTTCTTGCACCAC
TCACTCCTTCACTTTATTAAGGACTTTGCTGCTCTCTCTCCCCTCACCCTGCTGTCTCTT
TCTTCACAGCACGTGCCATGACCTGGCCTTACATTATATACCTACTTACTTATTGCCTTC
TTATTTGTCTCCCTGACCGGAAGGAAGCTCCAAGAGGGCAGGAAGGTGGTCTTTCATTCA
GAGCCGAATGCCTGCTGTCTGGGACAGGTTTAGTGAGTATCTCAAGGACTGGCTGCTCTA
TCTGGAACCTCATCCTTCGGACGACCTCCCGGGCCAGCCTAGCACCCCAGACAGCACTGA
CACTCCCTCACCTGTGTGTCCAGAGCACGAGGCTCCAGCGGGCCATTTGTCTCAGGCGAT
TTTATTTCTCTGAGGATTGTCTGTCCTGCTCCTACACGAGCTACTGTGAATTCCCAGGTG
CCCGACACAGAGCAGCTGAGCTTGGACGGGAGCTCAGGACGGGCGCCCAGCGCACCCACT
AGTGGGGTGAGTAGCACGACTTATGGACAGGGCACTTCAACTCTAAGGACAGGTAGGCCT
GAGCTGGCCCGCTCCCACTCCCCTCATTCATTTATTCAGCAATGTTGACGAGGGCTGCTC
TGTGCCTAGCTCGGAGCAGGTGACCCCCAAGGGATGCTGCCCTGTCCGCACAGAGCTTCA
AGCCCGGGGGGACACAGACTGAAGTTAACAAACAACAACTGTTTTAAGTTGGAAAAAGTG
CTCTGAAGGAAACCGGGGCTGGGGGAGTGATAGAGACGTCAGGGGACACCACATGACACA
GAGCTGTTTGGGAGGGCCCCTCAGAGGCAGGGCAAGCTGAGATCCTAAGCACACAGGCAG
TCATCCCCATGAAGAGCGGGGAGCAGGGCCCGGGTCTGAAAGGCCCCAAGCAGGAAGGGG
CGTAGTATGCTCCCAGGGAGCTGGAGTCAGGAAATCTGGGCGGTTGTGGGGGTGACTTGC
CCAAGGTAACTCGTCCTGTAACACAGCACCCCGATCCCAGCCTAAGGGTCTGCAGAGACT
GAGATCCATGTCACCTGCGAGTGACAATCTGGGGTCAAGGGTCAGGGGAAGCCATGACCT
CCAGGGGGTTTCTAAGGACAATCTATGAGCTCTGTCCAGTAGGCCCAGCCACCTCTGGCC
TCCTCCGGCCTCCAAACTCCAACCTCTCCCCTCTGGCCAACGCTACTCACCCCGCCCCCG
CCTGGGGTGCTGCGCTGTATGGAGACCGGGGCGGCAGGCTCCTTGTACCCGCCATAAGAC
TGCGCCGCCTGCTGCTGCTGGGGCTGCTGGTAAACTGCGAGAGAGGAGGAGACGGGGCTC
AGACACTGTCTTGCCAAACCTGGCCCTCCCGGAGCCCACCCCTTCCTCCGTGGAGCCCGA
ACAACGTATTTCCACCCCCACGCCCTTGCTCAACCTTCACTTCTCAAAAGCTTATCATAA
GCGCTCATTTGCTGGGGCTGCGGCTCCCCCATCCCCGGGGGGCCCAGCACAGGCCTGACC
CGATGGGGCCCGAGGGTGTGTGTGTGTGTGTCTGTATGTGTAAATGAGGCTTCCTCCACC
CTGAAGCTGGCCTGGCCTCAGGTCCCCTGCCCCCACAGGCCTCACGCTCACCTGGGGCGC
TGGTCGGGATGTGGTGAGGTGGCTGCTGCTGCTCCTGGGGCCGCCGGTAGCTGCCGCTGC
CCTGGGAATCTCGGCGCTCGGGCTCCAGGCCCTCGCCCCCGCTGGGGCCCATGCGGCTCT
TCTCAAACTCCTCGTGGTACTTGATCTACAGGGGCAGAGAGCGCTCGGTGAAGGACTCAC
AGCAAACCAGGCAAAGCTCCCCTCCTGTTGCCACTCAAGATCCGGATGGGAGAGAGTCCT
GGAGGGCTCCAGACAGAGAGCCGGGTTCTCATCCGGGGGCTCACCAGCTGTGTGCCCTTG
GGCAAGCTACTTAACCTTGCCCAGCCTCAGTTGCCACCTCTGTAAAGTGGGACACTGGTG
TCTACCTCAGGTGTTGCTGGAAGAGGCAGTGAGATGACGATGTACAAGATCCATGCAAAT
GAAAGCACCAGACAAAGGTGAGCAGTCATTCTTCTGCACCCGCGGCAGGGGCTGGGGGCT
GCCCTGTTCTGCCCGTCAACAGCAGCAGGAGCAGCGACTCCTGTTTACCCAGCACCTCCG
AGGTGCCAGGCACTGTGCCGGGAGTGCCACATCCCGGCTCATTTTACTTCATCAGCACCT
ATGGGGGGGCACATTACAGTCCCCATTTCACAGACAAGACGGAAACTAAGGCGCTGACAA
GCAAAGTGAGCTGCCCAAGGTCACGCAGATTCCGGAGCCCACCCTCTAATGGTTGGGCGC
TTCTGTCTCTTGTGGGCATGACCTCACAGAGACCAGAGCCCGGGGCCCAGCGACGCTCTG
CTGAGGACTCCAGCACCCCGGGACAAGAAATGCCGGGCCCTCCCTGTGGGTGGGTCGTTA
TCTTTGAGATGGGTTCCTTCTCTTGTCAGGTTCCAAAAATGGGCAAAAAGAGACCCAAGG
AAGTCACACACCCCAGGCGCTCAGCAAGGACTGGTTGAGTTGAACAGATCAGGACCCTGG
AGACCTTCCAGCGTGGCATTTCTTAAAATCTGTTCTTCAGATTGTCTGCTTCCTACCCAC
CTGAGCTGCTTATGAGAATGCAGGTTCCAGGGCCTCCCACAGAATCTACAACATCAGGGC
TGGGGTTCTGGAATAACCTAGCATTTTTGAAAAGCTCCCCAGGTAAGTCCAGAGCCGCCT
CCGGAGCAGAGGTTGGCAAACTGAGGGCCCTGGGCTCACGAGCCAAGAATGATTTCTACA
TTTTTTTAATGTTTGGGGGAGGGGGGTGGAAATCAAGAGGAATTCTCTTTTGTGACCCAT
GAAATTTCTATGAAATTCAGATTTCAGTATCCACAAATGAAGTTTTACTGGAATGCAGCC
ACACCCACTTGTTTACCTATGGCTGCTCTTCCATTCCAATTGCAGAGCTGAACAGCTGGA
ACAGAGGCCCTGCGGTCCACACAGCCTAAAATGCGTGCTATCTGGCCCTTTACAGAAAAC
GTCTGCTGACCCCCGCTTGCCAAAATACTCTGCACACTCTGATGGTAAAATATATTTTAG
CACAATCTTCCCAAATTAGACCTATTTTATAAATTACATAAATGTATCACTTTATAAATA
TAGAATGTACACTGTAAAACTTACACAAAAAATATGAATTAAAAAAAGGTTGAGGGGCCG
GCCCCATGGCACAGCAGTTAAGTTGGCACGTTCTGCTTTGGCGGCCTGGGGTTCGCCAGT
TCAGATCCCAGGTGCGGACCTATGCACAGCTTATCGAGCCATGCTGCGGCAGGCATCCAC
AGCATAAAATAGAGGAAGATGGGCATGGATGTTACGTCAGAGCCAATCTTCCTCAGCAAA
AAAGAGGAGAATTGGCAGTAGATGTTTGCTCAGAGCTAACCTTCCTCAAAAAAAAAAAAA
AAAAAAAATGCTGAGATGACAAAGAACCAGAGCCTGGAGTTCTAAGGTTTTTCTCTGCAT
TCTCTGCACTCTCAGGGGCACATAATGCCCATACCCCACCTTGAAGAGCTCTGGCGGGGT
CTACTCACTTTTCACTGGTGGGGAAGGGAGCAACCCAAGAAAGGTGCGGAGGCCATGGTT
TGGGTGTTCTAGAAGTGCTGGGCTGGCGGAGGGTAGGGGAGGAGGAAACTCGGAAAGCAG
GACCCTGAAGGAAACTGTCCTGTCCCAGGCAGGCCCAGGCCCTGCTTCTCTCCAGGCCTC
AGACCACCTGACTTGAAGCTGGCTCTCACTTCCTGTCTGCCGGGATCCTGCCTTGCAAGT
CTCCCAGTGGAATCAGCGTGGGAGTAAGGGTGAGGGACAGGAGACGGCAAGGCCCGTCCT
GCTTCCTGGAGCAGAAGGAAGCAGTGATCCTGTGCTCTGGAAGCCCCTGGCCCAGGTCTG
ACCAGCACTGTCCCAACCCAAAGCAGGACCCTTCGGCCATCCACTCCCACTTCTCTGCTG
CCTTCTCTCCCGCTCCCGGGCATTCGCTTTGCAAGGAGGGCAAGAGTTCACACTAGGCTG
GGCAGGGCTTCCACATTAGTAGCTGGGCTAAAGGTCTGCAGGCGTGGCCACTGGAACACC
TGCATCACCTCTGCTGGCTGGATGATGGTTCCTCACTGCAGCCTGGGCGGGAGCACAGGC
AGGGCAGCAGCAAAGTCCAGGACGGGACCAGACTGGTGGCAGAGAAGCACCTCACTTTGG
GGTTTGGATCAGGACCAGCCCCCTCCTCTCCCTGTTCCTTCCCTTCAAGCCCAAGCAGGG
ACCCACACCCAAATGGTGAAGCAGGCTGAGCCTGTTCCTGAGGGGGAGGCAGCCAGTCCT
GGCCAGACTGAAAACGCACTGGACTCCCCAACTCCCACTCAGAAGGGCACCCAGGGGTGG
AGTTCTCAGACACAGGGCCAGTGTCCCGCTCTCAGATTCCTAAGACAAGGGCATAAAGTC
GGTCTCCTTCAGTGACCCCCATCCACCGGTGAGTGTGGGAGGACAAGGAGAGGGGACATC
TCTCCTGAGGCTTCCAGGCTCACAAGGCAACCGCCCTTCCAACTTTTGTCTTGAGGTGGC
AAAGGTCAGCTTCCCGTGTTTACTTTCTGCTAATGAAGAGGGCTGACCCCAGGAGCCGGT
GACCGGAGGAGGGACAGTGCATATGAGGAGGTGGACAGAGGCCTGCACTGGGGGCCCAGC
TACCCTGAGTGACAGCCCCCTTCTCTGGGTGTGACTCTATCTGCATTAGTGATCGGGTGA
TCGCCTATCTGGGTCCCAGGGTGCTATCCTCTGGCAACGTCCTACAGACTCAGTCTTTCA
TCACGGGCTGCAGCATCCCTCCCATGCCTCGTCCCTGGGAGATAATGAGCCCTTCACTCA
CTCAGGTGACCTTGGGAGAGTCCCCTTCCCTCTGGGCCTCAGTTTCCTCATGTGCAAATG
AGGCCATAGCACCATTTGCTCCCAGGTGGCCCTGAGGCTCCTGACCAGCTCTAGGAACCT
AACCAAACTCTAGAATTGAAAGCAAGTATGGACACGCCACTACATGTGGATAAATATTTA
AAACTAGGGCCAGGTGACTGGGGTGAATGGTCCAGTGGCAGCCGAAACACAAAAGAACCC
TCCCCATCACCAATGCAGGTACCACCTGTTGTTATTATTAATAATCTTCATCTTTGCTCA
ACTCTTCACATTAAGTTCATAAAGGCTCTTTGCACATTACCTCCCTTGTCCCTGATAATA
ATCACCCTAAAAAATAAGCTGGACAAGTACATTTCAATTCCCATTTTACAGAAGAAGGAA
ATGAGGCTCAGAAGTTAAACGACTTCCAGAGGCAGAGCTTCCATTGCTCAGTAAGGGCCG
AGGCTGGTCACACAAGGACAGAGTCACAGCTGGACGGGCCTTTCCTGAGGGCAGATGTGG
AGCAGGGTGACCACGTTCCTAGGCTGAGTTCATGTTGTTTGTTCTGAATAAATATGAACA
GCACCCTTTTCACTCTCCAACAGGCACATTAAAGGGTGTTAGCACATCCGAAAGACAGAG
AAAGATCTTCCAGACTCCAAGGGCCTAGCTGATCCCTGCTCCAAGCTCACCCAAGTCTGA
TCTTCTAAGTGCCCTGAACAGGAGTCACCATGGCCCAAAACTGTCAGCAGAGCCCCAGCT
TAAGAACGGTCCTGGGTCCCCATGCAAGGATGTCACACTCTGTGCCCATGAGATCTAAGC
GCACGTGGTGGGTTGAGGGCCCAGGCCTAAGGACCCTCCGCAAACATCCAGGCCCCTGCT
AGCCAGGACTCCAGGTCCATGCCACAGCTAAAGAAAACACATTTTCTCTGCTAGCTGCTG
TCCTGCTTTCTAAACCCCCAGCTCCCCTGATTGTGGTGGAAAACAACAGTCTGACTCTCC
ACACGACGCTCTCACATGATTCTACGTCACAGCTAATGGGTGAGCATCAAGCTTTCAGTG
GAATAATCAACTCACTGGACAGAGTCTATTTTTCACAACAATGTGTCCCATTTGCTGAGG
GCCTATTTTGTGCCCTGACAGGCATTACTCATTTCCTTTCCTCAGTCAGCCCGAGAACAG
CGTACCATCATCATCCCCACTTTACAGATGGGGAAGCCAAGGCTCAGGGGGTGGGGAAGT
GGTGGGTAAGGCAGAATCCAGGCCTAACATCAGATCCTTAGTCCTCAACCACCAGGATGT
ACTGCTCCCTATTAAGAGACTAACAGGGGCAGCCCCGTGGCCGAGTGGTGAAGTTCGCGG
GGGCTGCTTCAGCGGCCCGGGGTTTCGCTGGTTCGGATCCTGGGCGCGGACATGGCACCG
CTCATCAGGCCATGCTGAGGCGGCGTCCCACATAAGAGAGCCAGAGGCACTCACAACTAG
AATATACAACTGTGTACTGGGGGGCTTTGGGGAGAAGAAGAAGAAGCAAAAAAAAAAAAA
GATTGGCAACAGATAGCTCAAGTGCCAATCTAAAAAAAAAAAAACCCATTTGTTTTTTTT
AAAAAACAAGAGACTAAGAATATTTTGTTTTTAAAATAAATGTAAATCTGTCCTCAACTT
CATTAGTTATCAGAGCAATGCAAGTTAAAACCACAATGAGATACCATGACACGCAGTCAA
AAATGGCTGTGAGGAACAAGCCTAAGGACGTAGAGCGACAGGACCTCTCGTCTCTGCTGG
CAGAGGGTAACCAGCACAGCCACTGGGAACATAGTTCAGCATTATCTGGTAAGGTTGAAG
GAACACACACTCTGAGACCCAGCAACTCCACTCCACATTAATACTAGGAAATATGTATGA
GGATGTCCATAGCACGTGGGAGCAATCCAAACGTCCATCTGCACCAGAATCAATAAAATG
CAGTATAAGCATTAAACGGAATACTATACAGCAACAGAAAAGAATGAACTACAGCTACAT
GTAAACACGGAGATGAATCTTTAAACCCAATGTTGCCCAAAAGGAAGCAAGACACAAAAG
AATACATACTACACGTTCAAAATCAGGAAAAACAAAACTATAGTGTTCAGAAATGCACAG
TGACATACGAAAAGAACAACACAAGCTTTCAAAAATTAAACTTCAGGGTTGGCCAACAAG
CCTGCCTTCAGGCCATTTGACTCTGGGGATGGAATTTTGTTTGGCTTCACCCTTTACTAC
TGATTAGGCCCAGACTCAAAGACTGAAGCTAACTTAAGGAATATATGCTAATTATTTTTG
ACTGACAGAAACGCAAAGGATTTCTGCCTATAGCAAGCATATCGCCAGAGTTTATGACTT
TATGGTCCTGTAGGACATTAACCAGTTCTGTATCTAACTATATCCAGCACTTTCTTTCAC
TGACTAGACATCACCTCTGCCTGTTGCATCCTCCCGCTGGTTCCTGATAATTAAGTTACA
TATGACAGGGGCTCACTACATCAGAGTTAGGTTTTAACACTTTGGAAACTCTGTTTTGAC
CGCGGTGCAGTAATGTTCTCCTTCTTGACTTGCATGGTGAGTGCGCAGGTGTTCACTGTA
TGTGTTACTGGGTGTTATGTCTCACAGAAAAAGTGAACCGACTCAAAATTATATACAGAA
AATCAACATATAAGTAAACATGTTGGTAAATAAAGGCAGAGCTTCTCTACTTGAAGACAG
TAGCCCCCTTAAGGCAGCCTCAGCAATTAAAGTTTCCGGCCATCACAGCCATGGGAGCTC
CTGACTGGAGGCCAGGATGCCAAAGGGGTAAACTTCACCCCAGAGCGTGTGGCCTTGTCT
TCTCACCCCTTTGATGCCTTTAATGAAGACACAATTACCACAGGTGTGTAACTTACAAGG
ATCTTGCTTCCAAACTTTCTACACATTCTCAGTACTAGACAATGGCCACACTTCACCAAA
CTTACTCCACGTCCCTCCTTCAGCCACAGTTAGAAAGCAGACAGGTCTGCCTTTAAAGTA
ACAATCATGGAAACCATTTATCAAATGCCAAGCACCTGACATTTTCCTCGCAAGCATGTT
TTACGGTACAGCCGAGGGTCCTCGTTTTTACAGATGAGGAAACCGAGGCTGAGCGAGGCC
CACCCAATCGCTGAAGGACAGAGGCTGGGATCCCTCCAGTCACTGGCTCTACCCGCTCAC
CATCTCACCTCTGGGCAGGACTGAGGACAGATCACAGACACCCAGTGCGCTGAAACACCA
CCCAGGGAGACCAGATGCTTGTTTTTAAATATTAAAAAAAAAATTTTTTTTTGAGGAAGA
TTAGCCCTGAGCTAACTGCTGCCAATCCTCCTCTTTTTGCTGAGGAAGACTGGCCCTGAG
CTAACATCTGTGCCCATCTTCCTCCACTTTATACGTGGGACGCCTACCACAGCATGGCTT
GTCAAGCGATGCCATGTCCACACCCAGGATCCGAAGCAGAGAACCCCGGGCTGCCGAGAA
GCAGAACGTGCGCACTTAACCGCTGCGCCACCAGGCCGGCCCCAGACACTTGTTTCTAAA
ATGCTCTCGCTGGTAAACCCTCTAGTCTGCGGCATATTCCTCCAGGGAGGCAAACCTTCA
TCTCTTTGCAGGATGGTCTGACCTCTGGGAACTGCCAGGAGTCATTTGGTGCTAACCTGG
GAAGTGAGTGACAAGCTACATACAGGAACACTATTTTGGACACAAAACAAAAAGAGTGGC
TCTCAGCACCATCTTTCCCACAACGGTTCTGGAGGTGGGACAATTTAATGGCTCTCAGTG
TGGTTTAAATTTCCCTGGGGGTTCTGGGGTGCGGCCAGGCCTGGCGCCTCTCACTCAGGG
CTTGGGGAAGCTTTTTCGGACTCTTAGGTGATGATTCTCAAACTTCAGTGAGCACCACAG
CGACCCAGGGAATGTGTTTAAAATGCTGGTTCCTGGGCCACCCTCCCAGAGATGCTGATT
CAGGTGGCCTGGGGAGGAGGCCTGCGAGCCCACAGGTTCAATAAACCTTCCCCAGCGATT
CTAGTCCAGTCGTTTGGAGGCCCGCGTTTGACAGACTAACTGCGTTCACTAAACCCGAGC
CTTCCAGCTTTGTGGTCACACCTCACAGGCCCGAGCTGAAGCTGCAAAAGCAGAAGCAGG
TCAGGTTCAAGCCACCTCCCCCATCTCCCAGCAGAGGACAATCAGCTAATTGCAGCCCTG
TGGTTAAGGAGAAGATGCTTATCTCCGGAGGTGTGGATGTCTCAGCCGCACTGAGTTCTG
TTACTAGGGCTCCTCAGACAACCCCTCCAATAACCAGTGCGGGGGAGGGAAGAAGAGTGG
GTGCAATAGGCTGGAAGTGGAGTATTCTGGAAGCCTTCCTGAAAGGGAGGCAGGGATGAC
TGGGTTTGCTTGTCTCCTCCCCCTCTAAAACCCACAGGCTGGAAGCAACGAGCGAATGTA
GGGGTATTGGCATGGTAGGCGGGGAGCAAGCATCCGATAAAAGGCAAGTCTTCACAGTAA
AAAGCCACAGAGGCGGAAGAGTCAAGATCCCACTTGTGAGCCATCCCAGGTTCTCCCCAT
CACCCAAGGCCTCCCCTCCCTCCCTTCCTGCAGACACACACCTCTAAGGTCCTCCAAGAC
ACAGCACGTCCTTTACCCCTTCTTTACCCCTGGGAGGTCTGGGCAACATGGGGGAAGCTC
CAGGGGTGAGGCCAGGCCCAGGCTGATGAAGAAGCAACTGAGACAGGCTTTTGTTTGGTG
GGGGAGAAGGATTACAGCCCTCAGGGACATGTCCTCCCAGCCCAAGGGAAGCACTCCATT
TCCTCAAGCAACACATTTCAAACTGCGGGTCAACAACCTGGTTGTGTAACGGGTAAACAA
CCGTTTAGCTGAGGCTCAACCAGCATCTTTACAAAACAAAACACAACAGAAAATATCTGA
ATGCACTCCAAGTAGTAGGGACTCCTTCACCAAAGTTTTGATCCTGTTTTCTCTCTAAGT
GAACAAACACGCCTGTTTCGGGGGTCCTGGTGTAAAATGTATTTCACATTGTCGGTTGCA
GTCAAAGTTCGACAGCCACAGACTGGGCCATGGCTGGTTCTACTGGCTTGGGCCCTGGCT
CACGAAACCCCCCTGAGCCACTGCTGGAATCCACTCTAAGCAGAGCCCAGCCAACTTCTA
GAAGGAGCACCCTACCAAGGAGGCTGGGTGGAGGGGTGGGGAGGGATGTGGAGCCCAGGG
GGCAGATGCCAGGTGGGCTACCTGAAACCCAGGCCCTCTCCCAGCCTCCATCCCGAGTCC
CTGAGCTCAGAGTGACACTGCGCAACTCACCAACCCCTTCTTGTTACCAATATGAAGACA
ACCGCTTGCCTAATCCTTCATTTGTAGGACCTCATAGCCCAGGCTGGTTGGGCACACCTT
GCCGCTCTGTGCCCAGGACCCATCCTCTGGCCTGTGGCCCATATCCTGTGCTTGTGGCTC
ACAGCAGTGCCCTGCCCCCACATACCCGAACCCTCTAGGCAGCCTCCCCACAAGCCCAGA
GCCACAAGGCTGCTGATCTGTGGCTCTGCCAAGCAGGAAATCAAGGCCTATTCCCTGGCC
ACAGGTGCCATGGGGCCTGTGGATCCAGCAGCCACTCTCCACACCCAGCCCTGCCACAGC
CAGTGCTGACTGTCCTGGGCCCAGGAGGGCCCAGGCCAGGGCGTGCGGGGCCAGCGGGCA
AAGCTGGCTGGGGTTTTTACACAGGAAGGAAGAGCAAGCGAGGTGGGGGAGGAGGCTGGG
GGAGGGCGGAAATGACTACAAGTCAGCACCCAGAGGCAGACAAGGGGGAGGCCAGCCCCT
CCCCACCTCTGCCACCCAGTTTTGACCTTTCTGCTCAGACAAAACAGCCAGTCTGGACCC
TAACACCCACCATAACCAGGAAAAAAAAAACTTCAGAGAGTGGGGGAGGTTGATTCGGCA
CATAAGACCCTCCCTGCACCCCCCCCAAAAGTACAGTCCTTTCAAGGTGGAAATGCCATG
TGGGCGGAGGGTGGCAAAGGGGAGTCCGGGGGTGCACAGAGAAAGGCATGTGGGAACTCC
AAACCCTTCCCTTCCCTCTGCTCAAGCAGCTGCCAGCCAGGCCCGCCCAGGAGAGCAGGG
CCACAGAGAACTGGGAACTGGCCTCGTTCATGTCTGCCAGACTGGCAGGGAGGCAACGGG
AAGGGAGGGCAGTGGTCAACGTGGGAAGCACGGGGAGCAGGGGCACTTACGTTGCTGATC
TGGTCCTGGGTCTTCTTGATTCTCTGGAGTTCGGGCGTGTCCGCCACCACGCTGAAGCCT
TTGCCCTTGTTCTTCTCAAACTCCTCCTTATAGCGCACCTGGAGGGCCGAGGAGGGGGCT
GGAGTCAAGCCAGCAGGAGCAGAGGGGGCCCCGGCCTGTGGCCACCTCTGAGGCAGCAAC
TGGCCAGGAGAGAGACCCTGACGGAAATCCCCCCTGTAGGGACATCCACTTCCCAGCTCA
AAGCAGAAGCCTTGGCCAAAAAGAGTCAGACTAATAATAATAACCCACGAGTATGTATAC
AGTACAATGGGAGTGGCAGGCCCCACACCAGATGCTTTACACACACTGTCCCATTTGAGT
CTTACTATACACCATCATTAGCTCCATTTTACAGAAAAGGACACTGAGCCACAGAGGGAC
AAAGTCTCATGCTCAAGGTCACACAGCTTAGCAGCCAAGGTCCAGAGCCCCAGGATGCAA
ACCCTTGCCTGCCTAACTCCTGATCCCTCCCCGCCGGCCCATCCTGCCTGAAAGCTATAG
GAAGAAGATTCTTTCCAGAGCTCCAAAGACCGCCCGGCCCTCACCCTAGGCAGGATGCAG
CCCTACCCGCGGAGAGGCCGGGGGAGTTTCTAAGCGACCAGCTGAGTGAGAGCTGTGCCA
AGGGACAAAGTTGGCGTCCAGAAAGGAGGGCGGTGAGACAGCCATTCTGAAAACTCAATC
AATGAGCCTTTGACAGGCCCCAGTGGCTTCCTGGAGCCTGCCAGGCCAGCTTCTGAGGTC
AACGCCACGGGAGGGGATGAAATTGGTGGGGGACAGACAGCACTTCAGAACAGGGTTCCA
AGCTCAGGGGAAAGGCCCTGCCACCCTACCACTGCCCGTCTCTTCCGAGAATTCCACCGA
AACTCGAGTACTCAAGTCAGACATCAGAAAGGACTTCTGAACTCTAAAGAAACTGAAATA
CGAGGACTGTCTTGTCCTCCCCTAGGTGTTCTGAAGAACAGAATGGAGGCTGGAAATGCC
CATGAGACAGAGAAATGTTCCTTGGCTTCCAGAGCCTTCACTGTCCACCTCGGCAGCCAG
CTGTTCCAAACCCCACCAGCTGCCTGGATTTCCTCCATGGGGGCTGCACTGTCCTGGAAG
CAGGTCAGCCCAGGACATGAGGCCTGGGACCTTGGGAATTTCCAGGATGACAAGCCCAGG
CAGCTCCCAGGCATGGAAGCATCTGGCCGCAGCGCTGAGCTGTACTCTGACCCGACCGAC
AGCACACACGAACGTAGCCATGGCCACACCTGTCAGTTCCTCTGTACATTGCCAGGGGTC
AGGGGTCCTTGTTCATCCCCTGGAGCCTTGGCTCACCCATCCATGGGGTTCTTCTTCCTA
AAAGGTTCCAGAACCTCCTTTGTTCTGATCCAGACTAAAAACAAAGGCCTGGATGTGCCA
GTTCCCACCAGACCAGAAGTTAACACAGTGGGTACAGGTACCAACCCACCCAAGGGCCCA
GGACAGCCCAGCATCAGCTCTTCCAGGAAGGCCTGGCCAGCAGGCGACAATTAGTGTTGG
GGGGAACCCTGGGAAGGGGGCATCAGGGAAGGCAAGGCACTTAGAAGCAAAAATACGGAG
CTCCAGATGCAGAAGCCCCAAATCCAAAACCTCCCACCTAGGTTTCCTCAACTGTAAAAC
GGTTGCCATAAGAATCAGTTAAAATATGGGGAGGGGGCTTCCTATCACCAAGCATGGGCA
AAGAGCCAGAGGGAGCTGGTACTAAGCCAGGCTCAGTCTCCCCGGAGACCCTTGCTAAGC
GATCTTGGGCCAATAATGTAATCTCTCAGGCCTCAGCTTCCACATCTGTAAAATGGGGAT
CACAGTACCACCCATTCCAATCAATGGTGCAGACTTCAGCAGCTCTGAAGCAGCACACGG
CAGGGCTCAGCATGTACCGATGCCCAAGTGTGAAAGTGCTCTGTCAACACTAAAGTGCTG
AAGAACTGCCAGTCTCCACTCCTTCCTCCACTTCCTGGCCTCGAAGGGTCAGGCCCCTAA
TCCAGGGGAATAATCACCATGGCAACACTGCAATGACATCAGCTGGTTCCCAGGCTCAGG
AGCTGCCTCTCCCTCCCTGCTGGGGAAGGATAACTCATGCCACTCCTGGCACAGGGGGCC
CAGAGACGGCAGGGCGGAGCTGGGTGGAGTGGGGCCGAGAAAGGGTGGGAGCCTGGGCTC
AGCACCACTTTGCTGTGTGTCCCTAGGCAAGTCAGTCTCCTTCTCTGGGTCCCCTGATCA
GCAGGCTTTTCAGCTATCTCTAAAAGCCCTCCCAGCTCTGGAGTTGGTGACCATTTTTAA
GCACCTGCAGGCCCTCATTATGGAGAATCTAGGTGGGGAGGACTCTCGAGAGGCCGTTTG
GTGCTGGAGCAGGTGGCAGGGGTAAAGGGTGAGGAGCCAGGAGCGTGGGAAGGGCCCTGC
CCAGAGTCCCTCCAACAGGGCTCCCTTGTCACCCAAGCAGGAGTGTTGGCCCTCATGTGG
GATAGCTCACCAGGAAGTGACAGGGGTCTCTGAGGCGGGAAGGGACCTGCCCAAGGTCAC
TCAACCCAGTTGTTGGTAGGGTCTGGGTGCAACTCAGCGCTGTGGTCGGACGACTCCCTG
CCTGGGAGCTGCCTGGGCCTCCACCCTGGACGCGCCCAAGGCAGGGCCAGGACTGACACC
TGAGGGTCCTCAGGCCCAAACCACCCTGGCCAACAAAACTCTCCTTTTTATATGTAGATC
TATTAATTATTCTCCCTGGATCTCTCCTGTTTGTCAAGCAACCCAGCAAACAGCAGGTAC
AAATAAGTATTTACTGGGCAAACGATGAATGAATTGAAGAGACAAAATCCCCAAACAAAC
AGGCGGCAGAATTTGGAAAATAACTGCCTCGCTGACCCAAGAGAAGCGGGAAAGGTCATG
GCTTTAAAAAAAATAAATTATTGAAAAAAAAATACTATACCAACAATTTCCACTTATTAG
TGCCTACTATGTGCTGGGCCCACATACTAGGTAACCTGCCCCTTCTACCAAACAAGAAAT
CAGTTTTACAATTAGACACACGCAGATGGGGAGAAGAGCTAATGAAAATGGCCAGTTCTG
GGAGCCATCATCAAAAGGTCCATTCCTCATATGGCCAATAGACACATGAAAAGATGTTCA
TCATCGCTAATCATCAGGGAAATGCAAATCAAAACTATGCTAAGATATCACCTTACCCCC
GTTAGATTGGCAAAAACATCCAAAACCAAGAGCGACAAATGTTGGAGAGGTTGTGGAGAA
AAAGGAACCCTCATACACTGTTGGTGGGAATGCAAACTGGTACAGCCACTATGGAAAACA
GTATGGAGATTTCTCAAAAAGTTAAAAATAGAAATACCCTATGACCCAGCCATCCCATTA
CTGGGTATCTATCCTAAGAACCTGAAATCAGAAATCTCAAGAGTCCGTTGCACCCCTATG
TTCATCGCAGCATTATTTACAATAGCCAAGACGTGGAACCAACCTACATGCCCAGAAACT
GATGATTGGATAAAGAAGATGTGGTATATATACACAATGGAATACTACTCAGCCATAAAA
AAAGACAAAATTGGCCCATTCACAGCAACGTGGATGGACCTCGAGGGTATTATGTTAAGC
GAAATAAGCCAGTCAGAGAAAGACGAACTCTATATGACTCCACTCATAGGTGGAAGTTAG
TATATTGATAAGGAGATCTGATCAGTGGTTATCAGGGAAAAGGGGGGGTGGGGGGAGGGC
ACAAAGGGGGAAGTGGTGTACCCACAACATGACTAACAAAAATGTACAACTGAAATCTCA
CAAGGTTGTAATCTATCATAACATTAATAAAAAAAAAAAAGGTCCATTCCTCAGCTTCAT
CATGCCCAAGTTGCATTTCCTCTCCTTTCCAGAAGAACAGCAATAGCAAACATTTATTGG
GTGCCAGCTCTATGTCAGGAACTGTTCTAAATGCCTCATATATACTAACATCCTCACAAC
CCTTGGAGAGAGGTAATCCCCACTTTACAGATGAAGCATTAAGGCTCAGGGAGGTTAAAT
AACTTGCCCAAGGTCACACAGCTAGTGGTGGCAGATCTAGGATTTGACCTTCAGCCAGCT
CAGGCAAGAGTGACATGCGTATGCCTTGCTGGTCACAGGATCCAAGATAGGAGAACGGGA
ACTCTGTCGCAGGGCATGGCGCGGGGCTCTGCTGCACTGTCCTGTCCCCTGTGGCATTTC
CCACACCGTGCTGGGACAGCACAGGACGGTAGAGGTGTGACGATGAGGGAAAAAATGAAA
AGGAACCTTCTCCTTGCACTTCTGCCTGAGCTGAGGGGGCTGCACAGACACCCCCAGCTC
AGCCCCAGCCCAAAGCTGCTGCATCTACTCAGCCTGGGGCTGGGGGGTGGTGTGGGACAG
CTGCAGGGTGGGGGTGGGGGGGGGTGGCGGGCAGCTGGGCCCCAGCTGTCAGTTCCCTGG
CTCAGCCAGGCCTGGGCAGGACCACCCAGAGGGTCATTTCTGGTCAGCGCTGTGGTTACC
TCCCCCCCAGGGGAGGTTCCAGGTGTCCCAGACACCCAAAGTACCATTTTGGGAACCAAT
CTAGAGATAGGAAAACAAAGTTGAAATAGCACAGGCAGCTTCCCAGAGACTGAGAGGGGC
TGAGCCGCATGATGCAGGCCCAGGAGGGGACCCTGGAAAGACAGCAGCCAACGCCCTGTG
GGTGGGGCAGGGCGGCAGACGGGCTCCCACTTCCCTTCCTGCCAGCACAGGCGGCTCCAG
CCGGCCCTGCCCCCACAGGGGCCTCAGGAACCAGAACCTGTCACCACCCCCAGCCAGGCC
CACTCAGCCCTTCCAAGCCTCAGAGCATCGGGCCCAGCCCCAGCCCTCCAGGCAGCTGGG
CTTGCTGTCCCCATTTTACCAGGAGGAGAGACACTGCAAGGCGGGTGGTCAGGCGTAGAC
CGCACAGCTTGGGGAGGCGATGGGAGGCAAAACCAGGCCTGCAGGTGGGCAGGGCCCCTG
CCTCTGCTGTCAGCCTACCCCAGCCCCAGCCCCAAGGAGTCCGGGGTCCCACCAACAACT
GCCAACCAAAAGCCCCTTGGTGGAGACTGCCTTCTACAAGCCCCCAGACCCACTGGTGAT
GTGTGCACCTGCGGCCCGAGAGCCAGGGCTTGGTGCTGTGGCTGCAGAACCGTAAGAACC
AAGGGCTGACGTCCGCCTCAGGGCAAGTGGCGTGGCCTCTAAACCTCAGTGTCCCCCTCT
GCACAACGGGGATAACCATGTCCTCCTTCCTCAGGAGGATGTGAGGCTTCACTGAGGTCA
GGGCCTGGCCCTGAGTGAGGACCTAAGGAAGAGTGACTGCCACCGTCATGATGTCCCCAG
CCTGCCTGAGAGCCAGGGGCCTGGAAACCCAGGAGGCGAGCAGGGGCCCAGGCCCCCCAA
GGAGCAGGGAGCGCAGGGTGCCCAGGAAGCCTTCAGACCCCCTGCAGGAGGGGCTTCCTT
CCACAGACCCCGCCCCTCAGGGATCGGGTTCCAGGGGCAAAAAGAGCAAAGGGGGAGAGA
ATTGGGCGGGTTTGAATTCCCCCTCCTGAAAGCAGGGCTGTGGGTCTGTGTCTCCTGCCC
CTGCCTGAGCGTGTGCACACAATCCCACACCTCTGGGCCTGCACCTTCCCAAAGACCCGC
TACCCCCCCCCGCCCCCACTGCTTCCTCCAGGTCCCAGGTCCCAGCACTCAGGGTTCTGA
CCGCCCTCTCAAGCTATGGGGTGAGTACAGGTTGCCCTGCGATGCTCTGGCCTGCCTGCG
CTGTGAAGCCCCCTCCACCCCTGGCCCTAGTGGGCTCCCTATAGGATGGGGAGCCTGGGC
CGGTCTTTCTTGTGCAGACCAGGCCCAGGCCCCAGGCTGTCTCTACCCTCTTCCTGCCCA
CTGGGCCACCCGGCCCTCCTCTTGGCCAAGGTCTGGTATCTACACCCGCTCCCCAGGAAC
GGCAGCTTTCCCGCCACAGTGTGTGTGTGTGGGCGGGGGGGCCCACCCGGGCTGACATCT
ATGAGCTGCTGCGAGGGAGAAACTAGCTTTCCTCACTTGCTCCCCATCACTGTGGGACAC
ATGGGAGGCCTGAGCCTCAAACCCCACCCCGGCTGCACATGGTCAAGGTCACTGTACTTG
GAAGCGAAGACCTCACTTACTGTGTGTGTCTCTTGGCCTCAGCTCCCCAGAGCAGGGTCA
AGGACAAATGAGGCAAAGGAACCAAAAGCACTTGCTAAGCTACAAAAGCTCTCACCAGCT
TAAGGGACTATCGTGTTTATTATGAAGGTAGAGACAGTTCTCCTTAGGGAGCTGGATGGA
AAACTGGAAAGAGTGCAAGTCCCAGAGTTAGACGGAAGGGCATTCAAAGTCATCAGCATC
CATTTCCTCTTGCGTGAAGTGGGGATGATCCTGCCAGCTACACAGGGCCGTTGCGAGAAC
GACTGAGCTGATATGCTCAGAGCATTAAGCAATTACTACGTCAGCTGTCAATACTGCTAT
TATCTCTGCTGCTACCTCTATGATCTTAGCAAGTCCCTTCACGTCCACAGTCTTGGTTTC
CTAATCTGTACAATGGGAAAAACAGCCCCTCCCATCACAGGGTGGCTGGAGGGTTAAATG
CAAGAATGCATGCGAAGCCCCAGGCGGTGCAGGGCTGGCTCACCCTCATGTGACCTACTG
GGAGCCAGGGACCCAGGGAGGTGACATCAAGATCAGGCAGTCGGAGCCCCGCTCTGGAGG
CATCAGATCCCCTCTGTGGCCCAGGTGGATCCTCCACAACACTTTCCTGGCCCTGGGCGC
CCTGCCCTCTTGGTTAGGCTCCCCAGGAGTCTTTGCTGAAGCCCCGCCCCACCCCACCCC
CAGTCCAGGCCAGGCTTGTCCCAGAAGCCCCCCCAGAGCCCTAGGCAGGGTTAGCTGCTC
TGGTCTCAGGGCTCTGGACCTTTCTCTTGTTCCTCACGGCCTCCGCAGGACAGGATCCCC
GACTCCTCCCCAACTGCAGCCGTGTCCACCCCACCCACCCAGTAGGCACTGAGGAAAATC
AGGCCCAAGGAAACAAAGGCACGAGAGACCCCCAGGCAAGCTCCCCTTCACAACCTACCC
TCTGAGGCGTGGAGGGGCTTGGGGAGAGGACTGCAGAGCGGGGCTGTGTGGCCTCAGACC
GGCATGAGCCTGGAGAGGTGGGTTCCCTCCTTTGAGGGTGGGTGTGAGCGGAGAGGAAGA
AGGGAACAGCTTCCTAGAAGAGGTGGTCTTCAGGAGCCCGAGGTGAAATCTCCCAGAGCA
GAAGGAATCAGACACCCACACCCCTCAACCCACTTTAGGTAGGAAGGGGAGCATGCTCTC
CCACGCTCCTTTGATAAAGTCAGGAAATATGAAGCAACCGGGGGAGGGGAGGTAGGGCAA
GTGCTAGGATTTCCGCATCCTGGCCTTGCTGAGTAACCACAGAGGGAGGGGGCCCTTGCC
AAATCCAGGGGTTACAACAGCCCCCCTCCCTGCCAGGCCACGGCGCCAGCCCCGCCCCCT
CACCTGACTCTGGAGCTCGCTCTGTTGCTTGAGGCGGAGGTTTTCCGGGGTGTCAGCCAC
CATGGTGAAGGACTGCTTGGGGTAGTGTCTGCAGGACAGAAAAAGCAGAGTGGGGGTTAC
TGTGGCGAAGGGGCATGACCCTCTAGGCTTCTCATGGACCTGACTCTCTCCCGGCAACTT
CCTCTTAGCTGTGGGCAGCCCCTGGCCCTGCCCCGGCAGCAGGACCACCATCCATGGCCC
ACGGCCGAGGGGAAGCAAGCATTTCTCAGACTCAGCCTGGGCTGACCTGGGAAGACACAT
CAGGCCCGAGTGGCTGGCCGGCCACGGAGAACTGTCCTGAGCCAAAGGGAGGCCATGGGG
ACACTGTCTGTGGGTTTCAGATCACCCTTGTTGAGGATAATCCATGCCTTAGAATCTACC
GCCCAGGAGGGCCCAGCCAGACTGGGGAGAATGGGCATGGGGTCAAGACAAAGCTTTAAC
CTAAGACCAGACAGGGAGACCAACCAGGCAGAGGAAGCCAGGAGGGATACAGAGACAGAA
GTAAAGGAGAAAGGGACACATGTATCCAGGGGAGCTTCCTGGAGGAGGTGGTGAGAGAGA
GAAAATGCGCACATCCAGTTGTGTTTCAAATAGCTAACAAGGTCCAACTTAACTGGAGGG
GAGGCAAGAGATAAGCTTGAGGTCAGAAAAGAGGTCACGCTCGGGTGACAGATGACAACA
CTGTAACAACAGTTGATATTTGCCCTGTGCTAAGGGCATACATGTCTTAGTTCATCAAAT
TCTCAAAACTGCCCTATTATCTCCTTCGACAGGTAGGAGAAGTGAGGCTCGGAGAGGTTA
AACAACGTGGCCAAGGCACAGGCCAGTAAGTGGTGGCATCTAGACTCGCACCCCATCCCC
CCAGGGCCCAGGAGCCTGAACCAAACCCTCCAATCTCCAGACACAGGACAGACCAGGGGT
CTGTCCCCCAGAAAGAGGGCTGGCGTGGAGGTAGCAAGAACCAGGGCAGCCCTCAGAGTT
GGGCCTGCAGGGACCTCCAGGACCGTCCGGTCCAAGCCCTCATTTCCCAGAGGAGGGAAC
AGCGGGCTGGCACCGGGCACCTCACTGACTTCATAATTAACTTCTTCATCACATCGGTTT
CCTGTCTTCTCTCTCCACTACTTCTCTATGAGCTGAGGCATTTTTTGGTCTCTTTTGTTC
ACTGATTTATCCCAAGCTCCTCTGGTTCACTGATTTATCCCAAGCTCCCAAGCTGGTATT
CAATAAATATTTGTTGAATAAACAAATGTCACGCCAGGTGTTGAGGCTGGGCTGGGACTA
GCACTGGGACCTCCTCCACGCCCCCGGGTCTCATAAAGTCCCCCAGCAAATCAGCCAGAG
GAGAGGCAGCCTGAGTCACTGCGGTCTGTGTGTCTCTACTGGCATGTGAAGCGGCTGGGG
CTCCACACGGCTCTCAACTATTTCAGAGACTGGTGGGCGGCTTCTCTGAGCAGGAGCCGA
GCTCCGGCCATTTTTAGCCCTAGGTGACCACACCCCATCACAGCTGTGACCACCGGCAGA
TGCCTGGTTCGCAGGCTGTCCCCAGGTAAGACATGGACGGCCTCCCTCCAGGCATGTGCC
GCCCTGGCCCTGGAGCTGGATGTGAGCTGCCCTCCTGCCTCTGAGCGCTCACCAAACCTG
GCGTGTTCTCCAGCCGCCTGCACCACCCTGAGCCAGAGCTACCCGTTAACACAGCCCTCG
GCCACCACTTACGAAGGGCAGGACGTGCGGTTTGGTGAACTAAACTAAAGGGGGGTGTGA
CTAGAAAGGGCACAGGGCTAGGCTCTGGCCCTGCCACGGAGTCGCTGGGTGACTTTGGCA
AATCCTTTTCCCTCTGGGCTAGTTTCACTGTCCTGGACCTAGGTGACGCCAGCTGTGCCC
CTCCCTTTAGCCTCCACTGCCCACCTGGGTCCTGCCTCCCAGGTCAGCCCAGGCCCGCAG
CTCCTCCAGCAGAGGGAGGGAGAGAGAGAGGGAGGAGACTGAAAAGCCAACACAGGTGCC
TGCAGCTGGCAATGGAAATGGCCCGGGGATGAAGGTGAAGCTAAGGCTGTGGGCCCAGCC
CCCAGGCTTGGCCTGGGTCCACGCAGCCAGGGCACCCACAGCTGAGGAGCTCCATTCACA
ACTCCTTTGCAGTTCCAGAGAAAGGGAGGATCAAGCAGGAGTCTGCTCCCAGAGACCAGA
AAGAGACTAGCAGGAGAGATCTAAGTAAGATCTCCAGCAGAACTGGCTGGCCCAGAGGTC
CTAAGAGGGAGGGTTCAGGGATGACCCTCCCACCAAATCAGAGCATTCTGAAAGCATCAT
GGGGTGGCAGGTGTGGTGAGGAGAGCATCTGTAAGTAGAGACTCGTGGCAGAGGGAGGTT
AGGTCCTGAAGCAGGGGACGGAGGAGAAGACCTCCAGGGCAGCTCTGGCCCCGAGCCCAA
AGGGTCAATTCTGAGAAGATGGCGCTGGGGAGCATTTGGTGGGGAAGGGTGGCTGGCCGG
CTTGGCAAATACATGTGCTCGGGAGCCAGTCTGCAAACCTGGGGTTTCCCACTTGCCTGA
TTGTACAGGGTGAAAAGGGAGTGACAACTCCAGTGGCCCAAGGACAGCCACACACATGCA
CCCGACACGCGCCCCTGCCCTGCTCCTACACACGCTGTTATCCCTCACACACGATGAATC
TACAGACGGGCTCTCTGCAGCGACGCATGTCTCCTGCACTGAGGCCAGCAAGTCCACACG
TGACAGTTCACATTACAGGCCACATTCACACACCCCCTACACTCCACCAGAAGGGTCTCA
GGAGACCCCCCTAAATGCAGTGCCTCTAGATGGGGTTGGCGAATATTTCACCCTCTCTTT
GGAGCCTCTGTGACCCCCCAGATCTCAGCCCCCTACAGCCAGAACACTAATTCCATCAGA
AAGGAAGAGGGGACCAGCCTAGATGTCGACTCGACTTAATCCTGCAGGAGGAGGAGGGGG
GCGTTAATCCTGCATCAGATTAACCAGATTAAAGAGGAGATCCAGAGCCTCCAGTCTCGT
ACCCCCACCTCCTAAACCCCAAGCCCAGGCCAGCAGAAGGCAGACACGCAGCACCAGCTA
TGTTCCTCCTGCTAGGTCAACTCTGTCCCTCCCCACAGTCCCCAGCCCTGGCTAGACAAC
CCTGCCTTTCCTTCCCCTGCTCGCTGCGCTTCAGGTTCCCATGGCAACCTCATCTTCAGC
TCCAGGCTGGAGAGCAGCCAGAGCAGCAGAGAGAGTCTGTGGGGGTGGGGGAAGAGACAC
AGACAGCAAGGGTGTCCTCAACAGCGGAGGAGCCCACGAGGGCAAAACCAGGAGACTGTG
TCTGTAGGATGCTTGCAGACAATTTAGATGAGGCAGACAGGTGCCACCGGTTTGTTTTTA
GCAGGGAGGAGACAAGAATATTAGTGCTGGGCCCCTCCCCCACCAACATGACTGCCCTTG
AAGAGGGCTCCAACTGATTTGACCTCTTTCCAGAAACAATTGCTGGGAATTTTACCTTTT
CCCTCCCTCTCTGCCCTCGGAGTGAAGCTGCCCCCGCATCACCCTCAGATCCCAGGTGAG
ATGAATGGATGCATGTGTACGCCAATGTAGGCACTGAGACAGACGAGGGGCCACCTGCCC
CGGCTAGTGACCCCACTGGAACCCCAGCCCCACCAACAGACTGGGCCATGGTGAGAGAAC
AAGAGGCCAGGGTGGGGAGAAGCGGGCGTCCCAATCCTGGCCTGGAGCTCGGTCCAGAGC
ACAGCTGTTATTTGTCCCTTCTGTGGGCCAGCCTGCACCCGCCCTTGTTAATTATTCCAA
GGGGTGGGCCCTCTGCTGATACCCCTCCCCACCCTTGATAGCTACTCTGGGGAAGAGAGA
GGCATGGAGAGAGCCCCCAGGACAGGAAGCCTGGGGGCAGCGGAAGGGATCTGGCATCCT
TGAGGGCGAGAACAGGGATGGGGCAGGGCTATCAAGCAGCTGTTGGCAGCAGCCTAGGCC
TCTGGGAGAACTGACAGGCACAAAAAGTGACTTCTTGAAATACTGTATCCTGTGCACATT
CTCTCTTGAAATCCGCCATAAGGCTTTGGGCTAGAAAAGACAGGCGTTATCACCGTGCCT
GCTTCACAGATAAACAAACTGAGGCTCAGCGTCAAGGACAGAGACCTTGCCCACTGTACC
CTCCCCTACACCACAGCTGTGCCGCCAGCTAAGGGCAGCTGACATCTGTCTCTCAGGGGG
ACCCCGGTACACCCCCAGCCGTCAGGGTTCTAGGAAGGATGTGCGTGGCAGGGTGGGTGG
AGAACAAAGTCCTTCATCTTCCAAACCCAACCAGTTTCCAAGCTCGGCCATTACAAAAGA
ACCCCCAGTCAGAAGCCACCTACTCCCTAAACCTTTTCTAAAGCAGGTGTCCGAAGAGTC
CAGACAAGGACCTGTGGGGACGCAGGAGAAGGGCCCCTCCCCTCGTGGGTTATCCCTGCA
GACTTCGGAGTCCCCGTCGTGCTCTGAGGGACTATGAGGACAGGGAGGAGGTGAGAAGCT
GCAAGGCTCTTGCTTAGGGGCTTCCTGGTGACAGGGACAACTTGCAGGGCACTCCTGGCG
CTGCCATCAGCTGCGTCCCAGAGGCAGAACAAGAACAGACCAGACATCCTGAGAGCCCGG
CTCCCCCTTTCGACACGCAACCTCGCCCCTTCCAGCCTGGGACCCCTTCAAAAACCACAG
CTTTTTGTTCAAGGAGGAACAAAACTACATCAACAAAAGCAACAAGGAGCCTTTGGTTTT
ACCAAAAGGGAAAAAAAAACCAAAACAGCCCCTACATCCTGTCTCTGGAAGGAGCTGCTG
ATTCCCCCGCTGGGAACACTGCCCACAGGCGGGCAGGCGGGCAGCAGGGAGGGCTCCCTT
CCAACCCAGCTTCTCACCAGTCCCCAGGCCTGAGGGGCTGAAATGGTGGGGATAGGAAGC
AACAAAGAGGCATTGTTTGACTAGAGAAAAAAAATGAGCAGCCAGAAAGATCAAGGCTAG
ACGTGAAGAAGAACTTATCAGACCTCAGGGGTTGCAGACAAAATAAAAAATCAAAGCCGG
AACCTGCCCCTGATGACAATACATAAAGAGAAATGATTCTGCCAAGTTGAGTAAGGCATG
GAAACCCTGGGCCTCAGTTTCCTCATCTACAAAACAGAGGAGTCAGGAAGCAAAGTGAGG
CGAGGTTCCTTAAGGCCCTGACATCTCTGAGAGTAAGGATTTTGGAGTGGGAGGTGCAGG
GGCTGCCTAGAGGCCACATCTGGCCACTGTGGATGCCCCTTTGAGCCTGCCTCACCCATC
CCAAACACACACCCCTCCACTCCCACTCCAGGTGCTACCCCAGCTCCCGAGGACATCTGA
TCCCATTTTTCCCAGACAGAGGCAGAGAATTCTGGAAAGGCAAGAAAGCCCCAGGCCCCA
GTCCTAGATTTGCCCATTACTGCCCCAGCCCCTAAGAGCAGCTGGAATTCAAGACAGCTG
GCTAGAATCCAGAGACATTTCGAGCACCCAGCCCCACCAGGCAGGGCCGCAGCCCACTCT
CTGAGGCCCAGGGGAAGGAGCAGGACCACAGCCCTGGCTCACCAGAGATACCTCCATCCT
CCTCAACCCCTCAGCCTGCAGCTCAAGGAAACTGCAGGGCAGACCCCAGATATCCGCAGT
CAGCAGAGAGGGGCAGGCTGCAATTGAGGACCCCTCTTTCTTCTTCGGCCCATGTCCACT
CCCCAATTGACACCCCAAAACTGGTTCCCTGGCCTGTAAAGCCACCTCAGGTCTGCAGCC
TCCGCTGATTCGTGCCCCGGCCCCCCACACTGATTCATTCGAGGAGGAGGGAACTGGCAC
ATTTCTCCCACCCCCACCGGCCCCTGACCTCCAGACTCCCAGACCATCGGCAAGGAGATG
AAGGGGCAGGTTTGTCTGTGTGGACACATCTGCCCCACTTTCACTTTCTGAAAATGTAGC
TTATGAAACAAATAATCAAGGACATGAATATTCCTCTAACCAATCAAGCACCTCACCTAC
CTAGAAGCCTCAAGAAAGAATGAGATTAATAGTGGTTCTTCCACTGCTGGCTACTGTGCC
AAAGCAGGCACGCACACCTCCAGCTTGCCATAGCAAGGCCTGGGTGGCTCTGGCCTAGGA
AGTGTGAACACAAACACAGCGCACTGAATTCGACTCTCGGGCACTTCTCCCCATCCCCTG
CCTGGCGGCACGTGCGTCTGGGTACGCACCAGGAAAGGGAGTAAGTGCCTGTCTGTGGAG
GTTTACCACGGGCTGGGGGGCCCAGCTGGGAGCTCTGGTCTGTGTTCTCTCCCCTGCCTC
GCCCCAAAACAAATCTGGTGCAAGGAGAGAAATAGAAGAGGCTTTTTTTTTTTTTTGAGG
AAGATTAGCCCTGAGCTAACTACTGCCAATCCTCCTCTTTTTGCGGAGGAAGACTGGCCC
TGAGCTAACATCCATGCCCATCTTCCTCTACTTTATACGTGGGACGCCTACCACAGCATG
GCTTTTGGCGAACCCTGGGCTGCCGAGAAGCGGAACGTGCGAACTTAACTGCTGCACCAC
CGGGCCAGCCCAAGAAGAGGCGTTTTTGCTGCTTACGGTCACTTTCCACAACTTAAATCT
GTCTTGAAAAGCCACTGGGGAAAGACAGACAGCTTTCTTCTCTCTTGACCACCCCCTGCA
AGACCCTGGCTCAGGGACCAGCCAGAGACAGGCAGAGCGCAGAGGCCTCCCTGCACATGG
AAGCCACACGCTCCTGCCCCCGGGGGCCCAACTCCCTGGCAAAGTGCAGGGAGACATTCC
CTGTTCCTCAGGGTTCTGAGCAGGAGGTGCTGCCAGGAATGAAGCAGACATGAGGTCCAC
AAAGCAAGGCCAGAATGGGAATTGGGACAAAGCTACACCCTGCAAACCCCAGGATTCGGG
AAGCTGAATGTCAGTGGAGATTGGGGCCGCAGGCAGGAAGAAACAAGAAGGCATGGGAGT
GGACACTCAGCACGGGGCCAAGCACCCAGCAGGTGCTCAGTACTCTTGGGTCTAGGGTCC
AGCATCCCTGGGTAGGATTTCATAACCATGGGGAAACTGAGGCTCAGACAGGTCCAGAGG
GCACTCCTTGCAGGCCAGGCTTGCGTCTGGTTTACCCCGGAATCCCATGTCTGGCGCGCC
GGCACAGACCAGCTGCTCAGCAGACACTGGCTGAGGGAGTGTGAGCGCCTGGGAAAAGGC
ACTACTACAGCTGGAGACACAGCCAGGCCACAATCCCCCAAGCTTCAGCCCTCATCCAGG
CTCCTTCCCACAGAACATCCCAGCTGGACCAAAGGTCACCTGGGCAGGCAGAGGCTATCA
GTGTAAAGGTGGGGGGGGAACAGAGAGGGGTCAACCTGCCTCGGTGGCTGGGGGCCAGGG
GAGAGAGAGGGGAAGCAGCCTTCAGGGAGAGGCGCGACATCTTCTGCCTCCCCCGGGCTC
CCAAACCCTGCTCCCCACCCCCACTCGCTGCAGCCTCCCCAGAAGAGGGTGGAAAAAGTA
AGCTGGGACTTTGGCAGCAGGCTGAGAAAATGCAGAGAAAACAAGGACAAGCCTCTGATT
TCTTTCTCCAACTCCCAGTGCTCACTGAATTCTAGGCTACTGGAGTCTAAGGAAGGGACG
TGTAGAAGCATAGGTCCCTGCCACCCACCAGGCTCAGGGCTCTGCCAGCCTTCTGCCTGG
AGGGGCAGAGGGGTGGAGGCTCAAGAAGCTGTCCCCTAAGGAGCCTTCATGCCCAGAACA
TAGCCTGAAGTGGTCCAGCAATCAAGGGGTTAACTGCCCTGGCCTCTGGCTTTGCTGAAC
CCCACCCGACTCCCCAAGGGAAAGCGGAAGTGGCAGAGAATCAGGACTCCTGTTGAGCCC
TTAAGAATTCAAAGAATGTCCCATTTCCCTTGGGGGGGGTGGGAGGGGTTGGACGGGGAA
GAGGACCAGTGGAAGCTAATAGAAGGGGCAGCTGAAGGAGGAGCCAGGACAGAGCAGTGA
CCCTCCTCCTACCCCAGGCAACCTTCCCAGCGTCCCTAATCCCTCCCACAAGGGACAACA
CTCGTGCTGCTTCTTGGGTGTGAGATTTTATCAGAAATCTGTTTCCCCAGCACCTGGCAC
AGGCTGGCAGGCAGCAGCCGGCAGGCAATAAATGCTGACAAATGATCAAACCCCCAAGGA
GATGAGGGTGGGGTATTAGCAGGAGAGCGGGATGCAGTAAGGGAGAAACTGCCTTTCAAA
CAGGTTTAAGCCCCAATCCCTTTTAGACAAGTCCCAAATTTTTACTCCTGGGTGAACTTC
AGCTGCAAAGAGCCTCCGGATGGAAAATTTTTAAAAAACAAACAACCTGGACTCAAGTCA
GATACCGAACTGTTTTGAATACTGATCTGACCACCTACTTCAAGTGACTTGACCTTCCGA
AGCCCCCACCTGCTAGGACGGCTGTGAGGTCCTGTACGTGCTTGGACTTGCCTGGTTTGC
ACTTGCTCCGCTTGAGCTCAGCCCGAAGATGGAAGGTGCTGCCCTCTCTGGAACTGCATG
GGATGTTATGGGGGGACCCCCCTCCCCACAGCAGGCTAGGCTGCAGGTCCCAGTGCAGAA
GGAACAGAGGCCAGGACAACTCCACAGCTTCCCTCACAAGGTAGGGAAGACATTTGCCCC
AGGCCAGGCCACACCTTCATGCTGCCCTACTTCTCAAAAAATGACCAGGAAGGGCTGAGG
CCAGGGGCCCCCAAAGCCTAGTGCTCAGACCCTTGGGGAGGAGGCGGGTGAGGGAAGGAG
AGAGTCTGCAGCTTTATGGGGAGGGGAAGGAGGGAGGGCGAAGCAGAGAACACAACTGGG
CAGAAACAGGGCAGGTGACTTATTCTTGACAGACCCCGCAGCAGGTGCAGCGGAAAGAAC
CTGCTCCCTTTACTGGGTTTGAACTAGCCTCTCACTAGCCATGTCATCTTGGGACAGTCC
CTTCCGTTCCCCAAGCCTCAGTTTCCTTCCCTGTAAAATGGGAATAACAGCCCTTACTTC
AACCAGCATCGGTGAGGACGAATGTGATTAATACTTATCAGGCAGCGTGTGGAAGCGCCC
AGCAATGTCAGCCGGTGGTTATGAGAATGGAAGGAAGAAGCGGGGAGGGAGCCGAAGTGC
CCGCCCAGCCCCTGCCCGAGGCAGGACTCACGCGTTGCAGTAGGGCTTCTTCTCATAGCC
CTTGTAGTTCTTCATGTTGAGTGTCATCTTGCAGCTCTCGCAATGGAAGCATGCTTTATG
CCAGAACTGGGGACAGAAGCAGAGGGAGGACATCATCAGACACCAGGACGTCAGGAAGCG
GGGCTCAGGCCCTAGGAAGGAGCACTCCATCCCGGGGACTGCCCCAGACGGGCGGCCGTG
CAGAGAATGCAGAACCACTCCGGGTGAGCCGGGGACATCTCAGGTCACAGGCTCTGGCAG
CTGATGACACGCCCCTTCCCTTCCCCACTCCTCCCCAGTCAGCCATTTGAATGTCAGGAG
GCGGAGAAGAGCAGACATGGAGGTGAGTGGGGAAGAGGCCAGTTATAAGGAGTGGCGAGC
AACCCCCAGAAGGTCAGCTCCACCTCCCCCACCACTCCTGCCCCAGGCTGGAGAAGCCTC
ATTGATTATGCAAAGCGGCACCAGGGTTGCTAAGAAGCCACTGCTCTAAGCGCTGGGGCA
GCTCCTCAGCATTAAAAAGGCCTAGAGAAGAGGAGGAGGGCCCTGCCCCCACGCAGCCAG
GCCCGGGACCCAGACACTCCTGGCCTCTGGACACACATGAGCCCGGATGATGCTCCAGCT
CTGACACCTCCCACTGCGGGACCTTAACCAGAGGAGGGGATGGGTGCCCCAGCTCTAGCT
ACCACTCCCACCCCTCAGCCAGATAACAGGTAAGAGAGCACCCAGCAGGTGGTCACCGAT
GCACTGAAAAGCTCTGCTTAAAAGCCTTAGAGTGGACCCCCCATAGTGGACATCAAACCT
CCTCCCTGACTAGCTGGGTGACCAAGTCAGGGCCCACACCTCTGAGCCATTTCCATGTCT
GTTAGAATGGAAATGATACCCACCCCTCCTGGACTGCTGAGGATTAACGAGAAATCACCC
ACCAAGCCCTTAACACAGCACCTGGCACCTCTACGGACCGAACATCAGGTGCTGGGCATG
GCAGGTAGGAACCTCAGCCTGAGCCAAGGGGCTCAGCAGCTCACACTGGAGGTTTGTGTG
CGTTGGGGCGCAGGCGGGGCATCACTGTGCCCAACCACAGCTACAGCGCGTGTGAGTGAG
AATGTATGACAGGAAGACTTCAGCAAGGCCCAAGGACCAGGGAGGGAGCAACCAATCCAG
GATGGCTGATGGAGAAGAACAGAGTTGAAGACCATGAGGGAAAGGGAATTGAGGCAACAG
AGTGACCCCATCCTGAGAAACGTTGATGCTCAAGCAAACCTTTGCAAATGAGACAGAAAT
CTGCCCCTGGCAGCCCAGGACAAGGCCCCGGGATCAGCACCAAATGAGCCCAGCTTCCAG
GACTCCCAGAATCCGGGCCGCCGGGATGACCTGGCTGGCCTGTCTCTGCCCTGTTTCCCA
GCAATCAAAGGAGACACTCTTGATCTCTCAAAGAAGGAGCCCAGAGGGGCCAGCCCCGTG
GCTGAGTGGTTGAGTTCGCACGCTCTGCTTCGGTGGCACAGGGTTTCGCCGGTTCGGATC
CTGGGCGCGGACAGGGCACCGCTCATCAGGCCATTTTGAGGCGGCGTCCCACATGCCACA
GCTAGAAGGACCTACAACTATGTACTGGGGGGATTTGGGGAAAAAAAGCAATAAAAAAAA
AAAGGAGACCAGAGCCAGGCAAGGGCCCAGGGAGACTCTCAAAGGGACCCAGCTCAGGGC
TGGTTCTCAGCCATCTGTCAAAGAACTCCCCCAAGGCAGTGCTTTTTCAAAATGTGTTTC
CCAGCCAAGGGATGCTTCTGGGACACTTGGGAGGAGGGGACAGAAAAAAGAAGCTGAGAG
GTTGGGATACCATCTCCTCTTTCCCGGCCCACTTCATCCAGAGACCATGGGGTAAGTGGG
GGTTATCGCTTTCTAACAGGGTACTGTCCCTGTCAAGGAGATCCAAAGGAATCTCCAATG
GTGGAATAGTAAACGAAGTGATAGGAGAACCTCTCTTTTGGGAAGAAGGCCAACTGGAAG
TCTGGAAGCAAAAGGATGACTGGCCTAAGCTTGGCCCCCGCCCACCGGGGCCTATCCCGG
AGCCCAGCCCCAACTCCTCCCGGTGCAACACCCCAACACATACAACCCACCAGAAAACTC
GAACAGGGCAGTCCCCGCCCCCACAAACCCCCAAAACGACAGCCCCTCTCCCTCCCCCAA
TGCCTGGGAGGTGCTGGCAGAGTGCCCCAGTGCTGTCACCACCCAGTCTGCTGGCCTCTG
CCTGCTTAGCTGCACATGCCCCTGCCTGGGCCCCCGCCTCCCCTACCCCCGCAGGGGCCT
GCCAGGAAAAACATTCTCTGGAATCCAGACCATGACCCACTTTCACACACAGACACGCAG
GAATACGCACTGTCCTAGGACTGGGGACCTCCAAAACTGCCTGCTGATTGACTTGGGGGA
GACAAAGGGAGAGACACTCCCTATCCTAGCAGAAAAGGCAGGTCCCCACCCTGGAGCCAA
GCCCCTTGGGAAGAAGGGCAGGGTATACTGACAAGGCTGGGGTAGAGGCCCAGAGCCCAA
TCCAGGGGTTCCACAAGATCCCTCCCTGCTGCCACCGAGAGCAAGGAGAGCCTCCATACA
AGGGGATGGTGCACGTTTCCATCAGTAGCTCTGACCCCCCATCACCCCCAGAGAGGCCCT
GCTCTCAGCGAGACACATTAGAGGCTGGGGTGGGGGTCACCTATTCCCTTACAGGGGGAT
CCGGAGCAGAATAATGAAAACGAGAGTGGACCGAGTGCCTTCAGGGGAGCTACCGAACTC
AGTCTCCCCATCTGTAAAGTGGAGCCAAAACCATGGTCCCTCATGGGGAGAGTTACGAGA
CATCAAAGGCACCAAGCCTAGGATAATGCCTGGCACCCCTGGCTGCTTCATGTCACCTCC
CTCTGCTGTCTGGAGGAAGGTTCAAGGTTCAAGAAAATCCAGCAGCTCCAGCCACTGTGT
CCTCTTTGGGATAGGAAAGCTGGGGGAGGTGGAGGAGCAGAGCATGGTGAGTCACTCAAC
AGCCCCTGTGGGCCAAGCCTGGGCCCACCTCAAGATGAAACCCCATCCCTGTCTCAGTTG
GCTCTGGGGAAAGGCACAGTCAAGGAAATAAGTCAATACAACCCCAAAGGATCCTCTGTC
TGCCTCCTCTCCTGCCCCACAAGCCCTATCCCAGAGCAAGAGTCCCCTCTTTCTTAGAGG
CCCCAGGTAAGATTTCAAAGAAGCATTCCGGGGATGTGGAGCTCAGGGGAACAGAGCACA
CCTCTGGGCATGCAACTCTGATCCTTCCAGAACGCTGCTCTGGAAGGCCATCGTTTCCCT
ATTTGCAAAAAACAGACCTCTAGTGCCTGTTCGAAGCCTCTCAGCCCACATCCCAGGCCC
AGAGTCGCCCTCAACTCCCTTGCCTGCAGCTCCAAAGCTGCAACCCATTCCACAGACAGG
CAAACAGAGGCTGATGGGGGCAGAAGCAAGAACCCAGGAATCACCGTGGAGGTGGGCGAA
GCGGCTCCTCCCAGCTCTGGCTGAGGGGCTACAGCGAGCTTCAGGTCACTGTGTGGCAGC
CTGGCATCTTGCCCTCTGCACCCCGGCTGCCTGGGGTGACCATGACTCAGGGTTGGAGTA
TGACACCCTCCCCTCCCTTCCTGTCGCCTGGGGTTACAGTCTCTCATCCCTCAGGGGTAA
CACCAGCCCCACCCCCGCCAGGTCACCAGCCAAGCTCAGCTGGACACCTGGGCCTCTGGC
TGAAAGGCACAGACCTTGGCTGTACCTCCACAAATTCCCAGGGGCAGAGGATTATTCCTA
GTACCCCAGTTCCCCACAAGACCCCAGGGCCAGGAAGGGGCGGACCACTTGGGACACTCA
TGAGATAGTGTAAGTAAAAGTAGTTTTTGCAAACACACCAGGTAGAAGAGCGGAGCACAA
AGAGCTTTAGATTTGAATTCCAGCTCTGGCTGAGAGAGGAATGAGCCACATGACCTGTCT
GAGCCTCCGTCTATGGGGTTCATAATTTACAGGAGCAATCACATCTGTCTTGCGAGGCTG
CCATGAAGACTGAGCCTGGCACATCGCCGTAAGTAGTCGCTACTATGAATGGATGGTCGC
AAGGTGATCGTGAGGTACTCAGCTTCGGCTAGGAAAACGGGACGTCCCAGCTGTCCCCTT
TGTTGTGTCCAGCCCAGCCTCCTGCTACCTTGCTACCCACTGTGGGGCTGAGGTGGAAGG
TGGCTCAGACACCCAGAGGCAGAGAGCCCTCCTAATGGGGGGTTCCAGGGGAAAGGGCGG
CGCACCAAGCCTCTGCCCTTCCCGAATGTCTCTACCTGTTTCAGGAGCCCGGGAAAGCAA
GCCAGGGCAGGAGGCCACGGCAAGATTCTTGACAATACAGGTCCCCACATACAAATGCTT
CCCAACAGGGTGTGGGACAAAACCTCACCTCTCTCAGAATGTAGAGGACATTTTGAGACA
GCCTCTCTCCCCTCCCAAGGGCCCTGCAGCAGCTCTGCCGAGGGCCTGGCACAGAGTAGG
TGCTCAATAAATATTTGCCGAATGAATGAGTGAATGAGGTCACCCTGTTTCTCCCCCAAC
TGCAATCCCAGAAGCCTGTGGGAAAGCAAATCTCGACCTCCTTCCTCCAACTCTGTCATC
AGCAATACATATTTATTCAGCATGCAGAGCACACTGGGTATTGCAGGTTGGGGGCAGGGT
GGCCATCAGAGGTGACATGGCCTTTACCCACCTAAGCCTTTGGGAGATAAGGCCCAGGGA
GGAGAAAAGGCTAACACCAAGGACGTAGCTTGTGCTCTGGGTCACATGGTGAGCCGGCTA
CATGCCGTAGGGAAATCATAGTGAAATGGGTGAGGCTGATTTGACTCTCTCCTATTGTAA
ACGGGAAGCCTTGGGAAGCTGGTTAGCAGCCACACCTGCGGGACTTAATGTTCTCCCCCT
CCCAAGTCTCAGTCCTCCAGGCACCAGGTACCCAGTCCAAGTGCCTGTCCTTACTGCCTG
GAGGAGGTTGGGACCAATAGTCTGATATCTGGATATTCCAAGCCTCCTGCTCAGTGCAGG
GGTCAAGGTCTTCCCAGGGCCACCTCCTATAGAGAGAGCTCTATAAAGAAGGAGAAATCA
CCAACTCCCACTTCCCAGGGCAACCCCCCCTGAATGTCCTCTTCCAGCTAGGACAAGAGA
ACAGCTGGGGGGAGGGCACTTTGCAGGAGCCCTGCCCCCTTCCCCTCTGACATACGGCAT
CAAAGGTCCTTACAAGGGGAGCCAGGTGTGGGACTGGACAGAGTATCCCAGAGAGGTAGG
GAGGGCACAGCCTATACCACACCCACTCCTGGGCACTTTGGAAGGCACTTTAGTGCACTG
CCCCACCTCCAAGGAAGTGACATCACCCTACCCATATGACGGAGCGAATACCGAGGCCTA
GAGCCATTCATAAAGCTAGCAGGAGCAGACCAGGAACTAGGACCAAGTCTTCCAACTCCC
GGGCTAGCAATGCCTCCATCATATATTGTTTCTGCCTTATATGGATGAAAGTGCCCACAG
CCTCTCCCCAACTCATGACTGCGGAGAAGGGGGGCACAGGGAACTCAAGACGCAGAGGCC
GAAACCCCTACCACCAGAAAAGAGGAAAAAAAACCTAGTGTGCAAGGACAGAGAGTCCTT
CAGCTAGTGCCTCCAACTCAAGTTCTGCCCCCCAGAGGCTGGCACGGTCATTGGGAAGGT
CAGCACCCACATCCCTTGTGCCCACAATATGGCTCTCCTCTCCTCCTGCCCAGCCAGGGC
CAAGAGAAGCAGTGAAACAGCAGCAGCCCCATAAGCCCCCTTCCTCCAAGAGCAAGTTCA
AATGGATTTCTGAACCTCAGAACACCACCCCCTCACCCTGACTCAGAGGCCAAAGGTCGC
TAAGGAAGCTCCAACGCCCAGGGGGAGGGGAGAGACTAAAAGTATCCAATGAACTGTCCT
TTCCCAAACAAAACCTGGCTCCCGGTGGGCAGTGAAACTGGTCTCAGGGCTCTGCACCCC
TCTTCCATCCCATGGCCCCCACCCCTGCCAGTTCAGATGCAAAGGAGGGAATATTCGGAC
TTGGAGGCAGCTTTGGGAGGTAGGGGAAAGGTAGGACGAGGAAGGGGCAATCACAGAGGC
CTCTCCTCCAGTATGGGGAGGAGGCGCAGAGAGGGGGCAGACTGGCCTTAGGATCTTAGG
GAGCTTAAAAGAGGACTGGATCCTACCCCAAACTGCTGGAAACACCCAGTTCTAACTCTC
CGCCCCCCTCCAAAAGTATAATGGCAACCAGATGAATGAGTCCAGCAGGGGAGGGGAGAC
GACGCGTAAGGGCCCCCAGGGGACACTGAATTTGCAGAAGGCCACCCTCCCCTTCCCCCC
CACACCTCCTCCTTTGCTTGGCTTCCCCCGAACTCAGCCAACCCCACCCTGCATCGGGGA
AACCTGCTTTGAAAAGTTAGCTCTTTGTTCTACAAGCCGGTCTCAGGCTCTGAGCACAAT
TTCAGGAGGTCTCTGCGAAGCGGCCCCCGCCCACCCTACTCCAGCACCCGACCCCGCCCC
GCTCCGGCTGGGCGGCCCGGCACCGGGAGCTGGTTTCTAAACTGAGGTGGGGGCTGGGAA
GCTCCAGAGGAGGTCTGCTGGTCCATTAACCGCTGAACCACCAAGGGGGCTGCAGGTCGT
CCAAAAACAGGGGTCTCGCAGTGGGGCTCGGGTCCTTATCCGAAGCTCAATTCACCAGAC
GCAACGCTCGCCGACTGATTAGCCCCCGCCTCGCAGTCTCCAGGCCAGGAAGCCGGGCCA
TTCGGGGGCACAGCAGACGGTTTCGCGGGGCCCCCCAGCCACTGCCCCGCCCCCCCGCCG
CCCCGCGCTTCCGCCTACTTGGCGCTCGGCGCCGCGGGGAGAGGGAGCGGCCGTCTCCTC
TCACTCTCCAGGCCCTAGGGGGCGGGACTGCCCCCCTAACCTTCCCCACCCCCCACCCCC
AACCCCGGGGCCTGGCTTCCCTACTCCTCTTCCGTCCTCCGAACCCCGGGGCACAGAGCC
TACTCTTCTCCAGTAGTGGCTGCCCGCCACGCATGGACTCCTCGCCTCGCCTCGGATCTC
CTGGCTTCCACACTGGGGTCTCTCCTCACACCCCATGACACCGCCCTCCTTCCTTCCTCC
CGGGATCGCGGGAATGAGCGGCAGAGACCCGGCCCCTCTCTCCTCCCTCCATCTGGATCC
CTGCTCAGAGATTGCAAAATCGCTTCCCCGAGGTTCCGGGGCTCACCTTATCCAGACAGT
TCACCTTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGATTGGAGGACTTTTCTTTGTACTCTGCGG
TAACTGGCGTGAACCTGCGGCCCAGACGGGAACCCCCTCTTCCGCCCCTCAGTTAGCTTC
CCTTCCCCCCTCATCCTTTTCCACATTTGTAGGGCGGAACGGGTCCCTCCCGGGTGGACT
CACCCCCTCGCAGCCGGGGATAGTTTTTCTCCATCCCCCCCCCCCCAAGCCCCCGCCGTG
CAACTTCCCAAGGTTCCCCGGATCTGGGCGCCTTCTTTCCGCTTGGCCCCCTTGCCTCCT
TCATTCCTTTCTCCTTAGCCTCAGTGGAAGTAACAGTGTCTTAACACCCAAAAGAGCCGT
CTCCAGGCGGAGGAGCTGCCTGGGGGTATAGCTCAGTGGTAGAGCATTTGACTGCAGATC
AAGAGGTCCCCGGTTCAAATCCGGGTGCCCCCTTGGTGGCTTTGCCTTCCTTCCGTAACT
AGTATTTTAATATTGGGTCCTAGGTTAAAAGAAAACAGAAAGACAATTTTTTTCAAAATC
CCTTCCTCGTTTTCCAACTTTAGCGGAAGCTTTCGATTTTGCTTTATACTCAGCAGACGG
AGGAGGGGTGGGTACGTGCATAAATCATGTACAAAAGCTGCGCGTCGCCGTTACCTGCTC
CAGAGGTGTCGGAATTTCCGCGGCCACCGCCAGCAGCCTCAAATGTGTCAGGCAGTTCGA
GGCGCCAGGTTCAGGGGACAAAATGACTCCCTCAAGTTGCCGTTCCGTTTCCAGTGGGGT
TGGGTTTGAGTCAAGAGAGGGAAACCCACAGACACAACCTTTCTCCAACTTCAACTTTCT
TTATTACCGGTGATACGGACTTGCTGTGTTCACCCTTCCCTATTGCTCATGACACAGGCA
GAGTGAAAGCATTTCGAGAACGTTAAAATGGCCAAGGCACACCTATAAGCTCATTTTAAT
TGACAAAAATAAAGTTAGATGCTGATGCAAACTGATATAAACTAATGTAGTGGTTCTCAA
ACTTGAGCGTGCATCAGACTTACCTGGAGGGCTTGTTAATACACCCCCAGTTTCTGATTC
TGTAGGCCTGGAGTGGGACCCCGAGAATATGCATTTCTAACAAGTTTCCAGGTGATGCTG
ATGCTGCTGGTCAGGGGACCATGCTTTGAGAACCACTGAACTAGTAATACAAGACCATGG
AGTTTCATAACCTAAAGGTGGGGGAGTTATCTGTTGGCTGCGTGACAGTGTCACTGTAGG
GCCAGAGGAAAACGATAAGTGTGAAGGGAGCAAAGGCATCCCCCTCTACTACGTTTTGCC
CAAAAAAAGGAAAAAGAAAGGAGAAAGGGAGAGGCATGCTGCCTAGGTCAGGGGGCAGCT
GCGATATTTTAAACCAGGAATCTGGTTGTGTCATCCCTCCGCCCCGGGGGAATACTCCAA
CGCATTCTTTCCCCCTGGCTCCCATTACTGTGAGATGTATCTCGAGGCTGGACATGGAGA
TTGAGCAGAGCTGCTGTCTCGTGCAAAGCCCAGACCTGAGAAATAACCAGCTTTTCACTC
CTTTCCTGCACGCCAGGCCTTAAACTTATACCTGTAGGTTTATCAGGCCAAAGCCCTGGC
GTTGAGCTAATATAAAGAAAAAGAAAGCCATCCACTTTTCACCTTCGATCTTATGTCTCT
GCTGTGTACTGTTAAACTTCGCGTCTACATAAACCTTCTGAACTTCTGTTCTCCTAGTCT
TCCCTGTCAGAGTATGAACTAGGCAAAATAACATTCTCCCTCCCCGGCACTCCATTTTTA
CCCCCAAAGAAACTATAACATTAAATCGGTAGATCTCGAACATCTTGGAGGTAGGGTTAC
AGGAGTTCTGCACCTTCTTTCTACCTATTGGTACAGGTGGGCTTTTCACCAGGGTTGGGG
TATACGGTTCAGACGCAGTCCAGTCATCCCAGTGCAAACTCTAGGGTGTTGCTCTCTACT
TCTCCGGTACTAGGAACACTTGAGGGAGGAAAACCGGGCAGGGGGAAGAGCAAGAGAATC
ATCCAAGGAGTTTTGGGTTCAGAACCGGCAGACATCAGGGCTGTTTTGAGTTATACCTGA
GTGGATCTTCCAGGGAGTTTTGGATTCGGAATCAATCTGCAGACATTCAGATTATTTTGG
GTTCTACCTAAATGGTTGTGGAAAACATAAAGGCAGACGAGGGGGCACCCGGATTTGAAC
CGGGGACCTCTTGATCTGCAGTCAAATGCTCTACCACTGAGCTATACCCCCTCTGCTGGT
GAGCTTTTGATAAACTCTTTTTATATCAGTCAAACTTTTCATACTAAAACTATTCAAAAT
CAGTCTTCTTGCTAAGTGATGCTGAATTTACTAATAAGGAGGAATAAAATAAAAAGACTA
GCTGAAGAGATGGCATTTTGAAAGCATGTGAACTTGGATACCAATCTGCCTTTTCTAGGC
TCAATTCTTTATCCAAAATCCCACCCATCTCTTTACCTGAAGAAGTCAGAGAACAACCTC
TTACAAAACTGAATAGAGAATCCTTTCCTCTGGTCTCTCTAAAAAGAATACAAACACGAG
CTAAAAAGACATCTCCACTGAGAGACCTTGCCTAGCTATACTCTCTACTGGTCCCTCTCT
CTTTTTATGGAGCAACTACTATGTGCCCCACTCTAGGTGCAGAACATACTTTCAGCAGAA
AGACACAAAGGTTCTCACTCTCACTGAGTTTAAAATCTAGTAGAGACAGACTAGAAACAA
ATGCACAAATGAATAAACAAGGAAATTCCCAGTTGAGAAGGGAAATGATTAGCAAAAACC
CCAAGAGGATGTATTAGGAAGCTTCCAGGGGGCTATTTCAGGTTGGATAGCCATGGAGGA
TTTTTCTGTGCAGGTGACTTTAGAGTTAAGACCCGAATGACATGAAAGAGGCAGTCATTT
GGCCATCTGTGGAGGGTGGGCATTCCAAGTAGAGGAAGCAGCTACTGCAAAGGCCCCACG
GCCCAAGTGGCTGGAGGAAAGTGGACAAGGGGAGAGAGATTCAAGAGAGTTGGAGAAGTA
GCCAGGGCTGCAGAGGGCCTTGTAGGCCAAGGTAGGGGGGTTGGATTTTATCCAAATGAA
TGAAAAGCCAGACATTGGACAGTTTTGAGCAGAGGGATTTGAAATCAACACCCACACTGC
TGTGGGGAAGATTCAACAGGGAGTCAAGAATACATACGTACAATGGAATATATTCAGGCC
TTAAAAAAGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGAGGTT
TCTAAACAAACTCTAGAAACAGAGATAGGAATGGTGGCTGCCAAGGGAGAGGAGAGAGAA
ATGGGGAGTTTCTATTCAAATGGTTTTAATGTCTACTTACCAAGGAGGACTAAGTTCTAG
AGATCGGCTCTACAACATTGTGCCTATGTTGACAATATTGTATTGCACACTTAAAAATCT
GTTAAGAGGGTAGATCTCATGTTGTGCTCTTTTTTTTTAAAAGACTGGCACCTGAGCTAA
CAACTGTTGCCAATCTTTTTTTTTTTTCTGCTTCTTCTCCCCAAATCCCCCCGTTCATAG
TTGTATATTTTAGTTGTGAGTCCTTCTAGTTGTGGCATGTGGGATGCTGGCTCAGCATGG
CCTGACGAGTGGTGCCATGTCCGTGCCCAGGATCCGAACCAGCAAAACCCTGGGCCACCG
AACCCTGGGCCACCAAACCAGTGTGCATGAACTTAACCACTCAGCCACAGGGCCAGCCCC
TCATGTTGTGTTCTTACTGCAATAAAAGAAAAAAAAAGCGTGGACAGAGAGAGACAGGTT
AGGATTCTATGGCAGTAGTGCAGGTGAGAGATGGCGGTGATGTCTTAAACTACAGTGGTA
TATTAGTTTTCTATTGCTGCTGTAACAAATTACTACAAATTTATTTGCTTAAAACAACAT
AATGTATTTCTTACAGTTCTGAAGTTCAGAATTCCAAAATCAATCTCACTGGGCTAAAAT
CAAGGTGTTGGCATGCCTGCATTCCTTCTGGAGTGTTAGGAGAGAATCAGTTTCCTTGAC
TTTTGTAGCTTCTAGAGGCTGCCTGCATTTCTTGGCTCACGGCCCCTTCCTCCATCTTCA
AAGCCAGGGTAGCATCTCCTCCCCCTCTGATCTCTGCTTCCATCCTTACATCTTCTATCT
CTGACTCTGATCCTGCTGCCTCCCTCTTATAAGGACCTGTAATTACATTGAACTCATCCA
GATAATTCAGGATAAGCTTCCCGACTCAAGATCCTTAACTTAATGACATCCGCAAAGTCC
CTTTTATCATGTAAGGTAACATATTCACAAAGGGATTGGGATGTGGATGCATCTGAAAGG
CCATTATTTAGCCTACAGTGGAAACAGCAGAGCTGGAGAGGAGTGCACGCGTCCAGATTG
ACAGAGGCGGGGAGCCATGTGCTTCCTGTGTGCTGGATGGCTCAAGGAAGGTGAGAGAAA
GAACCAAGAAGGACTCTTATTTTTTGTCTTCACTATCTGAGTGGATGGTGGTGTGGTTTC
CTAAGATAAAGAACACTGAGAAAGGAGTAAGTTTAGAAAAAAAGATCGAGTTTCTTTTTA
AAACTCTTAGAAAGTAATAAAGTACAGCCCCCTATCCTCATGGACTTCACATTCTAGTAC
AGGGTCAACCTGTTAAGTTTAAGGTGCTCCACAGACTTTTAAGAGGAGATGTTAAAAAGG
CACTTGGAGATCCAGTTAATTCTGGAGTTCCGGGAGAGTTTAGGGTTGGAAATATAATTT
TGGGAGTTGTCCGTGTATAGCTGGTAATTGATGGAGATAGTCGATCCAAGCTAGATTTGG
CTCATACCAGCTTGTGAGAACTGATGGTTAAATTTTCAGGAATTTTTAAAGCCAGTTGAT
TTCATTTTGGTAGTTTGAAATTGGCAAGTGGGAGTATTTGTACCGTGGGAACTGGCTACA
AACCAGGTCCCCTGGAACTAGTTGTTAGCCATTTACCAGTGCACCGCTGCTTCTGACTGA
TTCTGATTTTCTTCAAAAAGGAAGAGGCCAGCTCTTCAGCTAAGAGAGTGAGGAGGAGAG
GTAAGGTGTGGGAGGTTTGAGACAGGAGAAAGTGGTGAAATAATCCTTTTGGAGAGTGAG
AAAGTGAACCTAGTCAGCCAATGGTGTAGGAGTACTAGACAGAGAGCCTGTTTGACATTG
TGGAGTGACTCAGACTTGTGAGCTCTGCTCCAACAACATTCACCTGCTTGGGTGCAGGCC
TGGTGTAATGCGATAGTTGAATTTAATTAGGATTGTGGTTTGGCTGGCAAGTACAACCTA
CGGCTTACAGTTAACCAGAAACTGTGCCAACTACCGCGGGGAGTACAAAAAGGAATGCAA
TATGATCCCTGCCCTCAAGGAACTTACAGTCTCGTTAGAGAAACAAGATAGAAACTCCAA
AGGGAAAAATAACTGACAGCGGAGAAAGCAAAAGAACAGAGTAGCAGAACTGTGGAGATA
GGTAGTTGATAATGAGAGAAATGAAGTCACAGACTGTCTTAAAAATTAGTAGTGAGAAAG
AAGAAATGGACAAGTGATCACAGCCAAAGGAAGGATTTTCCAATCTAGGGGAAACCTGTT
GATGTTTGAAGGAGCCAGGGGAGAGGAAGTGACTGAAGATGCTGGAGAGAATGGAGACAA
TGGGGGCACATCTAGTACAGGAGCAGAGAGGGTCTTGGGAAGGACAAGGGAAGCAACTCC
TCTCATGCGCAAAGCCTTAGGCTGCGGATTCAGTGCAGCTCAGGTTGCAGGCAGGGAGGA
TGGAAATCAGACAAAGAATTCCCAGGTGCTACAGGCAGAAAAGGCTGTTGTTGATGGAAG
AGAGGAATCTCACCGCATACCCCCACAGGACTTCAAGCCTGGGTCAGTATGGATGTCGCC
CTTCTTTCCCATCACTTGGGTCTGAATCGCCTCTGTAATCCTCTTTTGGTTCTTTAGTAT
CTCCTTCAGGAAACCTGAAACAGCTGATCAGAAATAACAAACCACTGTTAATCACCAGAG
GCAATGGCTGGTCAGTAAATACTACAATTAAGCTGTAATCTCTTTCTTTCCAGCAGAGGG
GGTATAGCTCAGGGGTAGAGCATTTGACTGCAGATCAAGAGGTCCCCGGTTCAAATCCGG
GTGCCCCCTGGTGTCTTCACTTTTAAGCCATAACACCCTCAAGATGGTCCGAAAGAAAAG
CAGTAACTCAGTAAGTAACCCTGTCCATTCTCCAGTGTGTCCCGGGAATACAGAAAGCAA
TCAAGTACAGCGTCATGGATCTCACCTTCTAATACTGAAGGCGAATTGAATAGAGAGGAA
TTACTGTACAATGTGGTATCTGCAACATTTCTGGTGTCCTGTACATCTGTGTGGTTCTCA
AAGTGGGGTCTGGCTATTGTGGATGTCTCTGAGACTCTTACTAGCAAGAACAATGAAGTT
AATAATATTACATTATTTCATTTCACTTTTGTTCTTTCATAAGTATAAAGTGGAGCTTTC
CAGAGGCTATATGATGTGTGACATCACAACAGATTAAATGTGGAAACATGAAAATCCAGC
TGTCTTTCGTTAAGCCAGATATCAAAGGGATTTCCAAAAGAATGTAAAGCAAAGCCACTC
TTCTCATTCAATTATTTTTGTTTGGAAAAATGTAGTTATTTTCCATTTTAAAATGCTATG
TATTTTAACAGGTAATGGGCTTATTATCTTAAATGAATTAATAAATACTTTAACATTTCA
CAATTTAAATTTCTAATCCAGTCAATGTCAATAGATACAACCTATATAAGCAAAAATTCT
TTGAGGTCCTCAATAATTTAAGAATGTAAAGGGATCTTCAGATGAAATATATTTGGGAAT
CACTGTTCTAAGTAAAGAGGTGGCTAGGGGGAGAGCATGTTGGGGTTGTGAAATGACATA
CGGAAGAGAGGACATTTGAGCAGAGTTTTGAAGGACATATAGTGGATAACGCAAGAAAGA
GTCCTGAAATCCTAAGCAGTTTGGTGTTGCTGGAGCGTGAAGTGTAAGAGGCAAGGTGAT
GGGAGATGAGACCAGGGAGAAGGTAAGCCATTTCAGGAAGAGACTCCAATGCTGTTCTAA
GGAGCTTGGGCTTTATCCTGTAAGCACTAGAAGGTCGTTTCCCAGACCTTTGGTTTTCAT
GAACCCTTGAAATTACGCAACAACAACAACAACAACAAATGGTGGCATTGGGAGGGTGGA
AAGCCAATATAGGATTAAAAGCAACATTTTAAATTTTTTTTTTTTTGAGGAAGATTAGCC
CTGAGCTAACATCTGCTGCCAATCCTCCTCTTTTTGCTGAGGAAGACTGGCCCTGAGCTA
ACATCTGTGCCCATCTTCCTCTACTTTCTATGTGGGACGCCTACCACAGCATGGTTTGCC
AAGCAGTGCCATGTCCACAGCCGGGATCCGAACCGGCAGACCCTGGGACGCTGAAGCAGA
ACGTGCGAACTCAACCGCTGCACCACCAGGCCGGCCCCAAAAGGAACATTCTTAACACCA
AAAAAGTTGAAAGAAGATAATTCCAGAATAATAGGCAGTCCTTTAAATTAAGCAAATGTA
GCTTTATAAGAAACACTATATTTTCCAAATATTTCTAATTTTGCCATAGATGAATGAAAA
CTTCTTCACGCAAGGATCCTGACATATGGAGACGATTGAGGTCAACTTCTTCGTTTGTTC
AGCAATCAATCAACATGTATTTATTGAGCCAGGCCCTATGATAAGTGCTGAGGATATACT
ATTGAACAAAAAGGACACAGACCCAGCCCTTATGCAGCTTATAGACTAGTTACAGATGAG
TTGGGGCGGGGAGGGGAGGGGGGAGGTCATTCAACAAATAATCATCAAATATATATCTAG
GAGTTGTAATAAATACTATGAAGACGGGCCGGCCCAGGTGGCCTAGTAGCTAAGATCAGC
GTGCTCCACTTCAGCAGGCAGGGTTCAGTTCCCAGGCGCAGACCTACACCACTCGTTTGT
CAGTGGCCATGCTGCAGCGGTGGCTCACATACAAAAAAAGAAAGAAAGAAAGAAAGAAAA
TGGGCCGGCCCAGTGGTGCAGCAGTTAAGTTCGCACATTCTGCTTCTCCAAGGCCTAAGG
TTCGCCGGTCCAGATCCTGGCTGCAGATATGGCACCGCTCGGCAAAAGCCATGCTGTGGT
AGGCGTCCCATGTATAAAATAGAGGAAGATGGGCATGGATGTTAGCTCCGGGCCAGTCTT
CCTCCGCAAAAAGAGGAGGATTGGCAGTAGTTAGCTCAGGGCTAATCTTCCTCAAAAAAA
AAAAAGAGGAAGATCGGCAACAGATGTTAGCTCAGGGTGACTCTTCGCAAGAACAAAATA
ATAGTATGAAGGAAAAATACAGCATGTTAAGAGAACTTATAAGAAGGGTATCTGACCTAG
TATGGGGGTCAGGGCAGATTTCGCTAAGAAAGAGACATTTAAGCTGAGATCTGAAAAATC
AATAGACATGAAATACATGATGAGAGTAGGCAGGGTAGCATATTCCAAGAATGTGTGAAG
CCTCTGGGTATTCAGGAACATGTCCAGTATCTAGGACTAAAAAACCAAGCCTGCAGAGCA
AGAGAGAGCATGGTGTAAGATGAGGTTGAAAAGGCAAGATGATGCCAGATCAGGAGTTAG
TAGGACATGATATGGATTTTAACTTTGGTTCTGAGAACAGAATTTTTTGGAGGATTTTCA
GGAGAGTGACATCCTAATGTTTATAGTTCTCAAAAATTATTCCGGGCCATTGTATGAAGA
GTGAGTGGAAGGAGTGAGGAGAAATAGAGGCCAGAGGCCAGAGGCCAATAGGAGCCTTCA
GAAGTAGTTTAGGCAAGAGATGGAGGTGGCTTGGACCAGAATGGTAGCAGAGCAGATGGA
GAGAAGTGGATAGACTTGAGAAACATGTAGCAGGCAGCCTGAAAAGAACTTGAAAAGGAG
TCTCAGATGGACACCTGGATAGATGGTGATTCCATTTATCAAGAGAGACAAATCTGGAAA
AGAAATCATACGTTCAGAAACGTGTGGAATTTGTTTGAAAGGTAGAAAGAGAAACTGGTA
GCCAGAGAAGCTGGCAGAATGAAGTCAAGGCATTTTAAGAGTATTGGAGAGATTTATAAA
TTTATAGACTTTTTTTTTTGAGGGAGATTAGCCCTGAGCTAACTGCTGCCAATCCTCCTC
TACTTTATATGTGGGATGCCTGCCATAGCAAGCGGTGTCATGTACCGCACCCGGGATCCG
AACTGGCAAACCCTGGGCCACCGAAGCAGAATGTGTGAACTTAACCACTGAGCCACCAGG
CCGACCCCTAAATGTATAAACCTCTTAATGTTGAAGAGCCCCAGAGCTTCGTCCATGGTT
TTCTTTATCTACCCTTACTTCTTTGTGATCTCATCCACTATCATGGCTTTAAATATACTT
ATTGCTGACAACTCCCAGATTTATATCTCCTTCTCTCCAGAACTCCAGGCTTACATGTCC
AACTTGCTATTTGAATCTCTTGTCTGACAACTAACTCAACGTGTCCAATACTGAACTCCT
ACTCTTACCCCCCAACCTGTTCCATAGCTTTCCCCATCTCGGTTGATGGCAGTACCATCT
TTCACTTGCCCAGACCTAAAGCCTTGGAGACATCTTGACTCCTCTCTTTCTTTCACACCC
CACATTTTTTTGGCTCTACCTCCAAAACACATCCAGAACCTGACCACATCACATTACCTC
TACTGCTACCACTCTAATCCAAACCACCATCATTTCTCTTCTGGGTTTTTTGCTGTTTTT
TTTTTTTTTTTTTTGCAGGGAAAGATTCACCCTAAGCTAACATCTGTTGCCAATCCTCCT
CCCTTTTCTTCCTTTTTCCCCACCAAAGCCCCAGTACATAGTTGTAAGTTTTTCTGGTTC
TTGTACGTGAGCTGCTGCCACTGCACGACTACTGACAGATGAGTGATGTGGTTCCACACT
GGGAACTGAACCCAGGCCACCTAAGCAGAGTGCATGGAACTTTAACCCCTGGGCCATCAG
GGCTGGTTCTCTTCTGGGTTTCTGCAAGAGCTTCCTGACAGATCTCCTTACTTGCATCTG
TGTCCTCTCCCAGTCTAGTCTCAACTAGAGTGATCCTTCTGACATAGTAGTCAGATCATG
TCCCTCCTCTGCTTGAAACTGGCAATGGTTCCCCATTTCAGCCCATAAATGCTGAATTCC
ATAGTGGTGTACAAAACCCTACACGATCTGGCTCCTCTTCCCTGGACATTCCTATTCCTA
ACTCCTTCACCTTAAAGTCTTTGCTCTAATGTCAGCTTCTTCCATGAAGCCCACACTGAA
CATTCTATTTTAAATTGCAATCTGCCCCTCCTCCCACTTCCTGATGCCTGTTACCTTGTT
CTACTTTTATTTTTTCATACTGCTTATCACCATCTAACATAGTATACACCATAATCATAT
CTATTGTTTAGTGTCTAATATCCACCTTCACCACCACCCCAGCAGAATGTAAGCTCCATA
AGGGCAAGAATGTCTACCTGTTTTGTTCCCTGATGAAGTCTCACGTATGCCCAGGACATC
TGGCATCAAGTAAGCGCTCAAGAAATATTTGAATGAACATATCGACAGAAGGAAAGAAGC
CAGAAGAATGGGGGAGGTTGAAGCTGTGAAACGGGTCATTAATAAAGCAAGACATCTAAA
ATACAGATGGATATGGGATCAAGCACACATCTATGGAATTATCTCTGGCGCTAGACTGGA
ACTTCTCGATTACATGACATCCTAAGGAAACCGTTTAGACCTCTTTCTCCCTCGGCCATC
CACGCCCTGTGTTCTCTGGAAGCCTCTACACAACACAGACCGTTTTAATCATTTCCGAAC
CTCTAGTGTCCTGCGAAGTCCCCGCCACATACTAAGTGCTCAAACAAGTTGTTGGGCAAA
TTAACAAACCAATGTTTCTGTGTCCCCAACTACTTTCGAGCTCGTAAAGACAAGACACGC
TGTCATCCGCTTTTGCAGCCACCAAGCCCTCGCCCTCCCATTTGGCAGCGAGAGCTCCAG
CCGATGTCCACGACTTACTGCGTAATAAGACAGCGACCTCCGATAAGAGACGCGTGGAGC
GAGCTCCGGGTCACGTGATGAGAGTGGGCGGGGCGTCCAAAGTTCATATCCCAGCGTCCT
TTGTACCTACTTCCTCTCTGTCCTTTTTCTCGTTTCAAAATGTCAAAGCGAGGTGAGCTT
TTCGGTGTGAGGGAATCCTTCGCCATCTGTCGCGAGGTGGCTGCTAGCCTCGCGGGGAGT
GGCAGCCATAGGCAGCTGGGGTGCTTTGCTCTCCTCTAGGCCGGAGAGGGAGAGAAGGGG
CACCGCGAGAGCCCTGGACGGGGCCCCAAAAGTGGCGGGGGTGCCTGGAGAGTTGAGCTG
GCAGGATGCGGTTATGATTGTAGACTGAGCTCCGCGGGATCGCTCCGCGCCTAGCGCCGC
AGTGATGGGGTTGAAGTTGGACTGGCTTAGGCCGCAGAGCGGGCGACGTGTGTGGTCTGC
CGCCTTGCAGGGAGAACTACGTGGTGCAAAAGTTGGAGCGAGGATTGAGTCTTCCGGGCC
CCTTAGTCTCCACGTAAGGGTGGTGATAGGACTTGGCTGTTTGGCAGGAGAACTGGGCGG
CACGTGGGGAGGGAGGGAGTGGAGTCCTAGAGACAGCGAATGTATACCGTTTCCCAAAGC
ATGGGCGGATGAACTCAGAGCTTGAGAGTGTGAAGGCAACTCGCAACCATGACCCCTCCT
GTCTCCCTTCCTCCCCACAGGACGTGGTGGGTCCTCCGGTGCGAAATTCCGGATTTCCCT
GGGTCTCCCGGTAGGAGCCGTGATCAACTGCGCTGACAACACAGGTGAGACCTACGGCCG
CGCCCTGCCGACCCCCCCTTTTAAAAGCACTCGGTGGGCCTTGGCTGATGACCCACTGAG
CCGTCAAGAAGAGGCAGAGAAAAACACCGTTTTTGGGTGAAGCGGCAGCGTGTGTTGTTG
TTCCGCTTCAATCGGCGTTGTGACAGCGTGTTCCACATGGGGACTCACTGGTTGCGGAGT
GTGAGCCGGAGTGGCTTTTGGAAGCGGGGGGGGGGGGGGAATGTTCCACCGGCAGAACTG
CCGAATAGGCCCTCAAGAAAGTTCATTTTTGTTTACATCCTTCTCTAGGAGCTAAAAATC
TGTATATCATCTCTGTGAAGGGGATCAAGGGACGCCTGAACAGACTGCCTGCTGCGGGTG
TGGGTGACATGGTGATGGCCACGGTCAAGAAAGGCAAACCAGAGCTCAGAAAGAAGGGTG
AGTAGAGGGACCGAGTTTTCGTTGTCGCCTGGTGGACAGTTGAAGGACTTCTTCATTGGA
AAATGGAACAACGATTTTACGATTCTCAAAGCCTCTTACAGCTTTATTTCCTTTGAGAGG
CAGCGAGAGAGAAACACCTGCAGTTGAAGTTCTGCTCTTGCTGTCTCAGAGACCGTTCTC
TCACTGCCTGATCTTAACTGTGTTCATCTTGCCCTCTTACTCCTTAAGTGTAATTGCCAC
ACTGTGGCCATGGCCCAGCTTTCAAAAATGTAAATCTTGTCTCTTCTCTACTTAAGTTCT
TCACTGGGTTCCAGTGTAAGCTGGCGGCTTTGCATATCCCTGCCATTTCCCCCAGCAAGT
TCAGCAGGTAGTTATAGACCACCTCACGTACCTAGAGAAGCAAAAGCCCTGTCCTGGAAT
TTACAGTTCACCCTAACAGCGCCCTCCCCAGCTCTCTACTCGTTTCAGTTGTTGGTGTCT
CGCTCTCACCTATACCCCTTTTTTTGTGCCTCAGATCCTTTGTGCATCCTATGCCACCTG
CCTGGAAGACTCCGATCCAGTCTTCTTCAGCTCACTTGCTGACACCCTCCCTCCCCACCC
CTCAAAGAAATCCTTAATGTGGGTGGTAATTTTTGTGTGCATAACATTTACCTAAGTTTC
GTAAGAGCAGGTAACTGGCTTTAGTTCATTGCTGATTTCCTTGGCTACAAAAGAACATGG
TGGTACTTAGTAAATGTATTTTTTTCATAGGTGGTTTAGAGCTCAACCAGGTGAGATCAT
AGCTTTAAGACTTATGTCACCAAGGTTCCTTTTCTGGAACTACTAATTTGAAAGGGAATA
ATGATACTTGAATACTTTCTCAGGCGGCTGTGAGATTCAGGTGATGAGCATGTAGAGCGT
CTGGCCTATTAACTAGTGCAGAGTTAGAGGTGATGTTTTTCATGCTTTACGGCAGGTTCT
TTTTATAGAAGAGATTAATTCAAGATCATACTTGTCAAAAGTTTGGCATGGGTACTTCCA
AATCTCTTCTGATGGAATCTAAAACAGGGAGGTGCTCATTGCTTAATTGTGGGCTGCCCC
CCAAAAGTTTCCCCACTAGGTATATGAATTAAAAGGGGAGGCCTCGGGGCACTTCTGACT
TGTGTCCTTGCTGGCTTTAGAGCTGCTGATACTCAGTGCACTTGAACTTTTCAGCTCCTG
AGCTTACTCCTGTGCCTGCTTAGTGTTGTTCTTCCTGAGAAGTCCTCGCCTTTCCTTGAT
GTACAGTGCAAATGTAGCAGGGCTCAGCCACGTATATCAGTTACTCTTGTAGGCCTGCGT
CTGCCGCCCGTCGCCCCACTACGCAGTTTTTAGCCTGTTGGTCAGAAGTCTGACTGTGTT
CACCTTTAATATCCACTTGAGGACTTGGTGGGCAAGGAGTAAGTAGCATTGTGGTTAAGC
ATTGATGAATCAATGTGTAGATTGGGGTCAGCATGCAGTGGACAGGCTCCCCTCTTAGAA
CACTTGCTGGGTCTGATCTGTGGCCTCGGGAGCCGTCAGGGAAGGGCAGAGCAGTCCGCC
ATCACTGTGGGTGAGATGGCAGCAGGATGTGCTGTCTGTCTCAAATCAGTGTGGGACAGA
CCAGAGAACACTCATGATTTTAGAAATAGTTGTGAGTTTCCATCTCTGTGTCTTCTTTGG
TCCTTGTTTCTGCTAAGTGAATACATCCCTTTACCTTAGACATATATAACTTACAGAGAT
GTAGAAAGGGACAGGATCGGAAGTCCAGAGACCTGGATTTGTGTGGCCTTCTTTATCCAC
TAGATTCATTTGTGAGAATTTAAATGGTTCTAAGTAGATGAGTGTCCAACAGAGGAGGCA
CTCATGAATGTTAGTTACCTGTCTCTTAGTGTGTATCCCGTTGTTAAAAACTTGATCAGA
GGCTGTCTGTGTACGTAGATACATAATACTTGCCTCAAGCATAGCCAGGATCCCTGTCCT
TATGAAAAATCCTGTATTTCCATGGTCTGATTTTGAATGTAACTGTTAGCCCTGTTTTAA
AAGAGGAAAACTTGAACTCCAGAAGATTAAGTAATTTGTTCGAGGTTTCCAGGTTAGTCA
GTCAAGATTTCCATCCAGGTGTGTCTGGCTCTAGTTCTTTCAAGTGCAGTGGATGCTTTG
TCTTGAAGGTCTGGGAAACTTCCCTTCAGTGCAGGTAGGTTTTAAAAAGTTACTTATGAC
CCTAGAAAACAGTTCTTCAGAAATTAAACATAAGGGTTAATTACTGAAGAAATGCAAGTT
GAATTTCAGTTACCCAACTCTCAGACCTCCAAAAGATGATCTTTGTTAATATTTTGTTGT
ATGTCCTTTTTTCCTGACTTCTCTGCAAAAAATTAGCTTCTAAACTTTCCTCTGTCAATG
GGACCATTACGTTCCCATAACCAGTTCTTGCTTTACAGATGATTATCTTACGAACAAAAA
ATTGCAGGTGATTAAAAAATTAAATGATTCTGTTCTGTGCATGTGCCATGACATTATTTA
GGTTAATTCCCAGTTTTTGCTCTGTTAAAACAACCTATGCCCTGCAGTTAGAAAGGCATT
TGAGATAGGGTAGAGTGTATGGCCGAGATCCTGGGCATACTCATGAAGTTCAATGAGTGT
GTATGTACATGTGCTCGCTAGCAATGACAAGGTTCCTTTGGGTAAATTGGTGTGTAAACG
AGTTTATATTTGTAAAACCCGACACATGGTACACATTTAATTCCAACAAATTCTTCAAAG
CAGTAGTTTTTAGATCGAGGTATGTACTTTCTTGGAGATTTTGATATCTACTGGGCTGGA
ATATTGCCTAATGAGGAGTTAATGCTTGGCCTCTCCACTCATTCAGTCTGGGGGTAGGGT
CCCATTCCCGGTTCTGTGATTAGGATCTTAACAGTGCCCACCTGTTGGATGAAGTGGGGA
AGAGTATAGAAAGTGCTTAGCAAGGTTTCTGCTGGTGTGTTGCTAATTGTCCTCCCAAAA
GAGTGCAAACTTACACTTGCAAGGAAGTGCAGGTAGTTTTGACTTGGAGTAAGGTCTTTA
CTTAAGGGATGATTGGTGTTTCCACTGTCTCTCATACTTGGTTTTAGGAAATGCAAAACT
AATGATGCGTATACATTATGTCCGAAGGGACGATGTTTGGCGAACTACGAGGTGTGAACT
GCTTTTTTCCGGTGGCACTGGGACCTCACAGGTTAATGACTGCTGTTCTTTTTTCCCTCT
TAGTACATCCAGCAGTGGTAATTCGACAACGAAAGTCATACCGGAGAAAAGATGGCGTAT
TTCTTTATTTTGAAGATAACGCAGGGGTCATAGTAAATAATAAAGGAGAGATGAAAGGTA
AGGAGGGCTCCTTGTTGTCCCTCAGGTCTTTAAGATTGCAGGATGACTTAGCTCTTGGGT
CTAGGAATGTGAGCAAAGGACCCTCTAATCTTACCGATCACTTCGTTCTTTTTTTTTATG
CAGGTTCTGCCATCACAGGACCAGTTGCAAAGGAGTGTGCAGACTTGTGGCCCAGGATTG
CATCCAATGCTGGCAGCATTGCATGATTCTCCCATGTATTTGTAAGGGAAAAAACCATTA
AAAGTTATGTGCTCCCAATGCTTGCCTTCCTTTTCATTTCCACATGTCACTCTTACTGAC
ACTACCTAACCCTTGTCTCCTTTGTAAAATGAAACTACTCTGCGCACACTTTCTGTGGGC
ATGTGTAAAAAAGAGAAACACAGTCCTTGCACTTTTGTGAGTGTCCAGAACTTCTGGGAC
TTTCCATTTCTGCTATAAAAACTTCAGTTATTTGGGTTTGGAATCCTTAAAACAAATTGC
AGGGAATGGATGCTGCTTAATGACAGGTAACTGCTCTGCTGTTAGGTATTTGAGATAAGG
TAGAGTGTATGGTCAGATCCTGGACACACTCGTGGATTCAAAGAGTGATGTGAGGGGGAC
CAGGTACACGTGTGTATGTGCACACTTTTACAGTTAGTTTTCTTTGAGTAAATTGGTGTG
TAAATGAGTTTATATTTGTAAAATCTAATGTGGTAATTGCCATGTAAATTTGCTCTCATG
GAAGATGATTAAGTTGCTAATAGTATCTGCAGGTTTTTTGCTATCAAAATGTTGTGACAA
GATGGCCATATAACGTATCTCACAAACCCTAGTTTGAGAATACTAAGAGATGATATAATT
ATGCCAGCACAACAGGTGTGAACCCTGGCAAATTCTGCCTTAAGAGATGAACATTGCAGC
TTTTTTTCCCCAAACTGTAAGAGTGACATTCAGGGTCTGGGAAAAATGAGTACTCAGCTG
GTTTGGGTCAATAGTCTGGTGTAAAGATGTTAGAACAGGCTTTTTAGACTAAAGTTTGTG
TTCATATGTCTAGTATCTGAAAATACTCGGCCTTCAGTGTTATCTGTAAGTTGAGTATAA
TGCAAGGCTGAAGATTAGAGTGTACACGAAGACCAGCACATAGTTGCTTGGTGAGATGAG
TTCTTTTTGTCCTTCAGGGTTTGGAATGGAATATACCAGAACTAGAGAGCAGAGTGCTTC
TCAACCTGAGGAGTTAAATGTGTTCAGGCTATTGTTGGTGCCTCTAGTCACTTCTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1010, 125360..125443, 125748..125876, 129123..129236, 129363..129495
1001..1010, 125360..125443, 125748..125875
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved