Equus_caballus Locus ENSECAG00000015832
snOPY snoRNA Orthological Gene Database
Equus_caballus ENSECAG00000015832
Equus_caballus
ENSECAG00000015832
10
SNORD32, SNORD33, SNORD35
3154..3235, 3864..3948, 4432..4518
6149
CCAGGCCTGTCTGTGCATGGGACAGGGTGTGGATGGGGCCGCTGGGGTCTGAGTCTCGG
TTTGGCAGTTAATGCAATGTTTCCTTCAGTACCTGTTTTCTGGGGCTTCCGGGGCTCAGG
GCCAGTGCCGGGCAACGCTGGACCCAGACGAGAGTCAGAACCAGCCCAGGTCTATGGGGG
AGAAGTCACGGGACCCCGAGAGCCTTAGGACAGGATGACACACGCTCTGATGGAGGTGGC
GCAGGCACCGTGGGAGCCCGGAGGAGGCAGGTGACCCAGCCTGAGACACAGCGGGGCTCT
CTGGAGAAAGGACTCTGGAGCCAAAGGGCAGTGGGACTGCGACAAGCCAGATTCTAGACG
GCGGGGGGTGGAAGGGAGGGGATCCCAGGCACGGGGCACAACCGAAGCAAAGGCCTCGCG
TCTAGAAAGTGAGAAGCTCCTTTGGGGGCCACTCAGGCACTGAAGTCGCTGCTTTCTACA
CCCTCGGATGGCAGAGGGATGGGGACACTGAGGCCAAGACAGGGTGTGGGGTTGGGTCAA
GTCGCAGGCAGGAGGAAGAGGCACCGCAGCCAGATCTCAGCCTAGACTGAGCGCTGAAGG
GCGAGCCTGGATGCCCCCTGCGGGCCACCACGTGCCCAGCAGCCTGCTGTCGCCGGAGCG
GGTAACAGTCCTTCCCCACGCAAACCCACCTCGTGTGCACTGAATGAACAGCCCGGCAAA
ACTACGGCGGCCGAGGCGGGACAGCCCCGCCCCAGCAGAGCCGCCCCCTCCCCAGCCCAC
GTGACCTCCCGCCCGGCACAGCCATGGCCGCCCAGGTCCGACGGAAAGGACACCGGATTG
GACAATCAGAAGAGGCCCTGCCTTCTCAGCTGTCTCTCTGCGCACGCGCAGGACACTTTG
GCCAATGAAAAGACAGAGAGCTGTCCGCGCAGCCCGTGTGGCGTCATTTCCGCCGCTCCC
TTTTCAGGGATAAGAAACTCTTCGGCGCGACTTCCTTCTTTCCCGGGCGGCTGCCGAAGA
TGGCGGAGGGGCAGGTGCGAGCTCCGCGAGGTCCGGGCGGCGTGGGGCCGGGGGAAGTCC
AACCGGGGACAGCATTGGGACTTACTTCACCTTCGTTTGTGTGTCTTGATACTTTAGCTG
GATAACTGAGCAAAACTGGGAGCTTTGGGGGTAAGAGGAATCTGTAAGCAGGGAATAGGC
GATCCGGGGAGAGTTTTTATGCCCGAGATTGGCTGAAATGCGGCATCATTCCTCCCGAGA
GGCGATGATGGGGCTTCCGGCAGGGGGAGGCTTATTTTTAAATTGGGCCTAGGTTACTTT
GATTTCGGCCAGGTTTTGGCCGGATTGGTCCCATCCAGTGTCCCCAGCGGCGGGGAAGAC
AGACAGGCAGCCTGGGGGTGATGAAAGGCCAAGGATTGCCCAAAACGGGGGGTACTTGCA
CCCTGCCCAAGGCACGGATTGCTTCACCCTCACGTGGGTGTGCTAATCAGCGTTCCTTTG
CAGGTCTGAGTATTTTGCATTTGTAGGGGAGCAGAATTGGCCACCCCTAAATATGTTATT
TGGGCATAGGGTTATTTTTAAGAGGCCGCAGACAGGAAAAGCTGTGAGAATTGTGGAAGT
TAAGTCTCTCCGGTAGAGACCTTCACGTGTATAAGAGGAATCTCCTTTGGGAAGAGAATC
GCGCTGTAGGAGGAAGGGGAGAGTGACACAGTCTCTAGAAGTTTTTCAGTGGAGAACGTG
TGAAGTTAAATCTACGTAACAAGTTTACCCTTGTTTATTGTGCTTTTCCTGGGAGCCTCC
TGTGACTTCCCACCCCCAGCGTCTTTGTTTTTAGCTGGCGATGTTATTAATGTGGTGATT
TTGGCAAGTTACTCAGTTCTCGTGGGTCTCTCCCATGTGTACAGGAGGTATTCGTGTTAC
TAGGCTGTAATTTTTTTTCCCGTCAATCTGTTTTATGTCGATTTTTAATTTTTAGGCCAG
CCAGAAGGACTTAGAAAGGTAGAAGGAAATTTGTTTTCTGAGACAGCGTGAAACCTTATG
CAACAGGTCCAGGGGGCACCTCCCTACAGGGCATTCGGGAACGAATTGCTCTTTTCCTTT
GCTTTTGGGGTTGATTGATGCTTTGAAGGCCTGTTGCTGCTGGAAGCAGAGTTTGTGATA
AAAGGCTCCCCCCAGGTCATGCTTTGTCCTTAAGCACCTGGAGGCCTTCGAGGAAGACAG
CAGAAGCTTAGCTCTGAGTGCCCTGCCTCCTTGTGTAACTTCATGTATATATAAAGGACT
TAGAATGCTCCTGGCGTGTGTTCCTCCATTTATTGTGTGTCTGGCACAGTTTGCGTTCTG
TTTTGTGTAAGTTGATTAATTTCACGATATTCCTGAGGCAGGTGTTGTCACTCATCTTAG
AGGTGAGGAAGTTGAAGCCTGGAGAGGTGAGGGTTTGGGCCAGTCACCTCGTTAGCAAGT
CTGGCTTTGGATTCTGTTTCTTTCTTCACTGTCTTCTGATAATCACAAAACGTAACAAGC
ATAAGAGGAGGGACTTTCGTTCCTGATGAAGTTGAGGGTTGGCGTTTGAGCAGTTCGACT
TTGTGTAGCCTCACCCGCTCTGAACCTCCGTTTTCTTTGCTGAGATATTCATGCTAGAAA
CTGCTGTACTTTTGAGATCACGAGAGAGTTAAGTTTCTTGGGCTTCTGCTCGTATCACAG
AGCATGGGTTCTTCCACCTGGAGCATCGTGGGCTGAGTGTGGCCAGTCTTGTTCAAATCC
TAGCTCGTCCTGTTAGCCTCAAACCTAACCTGGGCATAAGATTTCCTGCCCTTGAAGCAG
CCAAGATGTGAGGGGGCTTCTTTGAAATGTTATCCCCCTCGCTGAAATCCTGAGTCAAAC
ACTTGCCCACCAAGGTGAACCTTGGGTGCGAGTTCCTGGGTCCTGGACCTGATAGGAAGC
ACCCTGGGGGACAGGCGAACTGGAAACAAGTAGAAAGCTGTTGACTGGGGTGGGATCAAA
GCTGTGGGTGCCTCTGACCCCTCTCGCTGTCTCTCTTGACAGGTCCTGGTGCTGGATGGC
CGGGGCCATCTCCTGGGCCGCCTGGCGGCCATCGTGGCCAAGCAGGTGCTGCTGGGTAAG
TGTCCCCAGCTCCCCGGACTCGAGCTCTGGCTGGAGGTCGGTGATGAGCAACAATCACCA
TCTTTCGTTTGAGTCTCACGACTGTGAGATCAACCCCATGCACCGCTCTGAGACCATCCA
GCACTCCCTCCCTGGGGCTGGGGGCTACAGGGCTGAAGTTTACTTTTGGGGCTGACTCGT
AATTCAGCTTGAATCCAGCTCCACCGGTTACTCCTCCGTGACTTGGGGCCGGAGGCTCCC
CTGTCTGGGTCTTCGGCAGTATCAGGGCAGGTGGATGGATGCACACAGAGCCCGTGGGTG
GCTTCCTAACCTTTGCGTCCCTTTCCTTTTCTTCTAGGCCGGAAGGTGGTGGTCGTGCGC
TGTGAGGGCATCAATATTTCTGGCAATTTCTACAGAAACAAGTGTAAGTTAGGGCATGGG
AGAAGGGCCAGAGAGTGTTGGCCTGGGTGGTGCTCAGGTCTCAGGATTTGAAAGCGACCC
CACAGCAGTGGGAGATGCTAGTGTGAGTTCCCAGACCGCCCTTGGGGCGTGGGTGTGGGC
TGGCAGAACTTGGCATTTGCCTGGGAGCTGGGAGGCCTCACCCGCTCTCCCTTCCCCCTC
CCCAGTGAAGTACCTGGCCTTCCTCCGCAAGCGCATGAACACCAACCCATCCCGCGGCCC
CTACCACTTCCGAGCCCCCAGCCGCATCTTCTGGCGGACCGTGCGAGGTGAGCCGGGCCC
GAGGACCGCGGGGGTGATGGGGGCTCGGCCAGTGATGAGGACTTCTCCCACTCGTGTTCG
AGTTTCCCAACCATGAGATGACTCCACATGCACTACCATCTGAGGCCGCCCGGCTGCCCA
CCGTGGGGGACAGGGCAGGGTCCTCGCGAGCCCCACTGAGCAGGCCTGCTGTCCCTCTGC
CCGCAGGCATGCTGCCCCACAAGACCAAGCGAGGCCAGGCCGCCCTGGACCGCCTCAAGG
TGTTCGATGGCATCCCGCCGCCCTATGACAAGGTGAGCTCGACCACGCCCTCACGGCAGC
GTGCGTGGGGCCCGGCGTCCGTGATGTTCCACAGTTACCTACATTGTTCGATCCTCGTGA
GAACAGCGCTGGCTGAGACGCTGTCCCGGCCACCCTCCTTCCCTGCACGCCCCTCGCTGC
AGGGCTCTAAGCCCCTCTCCTTCTCTGACAGAAAAAGCGGATGGTGGTTCCTGCTGCCCT
GAAGGTCGTGCGTCTGAAGCCTACACGAAAGGTGAGCGAGCTCCAGGTTGCCCTGAGAGG
CCTAATGGGGGCTCCCTGGCCCACTGGGGGTGATCTTTAGGTCCCCAAGACTGGCAGATG
ATGGCTTTTTCTCACGATGGTCTGCGGATGCCACTGTGGGCAGTGCCGATAATGCCAATG
GCTTAGCTGATGCCAGGAGGGGCAGGGAGCCCTTCTGGGGGGGGGGTCCTCAGCTTCCAG
GGAAAAATTGGAACATTAAATACCTAGGGTCCCCATTTGTCAGCCACTCTCCTATGGGCC
CCAGCCCCAGTCCCGGCTGTCTCCTTACAGCTTCACTCCTTCCCCCCTCAGTTTGCCTAC
CTAGGGCGCCTGGCTCACGAGGTTGGCTGGAAGTACCAGGCGGTTACAGCCACTCTGGAG
GAGAAGAGGAAGGAAAAGGCCAAAATCCATTACCGGAAGAAAAAGCAGCTCACGGTGAGG
GCAGCAGCCGGGAGTGGGGGCGCCGCGCTCCAGGCCGCGCCTGGTGGGGGATCGCTCTTG
ATGTCATGGTCTCTGTGGGCCCCTGGAGGGCTCTGCGTAGGGTTCCGCCTGGGGTCGGGA
GTGGAGTCAGGTCCCTCTCGTCAGGGTGCTCCTGGGCGGCAGTAGCCGCTGATCCTCATC
TGTCCTCTTAACCCCACAGAGGCTACGGAAACAGGCTGAAAAGAACGTGGAGAAGAAAAT
TGACAGATACACAGAGGTCCTCAAGACCCACGGACTCCTGGTCTGAGCCCAATAAAACTG
ACTGTTAACTCCTCATGCTTGGCCTGGCCTGCCCTTCCTCCATCGCCGCCCGCCCTAGGA
TGTGGGGGACACCCCGGGGCCGCTGTCCAGGCACCACAGGCAGCCTGGGCCTTGGCAGGC
TGGGAACACAGAAAGGGCCGTAGAAGCACTAACAGCTGTAAGCTGTGCGGGCGTCATGAC
GTACTTGTTCTTGAGAGCTCTAGGAAGGCAGCAGTTGGAACCATCAGTTCAGTTTCAGTA
TTTGAGCTGAAACCTTTTACGTTGTGAGTGGGGCGTCCGTTTAAACGGCCCCCGGGGTCA
CGGGCTATACTCTGCAGCTGTCAGAACGTGAGGGGTGCTGGGGGCACTGAGCCTGGCGCT
GGGCGGAGGCGGTTGTAGATCCGCAGCTGGGAGGTACAACCAGGGAGCCGCACTGCCCTT
GCACCTTCCCTGGACTTTGTGATCAGGAGCAAATAAATTACTTTTCAAGCAATTTGGCGT
CTTTGCAGTGTGTGTCTGCTCTGGAGGCAGGCCCTTGGCAAGAAAAGGGAGCTTGCGTAA
AACTGCCTGTGCTGCAGTCTGCACAGAGAAATGTTGCTTGATACCTGCCCTTCGTGGCAG
AAGATTTGTTGAGATTTACACGCTAAAGAATTTCCTTGAAGCCAGTTATTGGTATTTCCC
AAGGCTAGCACGGCCTGTGTGGCCCAGTTTATGTGGAGCTCGCTCACTTTCATGCAGCTG
CAAAGTATGGAACTACCATTGTGAGCCGGTCCCCCACTGCGGGACGTGGGCTGTTGCACA
CTTAGGCCGCACCGGGGGGCTGTGCTTTGTGAAGACATTTTGCAGGTGGTATTTAGGCAC
TAAAAGTGGGATATGAACGTTACTGGCATCTTACCTGGAAGAAGACTAGGCAGCAGGTTA
GGTCTGTCCCGGGGGGCCCCCGAGGCTGCTGGCATTTAGCGGGTACCCAGCCCTCTGCCG
TCAGCACTGGCCACCTCCATCACAGCCTCCCCTGCTGGGCTCGGGCCCCGTATGCACATG
AGGTTTCTGTGGAGCCTCCTATACGGGGTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1033, 3042..3114, 3457..3522, 3725..3826, 4026..4111, 4291..4350, 4671..4793, 4999..5149
1019..1033, 3042..3114, 3457..3522, 3725..3826, 4026..4111, 4291..4350, 4671..4793, 4999..5082
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved