Equus_caballus Locus RABGGTB
snOPY snoRNA Orthological Gene Database
Equus_caballus RABGGTB
Equus_caballus
RABGGTB
5
SNORD45, SNORD45
1441..1524, 2988..3059
10141
GGAGAATAGTTGGGTTAAGACACGGGCTTTGGAAGGTTTCTTGAGGGCTCCGAGAGGAT
GAAGGGTTACTCAGCGTTTTCTGCAGACTTCGCGGGCCCAGTTGCTGCTTCTCATTTTAC
CCAGGCTTCCTCCTACCCGGCGGGCCTCGGGATTCAACAGCCCGATTTCTTAATCCCGCA
AAGAAGCCAGGCCGGTTGGTGGTTCTTTTTTCCTTACGTATATAGAATTCTTATGGCTCA
AAATCCTTAGAATCATTAGAGATGTGATCTTGTTGAACATCTAGTAAATTTTAAATGGGG
TCTTAAGGAAATTTACTAGTACGTAGTCCTTTTTGGTAATTGTTATGACCTACTTAAAGT
GAGTGCAATGCAGTCTCCAGCGCAAAGATCTAAATAAATGCGAGAAACAAGGCTTCTGGG
GCCTTGTTGCAAATGCGGAAACAGACTAAAGCTGGAGAAGATGAGGCTAAAGGGACTGCT
CCCTTGATAAATTGAACAGCTTTGGGGGTGTGTAGAGGTGCTTTGAAACCTGAATTTCTA
GGATTAATAAACTTTCATTAAAGAACTTAACTGTAAATTATGGGCTAGCTAGGTTTTTAT
TTTAATGTTTCGGCTTGCTTTCTGCCACATGTAAACGGTAAGTTACCCTGAGTTGGTAAG
TTTTCATAGTTTATGGTGTTTATTTTACTTATCTCTTCAAGTGAACGATAACAGATGAGG
GTAATAATTTTTTGGGTCGATGATGAGCCGGCATGTATTCTGAATCTAAAGTTGATTATT
ACTACTTCAGCTCTAGAATTACTCTGAGACCTGAAAAATACCTGAACCTGTACAGGGCTT
TAGTGCTTAAGTTCCTTTTAGTCAGATACTTGGCAATTTCTAAACTGGAAGTTTTTGTAT
AGCAAGATGAAATCAAAGTAAAAGGTTCACATATATATTGAATAGATACTACGGCGTCAA
ACATTAAAAGATAAACATTGATGAAATCACTACCTTTTTATTTTGAAAGGGTACACCGCA
GAAGGATGTTATTATCAAGTCAGATGCACCTGACATCCTGTTATTGGAGAAGCATGCAGA
CTATATCGCATCGTATGGCTCAAAGAAAGACGATTATGTATGTAAGGTTTTATGTTGAAA
AATGTATTTTAAAGGAGTTAGACTATTCTGCATAAGCAGTCAGTCTAGGTCAGTATTTGT
GGCCCGTGTTTCTTAAAAATTGTATCCAGCTCCTGCATGCCAAGGACTGAATTTATGTCC
TTGAACTTCACTGAGTGTGCCTTTGCATATCTGAGGTTGAGGGTCAGTCAGAATTAACAG
TGGTCCTTACCAATACTTATTTAGAGGGCTTGACAAAGTAGATTCCCCTCCTGCTCCGAT
TTGTAAGAGGTTTGAGGTACAGAACAGATTTTTACTGTTGTAGTTGAGGTGATACTTTCA
AGGTCAATGATGTGTTGGCATGTATTATCTGAATTTATGGCTGATGTGTAATAACACTTT
AGCTCTAGAATTACGCTGAGACCTTGAAAAAGCTTTGCCTTGAGTTTTAAACTTTGAAGA
ATAGTTTTCCTCTCTGGGACAGTCTTAGAAAAAGTAATGAACAACTCAACTGAAAGTAAC
TATTTTCCCCTGTAGTATCGAGACAGCTCAATTATCTCCCAGCTTGGAAAACCCCTAGTA
TTGATGAATTCTTGACTTAAATGTGGTAGGTTCCCACAACGTTGTATGGCTTTGTTAGGG
CCATGTTTATTTTTTTCCCTGGATGGCTAAAGGGTTAGAGGATGACTTGATTCCTGCCTT
TTTTTTTTTTTTTTTTAAAGATTTTATTTTTCCTTTTTCTCCCCAAAGCCCCCCCAGTAC
ATAGTTGTGTATTTTTAGTTGTGGGTCCTTCTAGTTGTGGCATGTGGGACGCCGCCTCAG
CATGGCTTGATGAGCTGTGCCATGTCCGTGCCCAGGATCCTAACCGGCCAAGACCTGGGC
TGCCGACGTGGAGCACCTGAACTTAACCACTTAGCAACTGTACCAGACCCAATTCCTGCT
TTTTTATCTAGTGCTCACCTGCTGATTGTTTAAACCCTAAGTTTGGGTTCACAGCAAACT
ACCAAGACCACCTGTGTGATTCAGAACCTTTAAAAATGTAACACTTTGAAGACTAGCAAA
AACTTATTTCTGTACTCTGTTGTGTACCAGTTTTTATGTCTCCTTGATTAGCCACTGTTA
GCTATTTTAACCTTTGGCGTGCTTTGGCCATTTTGATTTCCAAGTAGTTAGGTCATTTGC
TAATAGATAACAGATTTTGTACAGAGTCCGTATATTAAAAGAATGGATATCTAATAAATA
CGTTGTACATACTCTAAAAGAAATGTCCTCAAACTTGAAAAGGGTAGATCTTTTATTAGC
TTATACTTTGTCTCTTTGGAGAGATTCAAGCCCTATTTGTGTTAATTACAGATGAGTTTA
TTGTAGGCTTCTCAGATAAATGTTTGACCCCCCCCCCCCCGCCCCCATCTACAAATCCGA
ACTTGCTACTGATAGGATCAAGTGAATTAAAAAGAAACAGTATGGCTAGTTAGCTTTCTG
TGTTCAATCTCTAACCCTGCGTCAGTTCAAACTGGCACATTAAAGTAATTGTGTATTTTA
GGAATACTGTATGTCTGAGTATTTGAGAATGAGTGGCATCTATTGGGGTCTGACCGTAAT
GGATCTCATGGGACAACTACATCGCATGAACAGAGAAGAAATTCTGACGTTTATTAAGTC
ATGTCAACATGAGTGTGGTGGAATAAGTGCTAGTATCGGACATGATCCTCATCTTTTGTA
CACTCTTAGTGCTGTTCAGGTAAATAACTAATTAAAATTCAACAGTCTTGGTAGTGTATT
CTCTTACCTGAAAGGGGAATTTGAAACCAGGTATTAGGAAGGTCACAAAATCAGTATCTA
TGTCAAAAAGTTACCCGTATCTTTTCAAATGAAGTCTGTATTCTGCAAGGTCAGTGATGT
GATGGCATGTATTAACTGAATCCAAAGTTGATGTAAGTTCTAAAATTACACTGAGACCTT
GAATGGTAAAATGTTGATCAACAGTATATGTAAATATTTGAAAATCACTAGGTGGCGTTA
AATGTTGTAACTTTTGGTGTTATGAAGATCCACAAATAAGGGTTTAAAGTCTTCTGTATA
TGTAGGTTAGTATAAAGATTCTTGGAATGCTAAGTTAAAATTTATATGAGAAAAATAATG
CTTTATGGTTAAATGTTTGGGTTTATTAATAATACCTATAATTTTATTGCATGGAAGATA
GTCTTCGTGTTTGAGAAAAGTTCATGATGTACGTAGACCAGAGCACTTTGCTTGCCTGAC
AAGTTAAGAGGTAGCTGAGGGAGAAATAGAACAGACTTAGCAGTATTGAGGTTTTTTTTT
TTTTTAACATGGTCTCTCTTTGTTACAGATTCTTACTCTGTATGATAGTATTAACGTTAT
TGATGTAAATAAAGTTGTGGAATATGTTCAGAGTCTACAGAAAGAAGATGGTTCTTTTGC
TGGAGATACTTGGGGTAATGTCCATTTAATCCATGCTACCGAAAGTACCAATGTCCTGTT
TGGTGTTTATTGTAGTAATAGGCTTTGTTGCAAATTTTAAAGTACAATGCATCAGAGGTT
TTGCTAATAATTTATAAGGAGATTTTTTAAGTTTTTCATTTTTTCAGGTCCCACTAAGCA
GCTGGTCTAACTGGAGTTAATGGTCTGCTGGCAGTTCCAGCATGCACTGTGGTAGTTATA
GCAGCATACAGGAGCACTGGAACAGAGGGGGCCAGTCTAAAAGATAAGGTAGGTGTCTTT
TTTTTCCCCAGTATTTGGTGACTTTGTAAAGTTTTTAAAAAACTGCTTACTGGCAGGGGA
AAAATATTCAAAAAACTTTACAAACTTACCGAATATTTGAGTGGAGGGAGGGAATAGTAT
TTTACTTGATAAATGTAGATAATCTCTGCTTTAGGGCTGAATACAGTGCAGGCCTGGAGA
GACCAGCTGCTTCATGGGATGTGAAAATCTGCTTTTATATAATAGGGTAAGTTTATGTCA
ATTAGAAATTGACTAGTCCTTTTGGTTCTGTTAGTTAGTTACCTTTTCTTTCTGGGCGCT
CTGTAAGCAGTTTAAGATAATTTACTGTTATTTTTGACAAAGCATTTTTCTAGTTCTTGG
TTTCTTTAGAAGTAAAGTGATTTCACTTCAGATGTGGCTTTCCTTCTGGTGACCTAAAAG
TAAATGTTAAACTTTTGAACTCTGGAAATTTAACCATGTTAGTTATACAGTGTTTCTTTT
CAGTTAACTTGCACCATTATGATCAGAGACCTCTGGTAACACTTAGGTTTTTTTGTTTTG
ATCCCGTTTTGCTTTTAGGAGAAATTGACACAAGATTCTCTTTTTGTGCAGTGGCAACTT
TGGCTCTCTTGGTAAGTTTTGAATATTGTATTGGAATGATGAAGCATCCATGATTACTCT
GGAGTTTAATAGGCATATTTTTTTCTGTTTATAGGGGAAACTGGATGCTATTAATGTGGA
AAAGGCAATCGAGTTTGTTTTATCATGTATGAACTTTGATGGTGGATTTGGTTGCAGGCC
AGGTTCTGAATCCCATGCTGGGCAGGTAATTTATTCATGTAGATTAAAATGTAGTGTCAA
TTTTGAAAGGGATAACCAATTTAGTAAACTGGGAAAATTAATAGCAATTTCAGTGTCTGT
TAAATTTGAATGAAGTTAATCTGACTGAATGTAATATAATATGGGATGTTACTTAAGAAT
TGTTTAATTGCTGGTTAAGGAAGGTATTTTTACAATAGTTTGATTTATATGCTTTCCTGC
CTTGGCGGAACCCTCTGATCCAGGCAAGCATAAGTAGGTTTGTAATCACCAAAAGTACGT
TTTGATTTTCTGTTAATTTTTAACTAAGCAAATGAAAACATTCTCTTCCTGCCTATTCTG
AATGCCTATTTGCTAGTGCCAGAGAACATTGTATATATATGATTGTTGAGTAAAATTTGC
TTTTATCCCTGAAGAAATTGTGGGAATAGTATTTCATTGCAGAATTGAATGCTAGTAATA
GTATACTTGGTTTTGTTCAACTAGTCATGTGATATTTACTTGTTTCCAATTCTAACTGTT
CAATTACCAGCAAATTTTTTAAACAAACTGGAGTTTTAATAATTTGAGTAGTTTTTATCA
CTATTTTATTATTGAAACATTATTATACACATGTACTTTATGTCTGTAATTTTAGATCTA
TTGTTGCACAGGATTCCTGGCTATTACCAGTCAGTTGCATCAAGTAAATTCTGATTTACT
CGGTTGGTGGCTTTGTGAACGACAGTTACCGTCAGGTGGACTGAATGGAAGACCAGAAAA
GGTACTGTTTCGTAAGATAAACTGTTCTAATAGCTTTATAACCTGGAGTGAGTACCACTT
TGTCTTAGATTTTTCGATGTTGCTCTTGTAAATTGATAATGAGCTTAACTTCCTCCCGTT
GCCAATTTTTCCGTTGTACCTCCTTAAAAATGCCCTTGGCAAAAGTAAAACAAGTGGGGT
TGAAATGCTTACTAACCCTGGTGTCCATTTAAAAGACACTCTTGAAGAAAAGATGTACAT
GGTACCTTCGGATACTCTTTTTTTATGACAAAGGTGCCTCTTGGTCTTCCCTGTCCTGAA
GTAGACGCATGAGTTATCTGGCGAATACAAAATGGCAAATACTCCAAGGAGGAAGTGTTA
GTAGTGTGGCTTCTTTGGCTCCCACTTTGTCTCTAGTCTTAATGGGCTGCACATAACTCA
GGATTTCAGTGGTGACCCTGGAGATTTTAGTGGTGACGCCTAAAGCCTAGAAGGAGGAGA
TCTTCTTGGGCCCATACCAGTGTCCAGGGCTGGCACAGTGACTTCACGTGGGGCAGTGGC
ACCTAATTGGCCAACAGTATGTCCCTGATCTCAGTGAGGTCCTCCTTGAAGAACACAAAG
CCCTCATTCTCCGGAGCTGGATTGTTCTCCAGCTGCCCGCAGATGGCCTCGTGCATCATG
GTGTTCTTGCCCATCAGCATTACACACAGCCTTCCTTCAGAAGGACGTGCAGATCTGCTG
CAACTGCTTGGAGCTCACACTGTCTGCTCCATGATGGAGCGTTCTGAATAATCACTCAAA
GGTTGGATGATCTTGAGGAAAGTAGTTGGACTTCCAGGTCATGCTGCCTTCCCTGGGCAT
CACAGCAGTGTGTCAGGGTTTGCTACAGGGTTTAATGGTGATGTCACTCACACATTAGCT
TTAAAATATATTTGTATTCAGACATGATATGAATTCTTAGAAGATATTTTTCCCTATGCT
TCTGAAGGCCTTGTATTTTTCAGGCATTGAAATAAAGCTATTTCTTCAAAATCTCTTAAT
TCTGGACCTATGCCAGGCACTTGATCGTGCTTTAAAAACTTAGTATCTGGCAGCAAAAGA
CTGTTGTTAAGTGAACACATGCATCTTATACAGGAGTCTCCATGTGTGTTTATGAGTGTG
AAAGGACAATGGGTTTGCCCAGAAAAAGATTTTTAAAAATAGGTTACAAAATTTTCATTC
AAAATTTTTAGTAATTTTTTAAGGAAAAAGTCAATTTTTGACATTTTGATTTGGAGAAAG
GAAATTACATTTTCCTTCACAAGTCCATAGTCCTGTTAAGCTTTCACACATTATGGGTCT
TAAGAGCTAGGTAGTAAATATTTTCAGCTTTGTAGGTATATGGTCTTGTTGCAACTACAT
TAACTTCCCTGAAGAGCAAATGCTGCCATAGGCAATAAGGAGTGAATGGGCCTGGTTGTG
TTCCAGTACAGTTACTATGGATGCACTTGTATTTTATATGATTTTCCTGTCACAAAACTA
TGTAAAATGTTTAAGACGATTTGCACATACAAAAAGCTGGTGGGGCCGGCTCAGTGGCAC
AGCAGTTATGTTCACATGTTCTGCTTCAGCGGCCCAGGGTTCGCTGGTTCGGATCCCTGT
GTGGACCTAGCACTGCTTGTCAAGCCATGCTGTGACAGGTATCCCACATAGAAAGAAAAG
TAGAGGAAGATGGGCATGAATGTTAGCTCAGGACCAGTCTTCCTCAGCAAAAAGAGGAGG
ATTGGCAGCAGATGTTAGCTCAGGGCTAATTTTCCTCAAAAAAAAAAGAAAAGCTTCTGT
TGTAGTCTAGATTTGACCCAAGGGCTATATAGCTTTTGTTGGGCCCATGACCTAAAATGT
GGTAGGGCATGGTGGTGCTTTCATCTGGGTCATTGTATTTTTAACTTTGCTTGCTCAAGA
TATCCAAGTTAAGGGGGCCATGGTGGGGGTAGGGGGGTGGTGGTAGGTAGGGAAACACCC
ACAGGTGGTTTCTAGTTAAAGTCTAATGAAAAACCTGGGCAACTTTGAACAATTAGAAAA
TGGTCTGGGGTGGGGATTGCCAAGAACCTGCACTTAAAATCTAGGGCAGCTTCTAATGTG
CCTGTGAATGACCCAGGGATCTTGTTGACATGATTCTTTCTCAGCCTAAGCTGGGATCTT
CTGCATTTCTTAAACTCAGGTGGCCATGGTTTAAGGAGCCAGGTTTTAGGTGATTTTTTA
AGCAGGTATGTTAAAAGTGCTGACCTACCTGGACAGCACTTGTTGAAAATGTGCTACCTA
GGGGAAATCATGTATGTACATCACGGTGGATTTCAACTTTACTGCCAGCCTCTGGGATAA
GGGGCTGAGTTAGGGCAATCATCGCAGATAGAAAGGAAGAGCGGATGGATGGTTGTCACT
GAGCACTGAAACTCAGTACATTTAGCATGGGTTTCTGTGGATTGGAGTATGTGGTCTTCT
CTTTTCAAGTGATTATCTTTATTTCTAAGCAATCATATTTATTAATTTCAGCATTTCAAA
TTGCATGTCAGTATATCCTTTGATTTCCGCCCCTCCTCCCCAATGTTTAGAGAGTAAAAT
TGTGGCAACTTTCTGTGGCTTTTTTCTCCTCCTAGTTACCGGATGTATGCTATTCATGGT
GGGTCTTGGCTTCCCTAAAGATAATTGGAAGGCTTCATTGGATTGATAGAGAGAAACTGC
GGAGTTTCATCTTAGCATGTCAAGATGAAGAAACAGGAGGATTTGCAGACAGGCCAGGAG
ATATGGCAAGTATATTTCTGACATGTTCATGGAAGTTAGATTGTCGTTGTTGGTTCGTGT
TACTTTTATGATTCTAAGCCTTTCCAGACTTAGAAATGGAAAGTATTCCAAGTCTTGCTT
TGAAAGCTGGATACTTTCTTTGTAGCTTTTTCTTTTTTCCTGAGGAAAATTCTCCCTGAG
CTAACATCCATTGCCAATCCTCCTCTTTTGTATGAGAAAAATTAACTCTGAGCTAACACC
TCTGCCAGTCCTCCTCTGTTTTTTTGTACGTGAGCACTGCCACAGCATGGCTGGTGGAGT
AGGTCTGTGCCTGGAATCTGAACCCATAAACCTTGGGCTGCTGAATCGGAGCGCACAGAA
CTTTAACCACTCTGCCATGGGGCCGGGCCCAATTTCTTTGTAATTTTTATTTGAGAATCT
ATGAAGGATATAAAACAAGTTTACAGAAATTTCTCATCACTTACTGCCAAAATTTATTTT
ATAGTAAAAGTCCTGTGTTAAAAACAACCATAATTTGAAATCGTTTTTCTTTAGAAATCT
TTAAGCATGCATTCAAGTAAAGGAAATACAATAGGCTATAAATAATCATTCAGAAGCAGA
GTTTTAGAAGTTTACATTTTGTAATACTCTATAAATTCTTATTTTTTAATAGGTAGATCC
TTTTCACACTTTGTTTGGAATTGCTGGATTGTCACTTTTGGGAGAAGAACAGATTAAACC
TGTTAGTCCTGTTTTCTGTATGCCTGAAGAAGTACTCCGGAGAATGAATGTTCAGCCTGA
ACTCGTGAGCTAGATTCATTGAGGCAAAAGTTGCTTAGTATAGTTTTTGCCATCTTAACA
TTTCTGTATTTGAAGTGCTTATTAAACTTAAAAATGACTATTATGTTAATATTTTGTATG
AATTGTGTTAATTTTAATAAATTATGTAGTTATTATACATATTGTAAAATACAGACCTTT
ATTGTATCTTCAACTTTAGATTTCCTCCTGGAATGCTATCATTCTGAGTACAGTATTTTA
TGCATCAATGTATTTGTTATTTGTATGTCTCTGTAACAGCAAACTTTGTTAGCTGAAGAA
GTTTTCTGTTCTGCTTGACTTTTCTCATGTGCTCCCTTTATATGTTTTGTAACGATAGTT
AATGTAAATTGGTCTGTCAGTGAGAATGTTAACTGAGAAAAATTGATAAATCCCATATAT
GAATTAAAAGATGCACAAAAATAATGGCTGTTGAAATTTGTGAATATTTCTTAGGTTTAT
GGTTACTCTGAGTTCGTTACAAAGTAATACAGGTAAATGACAAGTCACTATCTTAGAATA
GGATTGTAATCTGAGTTACACTTTGTTCTCATTTTTTAACATTTTGTGTCAGAATGCCAG
CTATTTACCCAAGAGACTTACCTTTTTTTCCCCTCCTAATAAGGAAACAACTTGATACTT
GACATCACATTTTTGAACCTGTGTTTTCAAGAAAGACTAAAATGAGCATAACCATTCTCA
AACAGTTTTACATTTTTGGTGAAAAAATATTTTAGTGAACGCTTTTCTTGAGATGGAAGT
TGAAGTTTTCTCAAGCATGTTTGCTGTACTCTGTAATATGTAATAGTCATTTTAAGAGTA
ATTTTACACATTGAGTAATGATTCATTTAACACGTTGACCAATGTCAACTTTAACATCTT
GAAAATCGGTGCTTTTATGAGATTCTTGAAGTGTCTAGCATTTTGACAATTAACTAAAGA
GTTTGGGCTGAGTTGCCACTATTTTGTTTTCTGAAAGTTTGGAAGTCATTGGATGGAGCA
TAATCTTTTTTAAATGGTGTCATTGGAAATATTTGAAGAGAGTTTTGAGGACTGCAGTCA
CTGCATGTGGGTGAACTATGCTGTGAATATCTGATTATTGAGATACTTAAGGGTTGTATG
AATTCAGTGATGGTTTAAATGAATGTCTTCTAGTAATAGTATCCAAGTGTACAGTCATGG
GC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1116, 2641..2838, 3448..3553, 4398..4450, 4534..4644, 5275..5400, 8015..8164, 8812..9141
2641..2838, 3448..3553, 4398..4450, 4534..4644, 5275..5400, 8015..8164, 8812..8949
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved