Equus_caballus Locus TBRG4
snOPY snoRNA Orthological Gene Database
Equus_caballus TBRG4
Equus_caballus
TBRG4
4
SNORA5, SNORA5
4685..4821, 5204..5338
10538
GGCAGGAGGGAGGTCCCAGTTAACATTTTATGGTGCCCTGGTCTCGTGCCTTACCTAGG
TCTTTTAATCACCCTGGTGAGCAAGTCTTACAGAATTGTTAAAAGCAACATCGTTGCGAT
ATGTAACAGATTCTTGCAGGAGGTAATGTTTTGTCTGGGTGTAGAAAGATGAAGGGTGAT
TTCCTGCGTGCTGTGGTGGGGGTGAAAAAAACCGGCAGCAGGCCCGGCCCTACCCAGGTG
TAATGAAAGTGCAGGGCCCTGTTTAGAATGAGGGAGTGTGTTGCCAGGAGGAAGAAGTAG
TAAAACTGGAGAGGTAATTCTGGGCCATGTTGTGAAGTGCTTCTTGTGATGGGTCCAGGA
GTTTTGCTCTTAGAAGGTTGTATGTGTGTGTTTTTAAGAAGGTTGGTGATGTAATGTAGA
TTGATTTGGAGAAGCTCACTCGCGTGTCTCTAAGTATTAAAATATATCCATGGAAGCTGT
AGGGTATGGATTGTGTGTCAGGGTATTCCAGGAGCAGTCTGATTTTAAAATATCCTGTCC
CGTAGTCTCTGTAAGCCAATAATTCTTAATCCTGGATGCTCTCAAAGAAAACAATGCTCT
CCGAGCCATGAGTCTCCCATTCCAGGGGTCTTGGGCCCAGCCTGGGAATCAGAATTGTTG
AACCCCTCCCTAGGTGGTTTTGAAGCACAACCAGGACTAAAAGTCCCCCAACCCACGCTC
TGGTGCTCCTGAGTTGTCGTGTTTGGTTACATTCTATGCTGGAACAAAAACTCTGGGATT
TTTTACTTCGGAAAATGCTGTTATATGTATGTGGGCAATCAGAAGGGAGAGGTTTGGGCT
GGTTTATGGAGAGCATGCCTGTGACTCCCTTTCATTTGTCATGTCCTCTTGTGTCTGTGA
GTCAAGAACTGCCCCTGCACCACTCCCTTCTCTCTCCTTTCTCTCTTCAGGGCTTTGGAA
TCACTTGCTAGGAGTCTTACCTCCCTGTCACCCAGGCCATCATGGCAGCTCGCCTGGTGA
AGCGATGTACATGCCTCCTGAGAGAGGCTGCTCTTCTAGCCCCTGCCGTATCTCCGGTTG
GCCGACTGAGACTTGCCAGGGTAGCGCATAAGACTCTGACTTCCTCAGCTACCTCACCCA
GTTCCCACTTCCCAGGATCCTTGTCAGAGCTTGTGGAGAGGGAACAAGTGTTTACTCCCT
ACCCAGAGCGCCAGGAGGTGGACCACCTCATCGAGAAGGCTGCCCGGCCTGAGGAGCTCC
TGGACCTGCTTGGTGGTGGTCACTGCCTGCACCAGAACCATGCAGCGCTCATCCTCATCC
GCCTCTCTCGCCTGCTGTCTGAGAAGCCAGGAGACAAAGCCTCGCTCGTACGGGATGCCC
GCTTCCAGCAGCTTCTCCATCTCGTCAACAGTCAGGTGAGTTCTGCAGTGTTCTCTGAGG
GCTCAACAAGCAGAACACAGCAGAGGCCCTGGAGTCCAGAGCAGTCAGTCGCTTTTCAGA
TGTAGACAGGAACTCTGCTTAGTCCGTCAACATCCTGCGATATTTTCTGATTTGATAGAT
TCCACAGTACCTTTATGTACTTTCTCTGTCAGTCCTCACAAGAGCCCCTGTTAGGTGAAT
ACTGCTGTCATCATCTCAGACAGGTGACCAGGACGCAGTAATGGAAGCACAAGGAGTGAG
CCTGGTTCTTGTTGGTTGGTCGGGTGCCTCCCCCTCACCATACAGTCTTGACTTGCGTAG
CTCCCCCATCAGTGTCTGGCCGACGGTGGGCGTGCTTTTGAAGCAGGAGGAGATGCAGGG
GTGACTGATGGAGGATCCCAGAAGCTTGAGCTGGACATAGGTGTTATTCAGCCAGTCGGA
GCCTTTAAGGGTGAGTGCAGAGAGAAGGGACCTGTTTGTGTGGCTCTAGGGGGCAGAGCT
CAAGCCAGTTTCTGTTCAGTTGAGGAAGGTCTCCCTTCATGTAGGCTCTTCCCCAGGTGC
TGTGGGGTTTGCTGGACTGCCAGAGGGGTCCATGGCACAGAAAGGAGGTACAAACCCCCA
CTCTGGCCATGTTGGCCCTCACTCACTCCCCCGGTCTGCTCTGGAAGGGAGAGGCTGCAC
TTCTGTCACTCAGCGTCAAACCCTGTGTCCACTTGTCAGGGAGGAGGAGGCTCACCCCTG
GTTCAAGGAAGGGGTTGCACCAAATGAGTGTCTTTTAAACTGCAGGTTATGAAAGCATGG
TGGATGTGGTCAGCCATTTTTTAATGAGATCACGTAACATAGAAGATGCCTACCTGCCTC
ACACGTAGTGAGGGAGTGCTCTTTTGTGGAATTCTGTGTTTCAGTTAAATATGTAAATAT
GCACGCATGTGTGTACTGGGGTCACAGTACTGATTTATTTCTTGCTGAGAATAAAAGTCA
TAAAATTACATTAATTAGCTCCCTTGTTCTAAGACAATAATTCTAGTTGTTATTTCTTAA
ATATTTTATGCACACAATTAAAGCAAGTTTCCCAAGACAAAATGGAAGGTTATAACAAAA
TTGTAAGCCAGTAACAAACTGGGAACAAAATATTGACAACGTAAATGGTGACCACAGTTT
CTTTTAAAAAGTCTTACTGCTGTCCAGGAAACCTAGAGAAGGATACAGGTGCCCAGGTGT
CATGTGATAATGAGATCAAATTCAGTACTTTCTGCTTGCTCCCCAGCCCTTCACACAGCA
GCTTTTCTGTTTCCTACTCAGCTCGCGTGTGTGATTTCCATTCCTTCTCTCGGCAGTGCA
GTCCCATTTCACAGATGGAGAGACTGAGCCTCAGGGGCCAGCAGACTTGCACCACCATTA
AAGGCAGAATTGAGAGGCTAAGCGCAGCCAGTGACTGAGCCTTGCTCAAACTCAGATGTT
CCGACTCCAGCTCATGTTGAAGCCTTCTGTGAGGGTGGGGTCTGGGCCAGAGGATCTTGG
AGTGGCCCCCTGTTCCTCTGAGGCTTAGAAGCACCCTGCAGGGAACAGCAGGGTCACCAT
TGTTCAGAAGCCGGGCAGGAGCCCAGGAGGAGGGAGGCGCTGTCATGCACAGGACAAGAC
TGGTTTCAGATAGCCTGGGTGCAAGTTCTGGTTCTGCCATTCCTGCTAAGACTTTGGGGA
AACGATGTGTGGAGCGGAGTGATGACGCCTCCCAGGCTGTTGGTACCTGACACACAAGAG
TGTGTGGAAGAATGCCTGTGTTTCATAAGAGCTGGCAGTGGTGGCAGCAGGCAGCCAGCC
AGTTGTTCATCCCTCGATGCCTGGCGGTTTGGGGGTGGGCAGGACTCAGTGATAGCAGGG
CATCTTTTTACCCACAGATCAAAGGGCTTTCGTGCACAGCTTCATGCACTGGGGATGACA
GACTGGCTGGCTTCAGTCACAGACTGGAGGGTTTGATGTGGCGCCCTGGTGCCTAGCTGT
CGTCTCTGCTTTAAGGCAGCAGTTGCATTCCCAAGGAACGCCACGTTGCCAGAAACTGTT
CTGACTCTTCGCTGGAGGAAGGGATTTAGGGTTTGGGGCTTCTCAGACTCAACCACTTTT
GTTTGTAGAAAAGTCTGTGTTTTTAATAACTAAAAATTGTAGTTGTCATCACGGGCAAAA
GAATGAGTTCTTGACCAAATTGACCTTCCAAAGCCTGACGGTCCTTCCTGACCCTGAGGC
ACCCTCCCACAGGCTTCACTCTCACTTCTGGACTTCAGAGTTTTACTTGCCCATCAGGTC
TGTGGGTGTGAGAGGAGCAGAAGCCAGGCGTGCCCGCGTGAGTTGCTGAGCCTGCTCTCT
GTTTAATGTCACATCAGTCGAATTTGTTATTAGGCGAACTCCAGGAGAATTTTTCTTATG
GCAGAGAGTTGTTGCTTGCAGGTGATAGCAAACAACCGACTGACTGGAGTGGACGCAGGA
TATTGGAGGCTGGAGAACCTGACTCAGAAAACAGGCGCGGGCAGAGGCTGTGAGGAGCAG
CCTGGTGCGGCCCGTTAGAAGTGCCTGCCTTACGATAGTAGATGAAGTGATTCTAGGGAC
GCAGCTTCGGGCTCAGACCCTTGGCCAGCTCTGTAACGACACAGGATCGGTGGGGTCCCA
AATGTGACTTGCCTGTGTCCTCCCCACCAGATAACCACTGTCTGGCACGGCACCCTCGTG
AAGCTGCTCCGGAGCCTCTATGCACTGGCGCTCCCCGCAGGATCCAAGGAGCTGCAGTCG
GTGGAGCAGGAGGTCCGCTGGCGAATGCGCAGGCTCAAGTACAAGCACCTGGCCTTCCTG
GCCGAGTCGAGCACCACCTACATGCAGGAACGGGAGTCCCGGGAGCTGCTGGCTGAGCTC
CTCGTGCACCTGGAGCGGCGCTGGGCGGAGATCGAAGACGGCCGCACAGTGGTGGCCATG
ATGATGAAGGTGGGGCACCTCTCAGAGTCACTGATGAACCGCCTGGAGGACAAGGTACTG
GGGCTGAGAGCATTTCTCCCTGGGAACTTGGGCTTGTTTCCTTGGGTGACGGCCTCTGGG
GAAGGGGTGTGGGAGGGGAGCCCTGAGAGCTTCTCTCTACATTATCGTCCTCCAAAATTG
CCTCTTGTCCATAACCTGGAGAGGGCATGGCCGGCAACTCCTAAAGTATGGCCTGTGTAG
GTGGCTCCGCTTCTGGCTGGCGCTTCCTAGAGACATCACGCCCCCACCCCCTACACCCTC
AGCCCTGCAGTCAAGTCAAATTCAGCCCCCGTTCCTGTCGTAGCGGGGGCTGGCCCAGAT
GGCTGCCACAGCAAGCTCCACAGCTCATGGGCCCTGGGTCCTCTGCCCTGGGACCTGGGG
ATAAGTTTGGCTGTGGACAGAGCACCCCAGGCCTGGTTCCCCGGGGTGGGAGTGGAGGCA
GGCCCTGCACAGGTGGGGCCTGTGTTTAGTAAGCTCAGGCCCAGTTGCTGTCTCGCAGGG
GCTGCACTGCATGGGACCCCTGGCCCTCGGGCCATCGAGCTGACCCCTGCCGGCTGTGGT
TGACAGTGCCTGGAGCTGGTGGAGCAGTTTGGCCCCGACGAGCTGCGGAAGGTGCTGGTG
ACGCTGGCAGCTCAGAACCGGCGGTCGGTGCCCTTGCTGCGGGCCATCTCTTATCACCTG
GTCCAGAAGCCCTTCCCCCTGACGAAAGGCATGCTCCTGGACCTGGCCTATGCCTACGGT
GAGCCTTTGCACAGGGAGGACTGGGGGAGGGAGCGAGCTCTGGCTGCAGCTGTGTCAAAT
TCGGTGCCTGCCCCACCCATGGCAGGCACTGGCCCAAAAGGCTGCCATAAAAACACTGTC
ACTCATGGGCCCTGATCCTCTCTGCTGGGCCTCAGGGATAAATTCGGTTACAGACACCAA
GCTCCTGGACCTTGAGGCCAGGATAGAGTGGTAGGGTGGGCCCACAGGTAGCCTGCCAAA
GCTCACCAGGTAGGACCCCCGGGTCTGCTCTGTCCCGAAGGTAAACTCGGCTTCCACCAG
ACCCAGGTGTTCCAGCGCTTGGCCGCCGACCTGCTGCCCCACACGCCCAGCCTGACATCT
GGTGAGGTGGCCCGCTGCGCCAAGTCCTTCGCCTTCCTCAAGTGGCTCAACCTGCCCCTG
TTCGAGGCCTTTGCCCAGGTGAGCAGGGTGCACCTCTGAGGCCTGGGCTTGAGGGCCCTC
CATGCCTGACCCTCACTGCGAGGAGCCGGGCCTCTGGTCGTTTGATCAGGGAACTACAGC
TGGCCTGGGAATGCTCCCTGATGGCAGGTGTGGCATGCTTACTTTCTGGCTCATTTGGAG
AGCAGTGGTAGAGCTCGATAGGGAAAGGAAAAGTAGTTGAGAACAGTCATGTCTCCTCCG
TCATTTCACCAGACCTCGTAGGTGCTTCCACTCCTCGTTGGGTGGCTGTGGCAGGGAGAG
TGCAGATGAGAATCCACTGAGAACTCGCCCTAAGCTTCCAACCTCCCCAAAATGGAGTCG
TAAAAAAAGACGACGCCTGTGCTTGCATTTAGTCAATAAATGTGGTTTCAACTGGTTGTG
CATAAAGCGTATTTCTAAAACCATCATCAGGGAGCAGTTTCCAAGGGTCCTGGGCCTTTG
TGAGGAATTGCTGCTGGGAGCGTAGAGTCTGGTCCTCCACCTGCCACGCTGTGTAAATTT
CCCCATGTGGCTGGGGGCTCATGGGCCCTGGGGGAGGTCTGGGTCTTCATGGGGCGCTGG
CCAGGGCCCGGAAGCTTCCCTGGCTCCAGGCCCCTCTCATCCTGCCTCTCTGCCTTACCT
GGCCGGCCTAGCACGTCCTGAACAGAGCCCAGAGCACCACTGTGCCACACCTGTGCAACA
TGCTCCTGGCTTTCGCCCGTCTGAACTTCCGTCCAGAGCGAGAGGATCAGTTCTTCAGCC
TGGTACAGTCTTCGTGCCCCTGTTCCCTTGTCCCCGACTCTCTCCCTGCTGGCTGATGCT
CTGCCCTCCAGGGAACAGCTCAGGGCTGGATGGGAGGGAGGGAAAAGGTGAGATTTTTGC
AGAGGAGTGCTGGGTGCAGAGACAGAATGGGAGAAGGCCTGGCAAGGGGGTTCCAGGGAA
GCACTGGGGGCAGCCAGAGGTCCCAGAGGTTGGGGACAAAACTCACAAAATCCTAGCATG
TTAGCTGGGCGACCGAGAGCAGCTGTGGGTCAGGAGGACATCAGCTGGTGGGCTCACAGT
GCAGTCAGGGCTGGAGGCCACTGGTCTCGCTTCCTAGCACTCCCTTAACGCCCTGCCAAG
GTTCAGAGACCTCCCTGGTCCACTTCAGAGATCTGCTGGCAGGGCCCAGGGGTGTGCAGG
CCACCCTGCTAGGGGAGCCCACATAGGGGTGAGAGCATCATGTGTGGGGTTGGCGTTTGA
CCCTAGGCCCCCACAGAGGGTGCTGCCTGGGCTGACCAGCTGCTTGCCCTTTCTCAGGGC
CGGAAGCACCACCTTCCCTGTCCTAGGGGCCCAGTCAGGATGTTCCTGAATCTGTAATTT
TGTGCCTTAGGCCCCTGCCAGTGGTTGGGTGGTGAGAAAGCCCAGCTGAATGTTCCTGCT
GTCCAAATTGGTCCTAGGGAATGAGGAGAGTTTCTGGTATCTTCCATCAGGGGTGCCCCA
AGCCTGACCAAGAGTGCCTTTGCTGAGGTTGCTCCCCATGGCCACCTCAGTGTGGCCGGG
TCGTGAGGCAGCCCCAGCTGCTGCCTGCCCCGCGATATCTGCAGCTGCTGAACAGAGCCT
GCTTTCTCCACCCAACCCTGTCCTTGCCCAGGTGCGGGAGAAGCTGGGGTCAGAGCTGGC
AGGCCTGGACCCAGCCCTGCAGGTGGACGTGGTGTGGGCCCTGTGTGTGCTGCAGCAGGT
GCGGGAAGCGGAGCTTCGGGCTGTGCTCCGCCCTGAATTTCACACCCAGTTTCTAGGTGA
GCAGTGGGGGGACATCGCTCCTCCTCCTAAGTGATGGTGAGCCCATCACCACGCACCCTC
CCCCCGACCCCAATACTGCTGTAGCTCTGGCGGCTGCCCGATTCTGTCTGCCTTGAGGCA
GGCAGGAGATTAGGGGCCTCCAGGCTCTGCTGATCGTCAGAGAGAAGGGGAGACAGGCAG
ACCGGAGCTTGCATTGGCTCCTTCTCTGTCCACTCCTGGTGGCTGACCAGCAGACCCTCT
TTCTGCTGCTCCTGACCCAGAGCCCAGGGTGGGGCGTGGATGTGGGGGATGCTTCTGCCT
CTCCCACCTAGCCCCCCATGTCCCTCCATCCTGGTCCTCCTGGCCCTCGGCCCACCCCTC
CCTTCTCACTCCATCCTCTCCCCTTAGGTGGCGAGTCCCCAAAGGATCAGAGTATCTTCC
AGAAGCTGCTCCACATCAATGCCACCGCCCAGCTGGAACACCCCGAGTATACCAGCCCCC
TTTTGCCGGTCTCAGCCTTGGTCCCCAGGCTCTCAGCTCTTGACAAGAAGGTGACCCCCT
TGCAGAAGGAGCTGCAGGAGACACTGAAGGGACTGCTGGGGAGCTCCGACAGGGGCAGCT
TCATGGTGGCCACGCAGTACGGCTGGGTTCTGGGTGAGAGCTCCCCCTGCCCTTTCCCAC
CTCGTCGGGGTGGAGGCTGATTCGGCCTGAGACCTGCCAGGACCCCCGCAGTCCCATCTG
AGGGCTGTTCTCACCTGCGCCGTCCGCAGCAAGGGCTGGCCCAGAGAACTGCAGAGACGC
TGGTCTCCAGTCTCCAGGGTCTCTGTCCATCCGTTGCTGGGGGCTTTCAGCCCACTTGGT
CTCCAGGAGATCATCCCCAATGTGTTTTCATCCCATGCCCCTTTTTCAGATGCTGAGGTG
CTGCTGGACGCCGATAGCCAGTTCCTGCCCCTGAGGGACTTTGTGGCCCCTCATCTCGCC
CCACCCTCCGGGAGCCAGCCACTTCCCCCTGGGGCCAAGAGGTAAATAGTCCCTCATCTC
TCCGGGTGTGTGCGCTTGGCTCTTTGGCATTTCTCTTCCCCCGCAAGGGCCTGGGAGAGC
TATCAACGCCCATCATGCCCTCCTCCCCCCACCAGGCTGGCCTTCCTGCGCTGGGAGTTC
CCTAACTTCAACAGCCGAAGCAAAGACTTGCTGGGGCGCTTTGTGCTGGCCCGGCGACAC
GTGCTGGCTGCTGGCTTCCTAGTGGTAGACGTGAGTACCTGGTGGATTTACCCATGTGGG
GCCAGGAGCTGGGCAGGGAGCAAGGCCAGGCCTCGAGCCAGAGGGTGCACAGATGCTTAG
CCCCCAGCTCAAGGTCAGCCATATTAAGGATTCTGTCTTTACATAGGAGAAAAGGGGAGC
TCGGGAAGTGTCATATTTTTTTCAAGATCACACAGCTTTTAAGGATCAGAGCAGGGCCTC
GGGTGCTGCTCCCATCTCCATAGCCAGGCCTCTTGGAGAAGGTGAGGCTGGCAGGATGCA
TGGGCTGCGCGCAGTGTGTGCCCCACGCGGAGCTCTGCACTGTGCTCTGGCCCCAGGGCC
TTGGCTCCAGGTTCTCAGCTGGGAAACCTCTGCCACCTCTTCCTGCTCTCTTCCAGAGAG
CCGACTGTCCTGTAAGGGCCAGAGAATACATGAGTGGCTTCATGGAACACATGAGGGTTT
TGTCACTTTTTTACTTTGGGTGGTGGGGGTGTTATTTGTTGACAATTCTTTAAAAGCCTT
GGGCCCCATGTAGTTGCTGCTGGCCATTGGCTTGGGCCCCTGCGGCTCTGAGCACTGACG
AAGCCAGGGGCTGTGGTGCAGAGCCTGCGCTGACCCTGCTCCTCCCTCTCCCAGGTCCCG
TACTACGAGTGGCTGGAACTCAAGTCTGAATGGCAGAAAGGCGCCTACCTCAAGGACAAG
ATTCGAAAAGCAGTGGCCGAGGAGCTGGCCAAGTGACCTGTCCCATGGCATGGACTGCAT
GCCCAGGGGGCTGGACTCGCCCAGCTCTGGGCACTGGGTGCACAGGAGGTGGCACGCCCG
AGGACAGACCTTAGTGCAGGACCGTGGCCTGAAGTGGGGTGCTGGCTGGCAGCCCCAAGT
GGCAGATTGCCCTCTCGTGGGAAATAAATCTTTTACTTTGGTGTTTGACACCAGGAGGCA
TCCCAGGCATTGTCACAGCTCTCCACCATGCACCCCACTTTCTTAACCACACGTCTCTGC
TCACGCGGCCAGGGAATGGCTGGCTGTGGCTCTGCCCTGGGCGCTCTCCACCCCCGTCAG
CAGGACCTGCTTGCCTGAGAGGCAAGGAGCCATAAACGGGGGCTGGCTCTTCAGAATTCC
CCTGTCACTCCAGCTGCTCGTCTGTCCCAGCTTGTCTCTGCCACCCACGGAGACCCTTCT
CCCATACATTCACACGTGGCCGGCCTGTTCCTTAGGGCCTGCAGTCAGCCCAGGTCCTGG
AATTCTGAATCTCAGTGTGAGGACCTTCCCAGGGAAGGCCCCTTGGGTTTGCAGTGCTTG
GCTTGGGGTTCTGTTCATCGTGTGGTAACTGATCACAGTTGTCCTGGGAGGTCTCCTCCC
ATCCATGGTCTCGGGTGACTGGGGGGACCCCAACAGCCTGTACTGACAGGTGGCATGAGA
GCTGGACACTCAGGAGGCACTGGCTCTGGAGTAGAAGACGAGCGTGCTGGGCTGCTGCTG
CCCGGTTGAGAGAAACCCCTCACTGTCATCACCCCAGACCAGGGGTTCGTGTCGTGGGAA
CCACTTGCGTGAGCCCAGTACCCCTTCACCACAGCAGCAGGATCGCCAGATGCTGGGAAA
CGAGGCTTTCTCCCTTCCTGCTTGCAGCCCGTTGCTGGAGACTTCCGCAGGCAGACCACT
AGAGGGGAGGCAGTGTTGTCATTTGCCCCCAACAGTACAGAATGGAGGGAGGACTGTGGG
AGTGGAGCTGAGCAGAGAAGGGCGGGTGCACTACCCCAGGCCCCTCCATCCCGGCCATTC
CCCACCCCCTCCCAAGTGGTCCCCCAAAAAGAGCCAGTCCAGTCCCTCCTGCTTAAAGCC
TCACCCCTCACATGGCCACTGGGGTGGAGGGCCAGCTGTCAGGCACCACACACAACACAA
GTCTGTTATTTGCATAGGCTGGCGGAGGGGGGTCGTCTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1414, 4110..4433, 4986..5157, 5440..5597, 6251..6361, 7231..7375, 7767..8012, 8269..8380, 8495..8609, 9234..9538
1001..1414, 4110..4433, 4986..5157, 5440..5597, 6251..6361, 7231..7375, 7767..8012, 8269..8380, 8495..8609, 9234..9332
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved