Equus_caballus Locus RPS11
snOPY snoRNA Orthological Gene Database
Equus_caballus RPS11
Equus_caballus
RPS11
10
SNORD35
2159..2246
4066
CGGCAGGTACACAATAGGTGCACAAAAGTGTGGGCTGACTATAAAAAGGACACCAGGGT
TCCTTCTTTAAAGGTAGGTTATCAAGAACTCTGAAGCCAGACTGCCCACCTCTGCCTCTC
ATTTTCTGCGAAACCTGGAGCATCTGTGCCTCAACTTCCCCATCTAGAAAACGAGAAGAA
TAATAGACTATTAGCACAATGCCTCTGGCCCATGGCAATTGCTTCCTAAGATTCTGCTTC
CTAAGAGTTTCTTAAATAATAAATTAGTATCCAGTTATAGATCTACAGTGCCCAACCCAG
TAGGCATTAGCCCGATGTGGCGATTTAAATTTAAATCTAACAAAATTAAATAAAGTTAAT
TCTGGTCCTCAGTCGCACAGGCCACATTTCAAGCGCCAGCGGCTACCGCAGTGGACAGCG
TACATATGGCACATTTCCATCACAGCGGAAAGTTCTATTGGACAGCGCTGTTGCAGAGAG
AAAATCAGCAAAAGGGCTTTTTTCCCAGTAAACTATTATCTGGGACACAGGGAACAATTT
TCATTAAACTTCAAAAAGCTCAAGGGCAATGCCCGCCCCTCACAAAGATGGCGGCGTCGC
CCGCCCCGCAAAAAGATGGCCGCAACCACCCCGGATACAGCCACGCGGTCCCCACACCCA
ACATGATCCTAGCCCCGCAGAATCATGCCCGCCTCCCTATAACTCTCGCGATAATGTAGA
CCGGGCTCAAGGCTGACCACGCCTTCCCGACGTGAATTAGCGCGCCAGTGCAGGGAGGCC
CTGACTATCGCGAGACAGCGTCCGCGGCTTCCCTCCCCTCTGCCCTTAACCATCATGGCG
GCGTCGGCGCCGTCTCCGAATTGCGTGTTTGGTGAGGGCCGCCCGTCAATCAGAGTGGCG
CCCAAGGCACCGCCCCAAACCCTGCTGCCCCTCCCCCTTTCGTCACTTCCTCTCTAGCCC
CTGCGCAGCCGATAAGGAAACCCGGGCGCCGCGCGGCTTTCCTTTTTTTCCGGCGGCCGG
GAAGATGGCGGACATTCAGGTGCGGGTTCAGGGCTGGCGCCTCCGCTTATTGTTAGCCCG
GGGCGTCCTCGATCGCCCGGGGGTCCACTCGAGCAGAGGACGCGTGTCTGCGTTAATCTC
GACCGGCGCCTCTTGCACCCTGGGGGCTCCGCACATGGAGGCTCATGCCTTTTAGAAGTT
GTCTTGTTAAGCGTCCCGGTTTCCGGGGTGGTTTTCTGCAGGCCGTGGGCCTTGGGGTTA
ATCCTTTTGAGTATAAGGGTTCATCCGGGGAGCCCCTCGTTTGGGTATTAATTCTGCAGC
CGTATATCTCAGCTAAGGAGCGAATCCCGGGTAGGGGTCCTGGTTTCTCGCAGCATAATT
TATGCTGAGCGGTGTCCCGGGTGTTAGCGGGATGGTTCTGTCCCTATGGGTTCTCAGGGG
TGACTTCTGCAGGCGGTGGGAGGTGTTTTGGAGCGTGAGCGCTGAAGTGACCCCCAGGTT
CAGGGCTGAGTGTGAATGAGGAGTGGATTTGTGGTGAGAGTGTCTTAGAGGGTCATTCTG
GGTCCTTGGGCCCTGGAGGAGCGTTTGGGGAGTCCGTGCTGGAGAGGAAGGATTTGGGGG
TTCCTAGAAGGCTTCCAGACCTGGTGGCTGACAGCTCGCGATTTACCAGCTCACCAGCTC
CCTCCTCCTCGCAGACCGAGCGCGCCTACCAGAAGCAGCCGACTATCTTTCAAAATAAGA
AGAGGGTCCTGCTGGGAGAGACTGCCAAGGAGAAGCTCCCGCGATACTACAAGAACATCG
GGCTGGGCTTCAAGACGCCCAAGGAGGTAGGGGGACTCTCAGAGGAAAGAGTGAGCCCCA
CGTGTGCCCCGGCTGAGTTGCCCTGCCCACCTCTGCGTGGCTGCTCCCGGGGCTGCTGGG
AATTGTAGTTCTTGTCCCTGAGGCCACGCCCCCTTTTCTTTCCAGGAACTACCTGTTGGA
GGCTCACTCTTTCCTCTTCTTTTTCAGGCCATTGAGGGCACCTACATTGACAAGAAATGC
CCGTTTACCGGTAATGTCTCCATCCGAGGGCGGATCCTGTCTGGTAAGTGGGCACCTCTG
GGGGCCTCCTGGGTTTGGGGGGGCTGGGGACATGCGGACTCCTGGTTCCAGGGGTCACTG
GCAGATGATGTCTGTCCTCACGATGGTGTGCAGATGCCTGCCACGGGCACTGCTGAGAAA
GCCGCTTGGCACAGCTAATGCCAGAAACAGAGCTCTGCAGCTCCCGATTCCTGGCATGCC
CTGGGCGCTCCAAGGCTCCTCCTCCTCGGGTTGGGGGGAGCGCCTGACCACAGTCTGTCC
CCTCCCCGCCAGGTGTGGTGACCAAGATGAAGATGCAGAGGACCATTGTCATCCGTCGAG
ACTACCTCCACTACATCCGGAAGTACAACCGCTTTGAGAAGCGCCACAAGAACATGTCCG
TGCACCTGTCCCCCTGCTTCAGGTGAGCACCGGGGTCCCCCAGGTGGCCCAGGCCAGCCA
ACCTCCGAGGCAGAGAGGAAGGGCTGGTCTGCGCTCGAGTCTGAGTGACATGGGGCCTGA
CCGGGGCTTGCCAGGATGCCCTGGCTGCGGGGGGAGGTAGAAAGCTCTTGGGAACGGGGG
CAATGACGAGGCTGCTATAAGCAGGCCACCATCCTTGGGAACCTCGAGTTTTGTGTCAGA
TGGAGAGGACCTGCCGCGAGAAGTCCGGGCAGGTTAGTATCCTCTCCAGCATTGGGCTGG
GCACGCGCCTTGCACATAGTTTGTGCTCAATGAATAATGGCTAGGAGGCAGATGGAACTG
GACATGTGAGGCTCTCCTCTGGGGGCTCCCCTCACCCCCCCGTGGTGACACACCGGCTGC
CCGCCTCCACAGGGACGTCCAGATTGGCGACATTGTCACAGTGGGCGAGTGCCGGCCCCT
AAGCAAGACCGTGCGCTTCAATGTGCTCAAGGTCACCAAGGCCGCCGGCACCAAGAAGCA
GTTCCAGAAGTTCTGAGACGATGCCTGCCTGCTCCCCCAAACAAAATAAAGTTATTTTCT
CAGCCACAGGCCAGGCTCGGGGTGTCTGCCCTTCTTGGGGGAGGGGACTGCCTGGGAATT
GAGCAAGAGGTTGAGGTGAAGGAGGGGTTCGTTTTCATTCTCTGGGGGCACAAGGATGGG
AATGGGAGCCACATTCTGCCTCTGGCTCTCATCTGCGGGTGAAGACAAAAGCCGTGTTGG
GATGCTGCCCTTCTCTCTGCGTCTTCTCTTGGTGTCGAAATAAATAAGTTGTTCTACCTG
TCGTCGAACTGCCCCCCCCCCCCCCACCCCAGTCTCTGGGGAGGAAGTGAGTGAGGGCGG
AGGCTCCTGGGTTCTCTAGACTGGTCTAGGCCCTTTCTGGCCTCCGTGGGGACGGGAGGA
GGAAGAGCCACACTCTGGGCCTCTTGGGGGGTTGGGTGGGCTCGACAGGTCCACAGTCGC
CTGGCTCTGCACTATGGGGGTTTTCGACCTGGGCCTCCTTGTCTCCCCAGACAGGGACAG
GGTGGGCCAGGGAAATAACGCAGGTGCTCTCCCCTGTGAGCCCCACTGCCCCCACCTAAG
TGGACATGATGCCGGGTCACAGATGAGCAGACTCATCCAGGGGGCGAGTTCTCTGCCCAA
AGTCCTAGGGAACAGCTGGGCTCCAGGCCTCAGGTTCTGGAAACCTTTTGCCTGAAAAAT
CCAAGTAAGGAAATTGGCCTCGAGAGCAAGTCTGCCCGGGAGGCCACCCTGGAGCCCCCC
TGGAACCCAGCTCGGCCAGGCGGGGTTGCGGGCTGCTCAGAAACGGGTAGGGAGGCCCTG
GAAGTGGGACCCATGGGGAGTAAGGGAGGGAGGGACAGCCGGGGTGGCGGGGGGCACCTT
GGGTGAGGAGAGACATGGGAGATGGGAGAGTGGGGACAGGGCCAGGCAAAGTTAGGGTAA
GATAATGGACAGCCAGACAGCGACCTTGAGCCTCAGAGGAAAACGGGAGAGGTTGACAGT
TAGGAGGGGGACCTTGAGTGCCAGATACAGAAATGAGAGAATCAAGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1038, 1694..1825, 2007..2082, 2352..2481, 2892..3066
1024..1038, 1694..1825, 2007..2082, 2352..2481, 2892..3012
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved