Equus_caballus Locus ENSECAG00000015258
snOPY snoRNA Orthological Gene Database
Equus_caballus ENSECAG00000015258
Equus_caballus
ENSECAG00000015258
21
SNORA68
2119..2251
3878
GGCCGGCCGGCTCGGGGATCGCGGGGGCGAGGGAGGCCGGGCCACCTTTCCAGGGCCAG
GGGCAGGTTCCCGCGGCGGGGAGGCTCGCGCTGCGGGACCTTGTCGAGCCTCTGAGCCTC
AGTTTCCCCATTTGCAAAGCGGACCAGGGCGAGGGCGGCAATAGTATTCCCTTTTCTGAG
AATGGCTGTGAGAAGTAGGAGGGAGTTATAGACCCGAGCTCACGCGGGGAGTGCGAACCT
GATCTTTGCAAGTGCTGGGTGAGACCAGGGAGCGTGACGACGCAGAGGTGGAAGAGCAGA
TCCTGGGGAGGAACAGGGCGAGCGGGTCATGGACAGCTCGCCAGCCTCAGTTTCCACGCT
GGGAAAGAGGCCGATGAGTCTCGTTGAGAGGTGTAGGTAAGAGCCCAGTGTACCATATTT
GCGGCTGTCTTCTATTAGTGTTAGTGAATTGGTGGCGAGTCATTTCCGGAGGTGGCTCTT
TCCAGCCGTGTCACAGGCCTTGGGCTGCAGCAGGGGAAACTGAGGCAGCCGCGAGCTGAG
GGCAGCAGTCCCGGGAGCCCAGGGCGCGGGAGGGAGCTGGATTCTTGTCCTGGTTGTGCC
TGGAGTGGGCCGGGGGGTCCCTGTCTCTGGATGCCAGAGTGAAAGAGGATGCTGGCGAGA
TGTGAGCTGCGAAGGTGCTCTGGAGGAAGGAGTCTGCCTGGCTGTTCTGGGCCTGAGGCG
GCAGGTCTAGGGCTCAGCTTTTCTCCCAAGTAAAACGAGGGGCAGGGCAGCAGGGTTGAC
AGCCCCCAGCCTTCATGAGCCAGGGCAGAGGGTGCCTGGGCATCTCGGTGAACCCTCCCC
GCCGGCACTCCCTTTTGCGGAGAAGGCTCGGGCCGTGGCGTGACCCACAGTCACTTGAAT
TCCACATGGAGGCCCTGAGATGGGCTTCCCTTCTCAGTCCCCTGATCCAGCAGTCACCAG
GCTCACGTGCTGGCCTCGCCTCACCTGTGTTTCTGTTTCAGCTGCGAGAGTACAAGGTGG
TGGGGCGCTGCCTGCCCACCCCCAAATGCCACACGCCCCCGCTCTACCGCATGCGAATCT
TCGCCCCGAATCATGTCGTCGCCAAGTCCCGCTTCTGGTACTTTGTGTCTCAGCTGAAGA
AGATGAAGAAGTCTTCAGGGGAGATTGTCTACTGCGGACAGGTAGGGGTGTCAGAGACGG
TGTGGTCCGGAGTGCATTCACACCTTCCCACGGGGCATACCTCAGCTTGTAGGCTCACCA
GACTTCTCAGTGACTGGTCCCGTTCATGGTGCTGGTCCGCTGTTCAGGCCCAGGGAGGGC
GTGGCTGGTGTGCTGGGCCACCTTGGCTGAGGCTGCGGCCCTCCCTGGGCTTCTTCAGTG
AGGTGGGAGAGGTGCTGTCCCCGGACACATTGTGTTGATGTGCTCTGGGCACCACGAGGC
TGCGCTGGGTGGCCACTGGTTTGCAGCCCAGACAGACCCAGGACAGTTGTGTCTGGGAGG
GGCCTGGAGCTGTGCTGGTCGCCATGGGGGCAGCAGCCAGGCCTGGACTGCTTTGCACCC
CTTGCTGTCACCGTGCCATTCCCTGTGGACAGCAGGTTCCCTCCGATGCCTGAGGTGCGG
GGGCAGGGCCCGCCTGCTCCCGCCTCAGCCGGTCTCCTTGTTCTGGCAGGTGTTCGAGAA
ATCCCCGCTGCGGGTGAAGAACTTTGGCATCTGGCTGCGCTATGACTCCCGCAGCGGCAC
CCACAACATGTACCGCGAGTACCGGGACCTGACCACCGCAGGCGCCGTCACCCAGTGCTG
TAAGCCGCCTGCCCCAGCGGGGTTCCTCTGTTAGCCTCATGTCACAGGCATCTGCAGCTC
GATTTGACACACGCACTCAGGCAGGACAAATGCAAGAGGCTTCTGGGGTGGTGGCGTGAG
GCGCAGGAGAGGTGTTTGCTTGGGGTGGGGAGCAGAGAGCAGGCCACAGGCCACCTTTTC
CTGGAACCTGCAGCATGGGATGCAGGGGCCTGCAGTCCACCACCTCAGAGTGTGGACCCT
CCCTCGTGGGTTGTGGCTGGGGCCTGGTGCTGGCCGCCCCACGTGCTCCCGGGGTGGCGT
GCCTGCCAGACCCAAAACCCAGGCACCTAAACCCAAGAACTGCTGTTTCTTGTAGCAGCG
GTTTAAACACAGGTGCTAACAGCAAGCGGATCCTGTCGCCTTTGAGGGGCTGTGGCTGTG
CCCCTCAAAGTGAATTTGGAGATTCTACACCTCTGGTGGCCAGAGGCTGCGGCTCCCCTG
TCCTCAAGTTGGGGCCCCCCGGTGGACACATGGTGGCAGTTTTGGGGAATGCCCAGACCC
CAAGTACACAGTCACCCAGTACACTCCTGCTCCCTGCAGACCGAGACATGGGCGCCCGGC
ACCGCGCCCGGGCCCACTCCATCCAGGTGATGAAAGTGGAGGAGATCGCAGCCAGCAAAT
GCCGCCGACCAGCCGTCAAGCAGTTCCACGTGAGTGCCCCTGGGCCCTGCTGGGTGGGCT
GGGCTGAGGGGCCGCCCTGGAGCGCTGCGCTGGCCTGGCTGCCCCCCAAGCCTTAGGAGA
CGCACAGGCACCAGGTCTGACGCAGGAGCCCAGTGGGGCGGCCGCGCCTCGGTGGGCCCG
GAGGACGCGTTGAGAGGCCTCCCTCCCCTCACTCGGCTCCTTGTCTATGACAGGACTCCA
AGATCAAGTTCCCGCTGCCCCACCGGGTCCTGCGTCGCCAGCACAAGCCCCGCTTCACCA
CCAAGAGGCCCAACACCTTTTTCTAGTTGGGTCTCCTCGGGTCTGGTCAAATAAACTCCT
TGGAAGCCTGCGTGCTTGGACACCTGTGTTCTGTCCGTGCCCTGCAGAACTCAAGAGGGC
GCGGCCGCGCTGTGAGTGCTCTGCTCCGGGAGAGCTGCCCGCTTCACGTGGGGCCGGACA
CCTGGGTCCAGAAGGGGAGCCCCAGGAACAGCGAGGGCCCCTCCCCAGCTCCATCCTGCC
GGCACAGCTCTCCGGGCTTTGTCTGGTGAGGGCTCTCACGGGCGGGTCCTGGAGCCAGGA
GGCTCCAGTTTCAGAGCCGTCACACTCTGCTGTGAGCTTTGGGGTACTTCACAGGTCTGG
CCCGCACATCTGTCCTGCCCGCCTGGGACACAGGCCCCAGCTGCCCACACTGCTGCTGGT
GGGGAGACGGCGGTAGTCAGACACCGGGCGGCAGGGTGACAGGGTTGGTTCCTTCCACCT
GGGGCCTCTCCCCCGGCCTAGAACTCCCATCTTTGGTTCCAAGATCCTCAGAGCAGACAT
GGGGATGCCCAAGAGGGCTATGGGTCTGCTGTGCTGGGTTCTCTTGTGTCCACCGGCTGG
AGCCCCCCTGATCTATCCCAGGGTGTCCAGGGCTCCCGTGGGGCCGGTCTCCAGGGAACC
GCTGGAGGCTGGGAATTCCAGGCACGAAGCTAATCCCACCTGGGGGGCCACCCTGGCCGA
GGCCCAGCTGGGAGCTCAGGCCTGCGCAGCCCTGGCCCTCTGAGCCTTTGTGTCCTTGTC
AGAAGGTCAAGTACGTGCCACATTTACTCAGTTGACAATACTTGAAGGCAGCACTGTGCC
TGCACCAGGAGCCTAGGTCAGTCAGGACTCGCCTCGTGTTCAGAGGCCACCCTGGGCTCG
GGCAGGAGCTGAGGCACAAAAAGGCAGTGGGGTGGGGCCTGGAAAGCCCCGGGCAGGAGC
ACAGCTCCACATCCCCAGTCACGATTAGCCTGGGCTTGATCCGTTTCCAGGAAACCAGGT
CACGTCAACCCCCCCCCCCCCCCCCCCGGCCACCGTGCTTGGAGGCCTGGGGCAGGCTCG
GGCCCAGCCCCCTGCCCGCTGGCAGCTCTGCCTGCTGTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1180, 1669..1798, 2379..2488, 2693..2878
1001..1180, 1669..1798, 2379..2488, 2693..2782
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved