Equus_caballus Locus Q6X9Y5_HORSE
snOPY snoRNA Orthological Gene Database
Equus_caballus Q6X9Y5_HORSE
Equus_caballus
Q6X9Y5_HORSE
10
SNORD101, SNORD100, SNORA33
1716..1788, 2962..3038, 3393..3522
4737
TCATTAATACTTGCTCACTGGCTCGGCGACTTGTCAGGAGAGGAAGTTACAACGGAAGG
AAAAAGACTACGTACTGATCATACTCGGCTGTGTTTCATGCATTTGCTTTGGAAATGGGG
CTGGGGAATGGCCAATCTGCAGAATTCAAAACGTTGATTCCTGGGAAAATCAGTTTTAGG
GTTTTCGGATTGCACTCCCGACTCCACGAGTGCTGGAGGGCGGAATAATGCCGCATTCCT
CGAAACTGCCTTTTCATCTCCTGTTCCCAGAGCCCATCCCTGGGGCCGGTACACTGCAGG
TGTGTTAAATGCACCTGTCAATCCCGAGGAGAGCGGGATTGCGAACCCAGGGGACAGCCC
AGCGTGAAAAAAGAAAAAACAAAACCCTTCATTTAGAACCAGCCACGTGGCTGAGGTTCC
ACTTTACTAACACTACGCAGGAAAGCGGAGTTTGCGATGCGCTTACAAGTCATGACCACG
TGTTGGCTTCCGTTTCATACACACACACACACACACAGATGAGGATCACCCACAGAATGG
CACATTCACGGCCACAGGGAGTGACTGAGAAGCGAGACAGCGTGCAGCGAGTAGGGCCCA
GCTAGAGGTGTCGGCAAGAATTACAATACGGCGCGGAAAGGGTTAAAACCCGGGTTCTGA
GAAAGCCAGGGTTCCAGGGAGCCGGCAGGACCACGCGGATGAGGCGTTTGGCCCTTCTTG
CGCTCCGTAGAAGGAGCACTCGGGGCCTACGCAGGCCCCGTCCCCGGCGGGGAGCTCCGA
TGCGAGGCTGCCCGTGTCGGTGCCTGTTGCGAGTGCCAAAGACGGGCGGGAGCGGCGTCC
GAAGACTCGCAGGACCCTCGTCTCAGGACCGCCTCCATCCGGAAACAGACGTGTTCGGGG
CCCGGCACCGCCAGAGACACCTCTTTCATGGCCGGGAGTGCACATGCGCCTAGGGGTCCT
GGGACGCCCTTAAATACGGTTCTGCTGGCGCATCCGGCCTCTTTTCCTGCCACCGCCGAG
TCGCGCGGAGGCGGGCGCACGCGGTGAGTTGAGCCGGGCGAGCGGGTGGTTCTGGTGCGT
GGCTCGGCGCCTTTGGCTGTGGCTGGCCATGAGTGTCTGGGCCTAAACGGAGTGTTTTTG
CCTTGCTTTTTTGCGTTTCAGTGCATTCAAGATTCGGGTCCACCCGTAACCCACCGCCAT
GGCCGAGGAAGGGTGAGCCTGGGGCCGGGGTCGTGGTGCGGGTGAGGCGCGGGCTCTGAG
GCTGCTTGGCGCCCTACGCGCCCCTGATGGGGTCCCCGGTGGTTGCCGAGTTCCGGGCGG
CAGGTGGGGTGCGGGAGCTCACGGAAGCTCTGCCTTGTTGGTTACAGCATCGCTGCTGGA
GGTGTAATGGACGTTAATACCGCCTTACAAGAGGTGCTGAAGACCGCCCTCATCCACGAT
GGCTTGGCACGTGGGATCCGCGAAGCTGCCAAGGCCCTAGACAAGTACGTGTCTCGGTCT
CAATACTGTGGGTTGTTGGAACCGGAACAAAATCTGCAGCCGATGGAAGAAAGCGTGACG
TTCATGGTGTTAGGACACGAGTTCTGAATGGCATCGGTTCTACAGGAAACCTAGGAAAAG
GTATCAGGACTCAGATCTGTGTAGCCCGCTTAGAGTTGGTGGGTTTCTGTTTGGAGTGGG
ATGAGCACTTGATTCTCAACCAAGTAAAACTACAGTGTTTGGATGATGACTTAAATTGTC
GGATACCCCTTCACTCCCTTTATGAGTGAAACTTAATAGTCTGACAAACCTGTAGGTTCT
GGGGCTCATTTCATGGTATCTGGAAAACAGATGGGGACCCTCGTTAGTAGTTTGCAAACC
TGAACCGTTAAGTTAATGGGATTTCAAGTTAACGTTTGTTGCACAAGTATCTGTAATTTC
ATATGGTTTAGTAAGTATAGTAGCTGTAGAAACGAACGTAAATGGAACATTTGTGAATAT
GTTTGGTTGAGTTTCTGACTGGTGACGTTGGCAAAACTGCATGCTTTAACTATGTGAGCT
GAATTTAAATGTACTTTAAGGACTAATGAGCCAGATAAATTTAAGTCAGTTAAATTCACT
GGGGTGTGGACTGGCCAGTTGCATCCAGTGGAAACAGCACCCCTGGCTGGAAGTGCTTCA
CCGTCGGTGCCTGAGCAGTGCTGCACGATGTAGGTACAGTGTCTGGGCCTGTGGCAGGTA
ACTAATCGAGTAGCTCGTGCTTCACGTTAACAGCAGTCCTTGGATGTGTAAGACTGGCTT
GCAAGAAAGCATGTTTTTGTTTAGGCCAAAAATTGCTAAACTAGTTCCCCCTTATCAATT
TGGTATTTTTAGGGGTTGTAGAAGACAGAGCGTTTCTGTAGGAGAGTTAAGTGAACGCAT
GCTCTGTAACAGCCTCGTCAGGCTGAAGCAGTGTTCTCTTCCAGTGGGTGTGCTCATGCT
GTTTGGTCAGAGTAGCCCAGGCGAGGGTAACTGCCCTGTAAGGTGCAGGAATAGTGGCTG
TAGACTCGAGTCTCAGCTCCTGCTGTTGGATTTTGCGTTTCAGGCGCCAAGCCCATCTTT
GTGTGCTCGCATCCAATTGCGATGAGCCTATGTACGTGAAGTTGGTGGAGGCCCTCTGTG
CCGAGCACCAGATCAACCTGATTAAGGTAAGTTACTGCCCGATCTGATGTATCTGAACTG
TTAATGGACGCATTAGCTTAATGCTAGTTGGGCCACTTAGGATCGAAAGTCAGGATTAAC
ACATCCATGGTGATGTCATACCAGAGCAAATTCTGGAAAGTGTTGAGCTCACCACTCTTC
GGGTGTGAAACATCACATAAGCTTGAAGTTGTTGGGTGTGCTAAAGCTAGTTACAGAAGC
ATTTTATTCCTGCAGAATTTAGTGCTAGTTTTGGTGTTGGTATGGGGTAAATCAAGTTAG
AGTGTGTGTAGGTCGTCTTGGTGCTGTGCATGATGACAACTGGCTCCCTCTACTGAATTG
CCTTGAGGAAACTGCCATGTCACCCTATCTGACTACAGCTACCTTTTGGGTTTAATTTAT
TGTCAGTAGCATTAATGTGTGCTAATATGGTGAATTTTTTGTATTGTTATTCCCCAATAG
GTTGACGACAACAAGAAGCTGGGGGAATGGGTAGGCCTGTGTAAAATCGACAGGGAGGGA
AAGCCCCGCAAGGTGGTTGGCTGCAGTTGTGTGGTGGTGAAGGTGAGTCAGATGAGGGAG
CTTGGCTCCGGGATGCAGGGTGTGCTGGGGAAGCATGCGGAACCTCCTGCTGAACCCAAG
TTGTTAATGAGAACCTCTTAAAGGGGAGAATGAGTGATTCTCAACAGACTTAAAACTGTT
CTTCCTGTGAGAAAGGGAAAATAAGCCATAGTTAAGCCAGCCAATGAATCTGCTTACCTG
AATGTGTTTTGGCAGAAATTTAGAGCAAGCTGGCAATAGTAAAGCCATGTTACGAGCCTT
AACGACGTTGAAGTCGTTAAGGTCCCTGAAAGTGGCCACAAGAAGTTGTAATGACGGGAG
GCATTCTCATAAGACATGAGCCAATTTTTTTAAAGCTCTTTATAATTAGTGCTAAGAACT
TAGTGGAATTTCTAAATATTAGTAAAAAGTCACTTTTTTTTTTTTTTAGGACTACGGCAA
AGAGTCTCAGGCCAAGGATGTCATCGAGGAGTACTTTAAATGCAAGAAATGAACAAATAA
AAAACTTGACTTTTGCTCATCTCTGATTTTTTATTTACGCAGTAAGATAAGGTGAGGGAC
AAAAGATAATCATTGCAGAATAACTGGAAGCATGCTGTCTGTCCCCTTCTGGTCCCAACC
AGTAAGTAACTTCAGAGTGGAAAATTAAAACAGTGGCCTAAGCAAAGATAGGCTTAGGAT
AGTGTATTGGTGACAGCCCAGGGTTTTGTGGTTGTGAGCATATATCAGAACTATGGCTAG
GCTAGCCTAGAACCTGGAGAAATGGGCTGAGGCTGGTCAAGGGAGAGTTAATGAGTTGGA
GTCCTCTAGCTGGACAAGTCGATAGGAAAGTACAGAGGTGGGGCAAGGTTGGATTTAGGC
TGTGGGCACTAGAAACGCATCGTGTCCAGGAGTGCTTGTGGACATGACATTGGGAAAGGT
CGGGGTGTCCATTGAGTTCATAAGTTACATGTTAGGCAGAGCAGCAAGAAATGCTCCAAT
TCAGTGTACTCGAGTCCCTAAGACTCTCACACGGTTGTATCTTGCTTATTGTATCTTGCT
TATGGGGGAAGTGTTCTGAGAAATGCGTCATTAGGCAGTTTTGAACGTGTGAACATCAGA
GTACTTAGACAAACCTGGATGGTCTGGTCTGCTACACACCTGGGCTGTCTGCTACTAATC
CTGTGGGACCATGGTCCTATCAAGTTGCTATGTTAGCAAGGAAGTCTGAATTTTGGAATT
TCTGGGAAATCAGCGACTGAGGTACTGTCTCCTAGTTTGCCAGTCCTGCTGTAGTGTCGC
TGGCGTGTGTTGTGAACCTGTGAACTTGAGCAAGATCTGGTTCTGAATGCTCACTTGAAT
CATTAGTGGTTTGTTTGGCATCTCGGGAATTTACAGGTTTAAAAGCATTCCTCCAAAATC
TGCCTATAAACATGTAGAAAGCTCTGATACGACTGGAGGCTGGCTGTCCTGCGCTCACAA
CCTCTCTGAGGTGCAGGGAGGGGCCAGGTGGTTTGTAAGCATGTGAGTGGGCCCAGTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1042, 1161..1211, 1367..1483, 2563..2665, 3120..3221, 3649..3737
1198..1211, 1367..1483, 2563..2665, 3120..3221, 3649..3708
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved