Equus_caballus Locus NP_001075354.1
snOPY snoRNA Orthological Gene Database
Equus_caballus NP_001075354.1
Equus_caballus
NP_001075354.1
5
SNORD21, SNORA66
6471..6565, 9480..9612
11138
GATATCTGCATTTTCACTAGTCTCCAAATGATTCCCATGCAACGGCCCAATGACCACCT
TCGAAACACTGTTACGTAAGGGAATATTCTTTCTTGAGGTGTTTTGTTGGTTTGCATGTT
TGTCTGGTTATTGGTTCTCTTCACTTTCCGTGTGGAGAATAGGAAAAGGGAACACTTATT
TCCGAGTTATAACTAGTTCTAAAAGAATGAAAAATAGGACTTACAGAAAAAAGTTAAGCT
GACTAGATCAGAGTCACGGAGGGAGGGAGATGGAATGAGGTGGTCAGGGATCAGGGAGGA
CAAGGGAGGTAAAGGGAGGCAGGAACGAGAGAGCATTAGTTCTTTTACCATTTGACAAAT
ACCGAGCACTTGCTGAATTGAAAGTCAGCGCTATGCTAGGTGCTGGAGATTCAAAGGTGA
ACTTGACAGCGAGGCCCACCCTCAGGGAGTTTACAGTCTAGGGTGGCCTGAAGCAGTTAC
GAAGTCTCTGTGGGAAGGCAGAAGGGTTCCTAAGGCAGGTTTGGAGCACCAAGGCAAGGT
TTCCTGTGGGCACTCTGATGTTCTGGTCAAGGATGTGTAGTCCAGGAGGTATAGGCCCAG
AGAGAGCAAAAGGGCTCCAGAGCAAATTCACTTATTAACTTTCAAACTTTCTTTCCTGTT
TACAAAAGTAATATATGTTCGTTATGAAACAATTTCTTGGTACAGGAAAGTGAAAGCCTC
CTGTAATCCTCCCTGCTACTGCTCAGCACCCATCTCCGTGAGGTCGTCCGCCAGGAGCTT
TGGGGGCCGCGGTACACATGGTTGTTGGAGCAGGGGCAGTCCGTCGGTCCTCCCGCCAGC
AGGGGGCGGCATGCCGCAGGCTATGCGGCCGGCGGAGCTCTCTTCCACACGTAGCTGGCG
TGTTCGCCGGCGCTACATACTGCGCCTGCGCACGGACAGCGGCCTTTTTCCCCCCCGGAG
CCGTGCTGGGCCTGTAGGTCTGTGGCGAGCCGCGGACGCAGGTCCTCTTGTTCCGCAGGA
TGGTAAGTGGGGTATCCTGTTCTCGGGGTTACGGATGCACTAGGGTTTCCTCTCCTTGCC
TTAGCTCCAGCCTAGGATCCGTCTCGCGCGGCGCAGCGGTCGGATGGCATTAGATTGCCC
GCTCTGCCACGGTCAGGCTGCAGTTCCCGGCATGGCTTTAATGGCTGCCGCCCGGCGCGT
AAACTTGGGGGGAGGGGTTGACGAAGAAGAGCAGGAGCGGGGCCGGCGGACCGGGCAGGG
AGGTGGGTGTAATAGACAAGCTGCGGGGATAGTGCGGGGTCGCGCGAGGGGCGCCAGCAG
GCGGCCGGGCGGGGCAGGCGCTATGCAGTCGGTCGCAAACTAGCAGGGGGCTGCCTGGGT
GTAGACGGGCTGTGGCTCCTCGGACCCGGCTCCATCCCAGCCTGCTTGGTGGGTTTTCCA
GGAGCCTCGGGACCGGTAGGTCTTTCAGAAAGCCAGTGCCGTTGGGCCTAAAAAGTGGCT
TTCAAGCCGAAACCATCACGAGAGCTTGGAGGCTGTGACGTCTCTGGGCCTCTAAAGGAA
GCTCGTTTACTCCAGCGTGCGTGTCCTGTCTGTCTCTCCGCTGTCGCTGCCGCCAGTTTT
TAATGAATTTTGGAGGGGGTGGTGTTAGGAGGTGAGGGGCAGTGTTGTTCTAATTGCTGA
GTATGCTCTTGGCCAGTTGAGTTTTGCGGCACATAATTTAGGCTTTTGAAAAACGCTGGT
GGGAAGTATGAGCTCGGGTTTTCGAAATGGGGCCTGCAGTGTTCAGAACAGACTGATGTT
TGGCAAGATCGGCCGCTGTCTAGAGCGGTGCTCTGCAAAAGTTTGGGGTAAGGATCCGTT
CCGGTCCGCGGGGAGCACGTACAGGGGTCGAGAGTAAGCGCTCAGACGTTTAAAAGCAGT
GTGATGATTTGATATCTGCCGAATTTAAGAAGTTGGCCTGCATTTTGTCTGTTCTTAAAT
TCCTTTTTTTCCCAGCGATTCATTTTTACTGTGTTTTATAGAACTATCAGTCTTGACAGA
TGGGAAGGAGAAGAAAAAGTGATTCTTGACCCCAGATGGTCTGAGAAAGGCCGGACTCTA
CGAAAGTGACAGTTACTCTTGAAGTTCAAGTGTTGTTTTGTTACATAGTTAACTCGGATG
TCAAAAGTATCGTAAGCTAAAACGTTTCTCAAAGTTTTAACATTCTTTTTTCTTAAAGGG
GTTTGTTAAAGTTGTCAAGAATAAGGCCTACTTCAAGAGATACCAAGTGAAATTCAGAAG
ACGACGAGGTATGATCAGTTGTTCATGTTCACAGTGTTAAAAGAATCTGCTTTGCAGTGG
AGTAGACTTTCTTAAGGTATTTTTTTCTTTCAGAGGGTAAAACTGATTACTATGCTCGGA
AACGCCTAGTAATCCAGGATAAAAATAAGTACAACACACCCAAATACAGGATGATAGTTC
GTGTGACCAACAGAGATATCATTTGTCAGGTAAGTTGTGTTCTGGACTCAAGCAATGGGT
CTGACCCCTCCCTCCCTCCCCTCGCTGCGCTAGAGAAGTGGTACTTGGGAAGCAAAACAC
AGGTATGGGTTAAGAAGGTCCATTTAGTCTAGTGCTTGGCCTTCCAAAAACATCGATTGA
GTGAGTAGTTCTTTTCCTTGTAGTAGGTCTGGAGTTGGAGCCTGGGAAATTGGTACTTTA
AGAAATACTCTAAAGGTCAGCTGTGCTTGGCAGTGCTGACCCAGTTCAGTCTCCTTCATT
TTCCTAACTGGGGGGAAGGAGGAGAAATTTATGCTGTTTTGTTGGGATGGTGGGGTGGGA
GGATAAATTTGAAACTAGGTTCTTGCCCATTCCAGTTCGGGTAGAATAATAAGATTTGTC
ACGAATCAAGTCCTGACTTTATTTTACATGGCTTACTATGGCCTTACATGCCCCACATCC
ACTGCCCTTTGCATAGACAGGTAGTTGTGAAGTTAGGCTCTTAAGATTGTTCTTACTCCT
GCTTATTGTTTGAAATAGGTCTTAGTAAATATGTATGAAGCTGTCTGCCACATAAAAGAC
CTCCAGAAAGTGGTGGTTTGCTCCTAGAAGGTAGTTTTCAGAACTTGTACAACTAGGGAA
AATTTTCATAGTTGAGATTTGCTGAGCCTTGCAGGAGGCAGACATACCTCTTTTCTGGGC
AAAGTCAGTTGCTGATTGTGAAGGCAGTGTCTTCATACCTAAGTTTAGATGATTAAGCAT
TAGGTGTCTGAAACATTGTTGGACCTATTTATGCTTGTTTGATATTTTAAATAATTGGAG
ATTCCTTTTTGACTTTTCAGAGTGCCTCTTTAATTCACCAGCTAACCTAGCTAAGAGTCT
TTTCAGAATTTAGAAGTAAGGTACTACAGTGTAATTTATTCCAAAGGCATTTTAATGTTC
AATGTGTATGTGGTAATTCTAGCCTTATGTACTGTGACATTAATCAGACATATTTACAGA
CTCATAAACCTACCTGCTATAGGTGATGAAGCCATAAACTGTAGTGGGGAGTGGGTTTGA
CAAATTTCAAGTGATGCAAATCTATGTCCAGCCCTTTTTTTCTAAGTACTTTGAAAAAGA
AGGCACTTAGGACAAGCAAAGGATAAAAGCACCGGTTACTAACCTGGTTTTTCTCTTATT
ATAGATTGCTTATGCCCGTATAGAAGGAGATATGATAGTTTGTGCAGCTTATGCTCATGA
ACTCCCAAAGTATGGTGTGAAGGTTGGCCTCACAAACTATGCTGCAGCATATTGTACTGG
CCTGCTGCTGGCCCGCAGGGTATGTACAAGATTACTTTAATTAATAGCTCATTGTTTGGA
CTTGCCTGCGAGACACATGTTTACACATGGATAAGATAACCCTCAGCTGTGGGGTCGGGG
ATTGCCTGCTGTTGCCCTGTGGCTTGTAAGGGCATCATTAGAGAAGATGATTTTATAAAT
ACAAAGTTTGATTGAGGTGGCAGTGCTGGTTCTAATAATCTGGTGAAGCAGTTTTCCTGT
TTTCTGCCCTGTTTCTTTGGTATCTCTAGGTCGATAGAATTTTCTGTCGTGATGGAGATC
TGTAATCTGTGTTGTCTGATATAGTAGCCACTAGCCACATGTGGCCTTTGGGCACTTTAA
ATGTGTCTAGTGCTACTGACAAACTGAATTTGTAACTTAAATTTGAATAGCCACTTGTGG
CTAGTTGGTAGCTACCTTGTTGGACAGACGTAGTGAGAAGTATAGATCTTCTGACCATCA
ACATACATTAAAAACACAGACTCTACTCCAGACCCTCAGAAACTGTATTTTAATAAGATG
TCCAAGTGATTTATATGCACGTAAGATTTTGAGAAGCAATGTCTTAAACTTTTTGGAGCT
CAGGTGTCGGTGGGGGATTCATTTTTTGTTTTAATCATCTTTGCCTGTGGGTGGCAGCAT
TTCCTGTAATGTGCAGAAAGGAAATGAAAATGTGATTTTTGCCTTATTTTTGTTTTCTCA
ATTACTGACTTTGTTTTGCAATGGAATTGTTAAGTGTGCGTCATTGTTGGGGACCCACAT
TTTCACTGCCATGTTTGAGTGGGGCGGGAAACATTCTCATGTACGAAAGCAACTTGGTGC
AGGCACTACTTGCGGAACCATAGCTAGATGTGTACTAACGGGAGTGGCCCGTATTAACAT
AATGTGGTTGAAGAGTAGAACCATAAAAGATGTTCTTTTCAGCCCAAGATCCTATTCCTA
CGATTTTAATCAAATTAAATAAAACTATGTGTGATAACATTTAATATTTGGTTGGTGAAT
TTTTATAGTCAAATCTAGTCATTTGCGGCATAATGATGTTTTGGTCAATGACAGACCGCA
TATACGATGGTGGTGCCATAAGATTAGTACTGTATTGCCTAGATGTGTAGTAGGTTAAAC
CATGTGGGTTCGTGTAAGTACACTATTATGTTCACACGATGATGAAATAACCTAACTGCA
CGTTTTTCAGAATGTATCCCTGTCTTTAAGTAATGCATAATTGTATGACTGAAGGACTGG
AGATCACCTCCCTTGAGTAATATGAGTCAAATTCTAGTATTGTACATCTTAATTGATTGC
TACATAAATCAAGTATGGACATGTAGCAGATTCGGAAGCTGTTAAAGTTAATAATTGAGG
GTGAAATTGAATGAAATTTCTTTTTGTAGCATTTAAAAATCGATGTTTAAAAGTAGATTG
GGATAAAGGGATAATTGAATTGGAAGGAAATTTTTTGTCAGAGGCATTAAAGCTGTGGCT
TGAGGTACTAGAGTTGTTTAAATATATTCAGACAGGTATTTAGACTGGCTTCTTTGTTAA
TAGCTTCTCAATAGGTTTGGCATGGACAAGATCTATGAAGGCCAAGTGGAGGTGACCGGA
GATGAATACAATGTGGAAAGCATCGATGGTCAACCTGGTGCCTTCACCTGCTACTTGGAT
GCAGGGCTTGCCAGAACGACTACCGGAAATAAGGTTTTTGGGGCCCTGAAAGGAGCTGTG
GATGGAGGCTTGTCTATCCCTCACAGGTAATATAGTATTGAGGGCCTCATTGCCTGGACT
CTGATAACTTCACTGTTTCTAACTGGTCGGACTTTGGAAACTATTGAAGTAATAGTGCTA
TTGTTGTGTGCCTGCTATATGCTAGGTACTGTGCAAAATGAACTTGGCTGGGCAGGAATG
AACTGTAATGTATTTTATCAGTGGAGACTGGGGTTCAGAGGTAAAGGATTTGTCCAAGGC
TTTGCAGCCAATGAGTGGAAGAGCTGGGGTTGAAACTCACTACCTTTTGTGTGTAGCTTA
GTTATGGTTAGAAATGAGCACTCCCCCCCACCCCACTCCGAATGCGTTTTCTTTTTTTCA
TTCAGAATGAAAATTGCTTCACTGAATATGGAAAAATGTGGACTCTAGGAAAAAAAAGAG
TTTGAGAAAAAGGCTTATGACAGATTTCTAAACTTTCAACTGGAAATAAGGTTGTAGGCC
ATTCTTAGGAGCTAAGTAGATTGTTTTGTCTGTCTTTTGGTTTGAGTTAATTTTTGTTAT
TGTTGAATAGATACATTTTAAAGTGACTTATTACCTTAGGGATATTTTAGTGGTTGGTGA
TTTAACAACCAAAAATTTTTTTCTGTATATGTGTATATATATGTATTTTTTTGGTAAGCC
TATAAAATGTAACCTAACTGGAACTTACTTTTTATAGTGTGGGGTGGGGGAGGGTTTTTT
TTTTTTTGAGGACTTACGGTTCTCTTGCAAGGCACCTATTAGATATGTACTCATTCCCAT
GTATCCTGAAGGCCCACTGAGAAATTCTAGGATTTTTGAGGAGCATTTTTAAACCCTTTC
CTATGATAATGAGGAGAACTAACTTCATAGTGGTGGAAAGCCTTGGTTCATTTAATGGTT
TTTAAAGGTGCTTGTGGCATGATTTTCTATCCTGGAATTCAGAGATTAGCTGCTGAATGA
TGATATCCCACTCACTGAGCAGTCAGTAGTTGGTCCTTTGGTTGCATATGATCAATTAAT
TGTTTCAAGACGGGACTGATGGCAGCTACTGAAATGAATTCCTGCTAGTGAACTGATTTC
AACCATTAGATACTAAAATATGAAAAACTTTATTTTAGTACCAAACGATTCCCTGGTTAT
GATTCAGAGAGCAAGGAATTCAATGCAGAAGTACATCGGAAGCACATCATGGGACAGAAC
GTTGCAGATTATATGCGTTACCTGATGGAAGAAGATGAGGATGCCTACAAGAAACAGTTC
TCTCAGTACATAAAGAACAACGTAACTCCAGACATGGTAAAAAATTTAACTAAAAATGCT
AGTATTGGTTAATTATAGAACCAGGTTTACTACTTGTTTTTGGTGGGTACATTATATGGT
TTTATTTCAGGTTAACAGTTAAAAGTTGAATGTGGGCATGTTCATAAGTACAGATAGAGT
CAAATAAGCTGTACTTAGCTTAAAAGGAAATGACGTGAAATTGGGATGTTGAACCCAGGG
TAGGTTAAAAGTCAGATAAGGTAGTAAAATGAGCTAAACTTGTCAGCTGCTTTTAGAAAT
CTTTTAGATGCTGAAGGATGGCAGGCTTCAAGCATCCAAATCTAAAGCCTTTAATGGTGT
TTATGCATTTGGCTGTTACGTATTTATAGATTTCATTCCTGTGGTCATAGTTATAATCGA
CCCTGTCTGATACGAGGTGCTAGTTACTCAACTTGACTCATTTTAGGCCATGGGGAAGAA
AGGTTCTTCCTCTTAGTAAATAAGTGTTTATGTTCTGGACTTTTTGAATGTCTCAGGCAT
GCACACAGAATGGGAGACGTACAGATTCTGTCACGAGTTCTGTGTGGTGATGTAGACGTG
GAGGGAACCATGTTTGCGAAAGTGAGCTTAATGCTGGAAAATTTCTCACCCCTAAAGCTG
AGTGTCCATGGCTAGCTATGAACACATTGGAGTAACTGAAGATAATAATTCCATTTTTAA
AATTATAGTGAAAGCATGGAACACACAAATCATACTATTATAAAACTCTTAGAAATATAG
AATTACATATAAATCAGTGGATTACATATCAAGTAGTTGTTTTGTTTATTAGATTCTTTT
CTGTTAGTGCATAGTCTACTTTGGTACAGCTTTGCCTATGAAAATTATTTTTGAAATAGG
TTTGTAATGGGAAAAGATGAGTTTATGTTATTTGTATGCTTAGTACACAGTAGGGCTGAA
TAAACACACAGCTTGAGTTTTTGAGCTAGGGAAAGGGTAGTTTTATGTTAAGGTAGATGC
ATGTTAATTTTCACATGAGTATATTCCTTTACATTATTACATCACCTTGGGAAAAAGGCC
TTTTACTTTAGACTATGATTCCCCTTGGCCTGCAAAATTTTCCTTTCTAAGCCACGTCTT
GCTCTGGTCATGTCACACTTGCTCAAAATTTTTCAAACTCCCAATCTGTTTTCACATGTC
TGTTTCCTAATGCTTTCCTATATACATGCTATACTTCAGCTGGCCACTCTTTGGCTAATG
TACTTTCCAGCTAGCTCATTAATTTTATCTATGGAGGCCTCTTATGTATGCCTAGTGAAG
TCCTCTGCAGACATCTAGTGTGTCTCCAACAGGAAGTGATCTTTATTACCTAAATTCATG
GCATTATCTGCATACGTGGTTGTATTTCCTACTTGTCTGGTCTCTTGGAAGGAATGAACT
GGGATGCTTAGATTTGTCGGATGACTACATTTGAAGTCATTAAATGGATTCGTTAAATAC
AGCGGAGAACTGTAATAGAGTGCTAAAAGAGATAGAGAAATTAACTTTCAAAAGGGATTT
AGGTAGAAATGCGGTGAAAAATTTTGCATTATTTTCCTTTGCTAAGCTTTATACAAATGC
ATGTAGTAATCACATTTTTTCCACATTGAATGAGTAATTTTAGAGGCTTGCATTACCTTG
ACTCATTCTTCAGGGGGCTGTAATTGTTACTAGCTTTTGATAATGAACACTCAGGCATTT
CATAGCTATTCTTCATGACTCGATCTTCCACAAAAATCAGTAGTCATTTATTTGGAGCTG
GTAATTGAAACAATTCAGAGAGTTGCAACATTGTTTTTTGGTGAGTTTTAGAACAAAATT
CTCATTAACATGTCTAACTGGAAAGCCTTTCAGGGTTTTCTCGGGAAATTCACACCTCTT
TCTGGTTGCACAGAGGCCTAATATTGCTGTCAGATAGTAGTGACTCATAGTAGTTGATAG
AAGAGGTCCCTGGTATGTAATACTGAGACTAGGTTTGAAAGACCTATCAGATACCAGTAG
AAAATGTAAATCTGGGGAATGTGGGAGGACAAAGGAATTTGGCATTTGCTTGTTGGCGCC
ATATACTATTCGTGTTAACATCTTAAATACTTTTTTTTGGCATGTATCCTCACTTGAATG
AAAGAATTTAGGTCAGATGGTATTTTAAATGAGCATAAAATGTGTTTCTACACAAATCAA
TTTACTCTAAACTTGAATGTCTCAAGAAGTATAGCCAAATCCCTCAGAAATATGTGCAGA
TTCTTCTTGAAGAAGATTGCGTTTTGTGAATTGTATCAATTCACATTGCCTACAGTATAA
ACATTGGGAATTTCTCAGGAAAAGGTGGGTTACATTTAGAAATTTAAGCAGATGCCACCG
TTCACCGTAGTTTAGTTCCTTTGGAGAATCTGGCTTAGAAAGACGAAGCAGAGCGAGTAG
TGGAATATGGTACGTTATATTAATGTTTAGGACATAGGAAATGGAACCAAGTACTGTTTG
CTTTGCTTTGTTTCAGATGGAGGAGATGTACAAGAAAGCTCATTCTGCCATACGAGAGAA
TCCGGTCTATGAGAAGAAGCCTAAGAAAGAAGTTAAAAAGAAGAGGTATGTGTCTTACTC
TTGTCTTGAGGAGAAAGAGGTTGGGAGGGTTCCCTGCCTTGTTTCAGACTTGGTGAAGTT
GTGCAAACTCGATCACTAACTCTGCATGATGTTGCAGAAGTGAAGGGAACCAGGTTTGCT
AAAGTAATGGTGGTGATAGAAACATATTAGCCTCAGAAGCTACTGAGGTGGCCCATTCTA
TCCCAGTACAGCGTGACTGCCAGTTACTGCATTCTTTACTAGGCTAACTAAAGAAGAGAA
TTACTTTCTGTTAATCTTTCACATTTTGATCTTTGAATGGAGTAGAAAATAATACTTACC
GAGTGGAAGTGTTGTATTACGTGTTTATTTGATTTTTGGCCCTGTGTGGTAATAGGGCAA
TTGACACAAAAGTTGGGGTTTGGTTAAGTCAGCTTAAGGTCATACTAAGTGCATGTATTG
GAATTGGGGTTATTCGACCTCCACCTTGAAAAAGTCCTTGTCTTTTTCAAAATTTAATAT
TCTCTATGCTCTTGAGCTATGGCTTTTAAAAATTACATTCATGTCTTTTACTTTTTTTTG
TAGGTGGAACCGTCCCAAGATGTCTCTTGCCCAGAAGAAAGATCGGGTAGCTCAAAAGAA
GGCTAGCTTCCTCAGAGCTCAAGAGCGGGCTGCTGAGAGCTAATAAACCAAACCACAATT
TTCTATGAAGATTTTTCAGATAAACTATCGATAATAATAAACTTATTGTCTTAGCACGTA
TTTCTGTGTTAAGCTCTTCTTAATGAAACTGTAGGAAATACCCTGAAGTTTTTCTTCAAG
AAACAAGTATAGCTTTTTCCAGAAAAAGTTGTCTTGCATATTGACTCAAAGTTCACACCT
GCTTCTTGGGCTTCTGCCCTCCCTGACAAGCATTATCCCTGAAATTGTGTGATGTACAGC
TCTCCCTAAAAAATCTGAGAAGCAACAGACCCGCCTTCCATTAAGAAATAGTTCTTCCAC
TCATTTATAGTAACTAGATGATTAGCAGGAAGAAAAAGTGCCTTCAGAGCACACAATTTT
ACAGTAAGCAAAACTGGTGGTAATCTGTGGCTTTAATCTTTGAGAGAAGTCTGTCCAATG
AAGTGACCATCACGTTATTTTAATGTATTCACTTTAACCACGTGAAACCTTTGAGCAGAA
AATACTGAGTCTTTTCTCCACAAGAGAAGGGGTTTAATTTTATGGCAATGTTGAAAAGTA
CATGCCAGATCTGAATAAACATGAAAAAGGAGCAAATATTGACCCTTGTATATCAAGTTT
ACATGAGAGAAAATGTTAGATAAATTTACATGCCTCTTAAGAAATAGCCCTTTGGCCAAC
AGGGAATAATACTGTTTGAAAACGGAAAATTATTAAAAAGTTCTGATTTCAGAGTCCTGC
TCTTAATGTCCCACTTCCCCATAGTTCAGATTGAAGGTAAGTGGATCTGGATTGGGTCTA
TAGCCTTAAGATGTCACTTTTGAAGGACTTGGCTCGTCGATACTAATGTGGATCTTTTGA
ATCGACAATGATGAAAGCTTATCCATTTTCAGCCTCTAAAATTGGCAATTAAACATTGCC
AAGTAGAACACATCTTGATAGGTTTTGAATTTTAAGGGTCTCAGTAAGAGCCACTCAACA
TTCTGAAGCCACATAACATCTGATGTCTAAATGAGTTTAAATGTGCTTAAGTCTATAATA
CAACAAACCATGCTATTAACCCAACATCTGTTTATAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1021, 2218..2287, 2373..2488, 3664..3798, 5343..5545, 6638..6815, 9316..9404, 9963..10138
1001..1021, 2218..2287, 2373..2488, 3664..3798, 5343..5545, 6638..6815, 9316..9404, 9963..10059
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved