Equus_caballus Locus UBAP2L
snOPY snoRNA Orthological Gene Database
Equus_caballus UBAP2L
Equus_caballus
UBAP2L
5
SNORA58
27316..27451
38175
CAACAGAAGCAGCTGCAAAAGCAGAGTGTTGGAGTTATTATCCAGGGAACTGAGATTCT
GGGCAGAGTCATTGGGGCTAATACATGCCTTGTTCAAGGCTATGGAAGCCCCCACAGCAT
GCTGAGAGAGAGAAACTTGAGGGAGAAAGAGGCTAGACTTGAGCTTGTCCTTTCCCAATT
GATGGAGGTCACATGCAACACGTAAAATGGTTGTAAGGCAGGTAAGGCTGTTTTCATAGG
TGGATTGAGAACAGTAATTTAAATTGCTTTTATTTGTCTGAGGTATAGACTAATCCCCTT
CCTGGAAGGCTTTTGTTTCCAGGCTTTGCTGATTATCTTTCCTTCTGCAAAGGGACTTCA
GATATTTTCATCTGTATAGAAGGCTTTTGATTATTATTTTTTTTTTTTTTTTTGAGGAAG
ATTAGCTCTGAGCTAACATCTGCCGCCAATCCTCCTCTTTTTGCTGAGGAAGACTGGCCC
TGAGCTAACATCCGTGCCCATATTCCTCTACTTTATATGTGGGATACCTGCCACAGCCTG
GCTTGTCAAGCAGTGCCATGTCCACACCTGGGATCCGAACCACTGAACCCCGGGTAACTG
GAATAGAACATGCCAATTTAACTGCTGCGCTGCTGGGCTGGCCCCGAAGGCTTTTGATTA
TTAACGTTGTTTTGCTCTCTCTCTCTATTGAAAGAGAGAGAGAGCAAAACTTGATGAAAG
ACTGCTTAGAGGGGACTAGTAACCAAACAGTGCCCATAACTTTTTAAAAAACAATAAAAC
CATCACTTAGCACATGGTTTATGCATTTCTTATACAAAAATGGATTTACAGCCATAGTTC
ATTAAGGAGTTTATCAAACTAAATATGTCTCAAGAACAGGAGAGTCTTATTGGTTTGTTT
CTTTGAGGAAATGAAAGTGTTTGGTGAGGGTGCTGATGAAAGAGAGGTTGAAAACATATT
TTGCCCACTTTTAACATCTAAACTCTTTTTTTTGTAATCTTTCAGTATTCTTCCTTGTAA
ATACTGTTATTTGTATATACTGTAAATGATGACGTCGGTGGGCACTAACCGAGCCCGGGG
AAACTGGGAACAACCTCAAAACCAAAACCAGACACAGCACAAGCAGCGGCCACAGGTAAA
GAACCCAAGGGATGTGGATCCATGGATAGCCTTGCTGGTCGATACTGGTTTCCACCCAAT
GCAGCATCATTCTGTGCTTTGGATTATTGATTTGTGTTCTTTATTCCTGTTTTCTAGTCC
TTGCTGCTTTTACTTGGGGCCTGATAGCTTAATGACATGCTGTGATGCAATGTGCTTATT
TTTTGTTGTTTACTACTATAACAGTATGAAGCTTGGAAAGAATAGGTTCTGTGCTTTGTA
TGTATAAGATAGCATTTCCTTTCTTTCATCTGGGTCGTTTTAGCAGTACATTTCTTATTT
CCTAGCCCTTCCCCTTTGATGTCTCTCTAGCCAACCTTTGTCTTGCTGCCTTTCCCCTTT
CCTTTGCTCTTCTTTTCCCTAACTTTTATCTTCCTCTCTGGTCTCATTGAGACCTAATCT
GATTTTTCCTTTCCCATAAAGCGTTAGCACCTTTACTGTGCTCCCTCAAAATTAAGAATT
GAGACACCCTAGAGTATTGCCCAGTTTTAGGTGTAAATTAGTCTCTTAGATACTGAGGTT
TATGGGGGCAGAGGGGGTTGTGTGTGTTTTGTTTGTTTCTTTGATTTAGATATGATCTGT
TTTCTGTAACCAGTTAGGTGTTGGTTGGTACCTAATGTGAGTGAATTAACTTACATTTTG
TTATGGTAGGATAAATTGAATATTTAAGACTAGAACTTTCTTCTAACTCATTTTTCTTTC
ACTTCTCTTTCCAAGTGAATCTCTAGCAGAATTTTAGTACTTAATTTCAATTGAGACAGT
AAAATTCCTGGTATCTTATAAACATACATTGGATACTCAGAAGATAGGCTGAGTATATCC
TTAGTCTAAAATCTTATGGTATTCTCAGCCCTAAGAATAAGAAGGTGGCATTGGTCATTG
CAGAAACTGGAACAAGGTTTGCATATGACATTGCAAATACACTAATGTGTATTAAGGCCC
AGATATTTCAAAGTGGTGCTGTGATCCCAAGATGAAAGCCTCTTTAACTGTGAACATTGG
TGAAAAAGCTCCCTGCTTTTTTAGGGATTGTAGAGTGAAATAGTGGCAACCTCACTCTTT
GTTTTTTCTCATTTTGCTGGTTTAAACATCTTGAGTGGTGTTAGTGTTTTATTACCTGGT
CATTTGTAATAAGGAGAAGGAAATCGGGGTGGGGGGTGGGGTGGATGTTGACTACATAGC
TCTCTTATGTCTATAAACTGTTTTCTCTTGATTGTGCTTTCTTGAACTTATCTCCATTCC
TAGGCCACTGCAGAACAAATTCGACTTGCACAGATGATTTCGGACCATAATGATGCTGAC
TTTGAGGAAAAGGTGAAACAAGTGAGTGTATTACTAATTTGCTGTAAGCTATGGAAAAGG
ACATCAGGATTAAAGCGTAGATGTGTAGCAGGGTGCTTTCTGCTACAGGTAATAGAAGAC
TTATAACCTGAAATAGGATAGGTTAAGCCAATAAATAAGTGCTTTTATTGCCTGATTTAC
TGTACTCTCTGGACAGTTACCTTGTTCAAAGAGATTTTATCTTAATTTTAACGTTTTGTT
TTTGAATGACTTTGTCAATGCTGTTTTATAGCAACTTTGAGCAATTGAGGCACCTAGGAA
ATGTGGAAGTACATGGTATGCTGAAGCCTGTGTGCTTCTAGGTTTGACTGTCTATCAGAT
GCTTTATTGTTTGATTGCTTTGTAAATACTTTTGACCCTATCCCTCATCACAGGTGGTAA
TATTTTTCTTTTGAAACTAGAATAGCAAAATTCACATATTTTGCTCTTTTAAGCCTGGTT
CTTTCAGACTCAGCTGGCATCTTCTCCCTTTTCTTTTCTTCACCTAGTTTCCTTTTGTGG
GGAGTGCCAGCTTGTTCGTGATGGTTGCTGATCTTTCTCTTTCAGTTGATTGATATCACA
GGCAAGAACCAGGATGAATGTGTCATTGCTTTGCATGACTGCAATGGAGATGTCAACAGA
GCCATCAATGTACTGCTGGAAGGAAACCCAGATACGGTAGAGTGCTAATAAAGTGTTCTA
GAAAGTGGGTCCCCAGTTGAGAGGCTAGTAATTTTCTAAAAATAGCAAGTGGGGTACAAC
TGAACTTAAAGCAAAGTACCTTATTCTCCAAATAGAGCAGGGAACTGTCTTGAAGGTTGT
TTGCTGCGGGTTGCAAATACTTAAAATTTGTGTACAATAAATAGGAGAAAACAGATAAAA
TCAGTGTCTTCTAATTGGCCTGGAATAAATTATTCATTGCAGGCTAGTGAATGTTTTCAA
GACTAGGTTACTCTGAAGTAGGGGTGCTATTTTTAATAGCTTTAGTTACAAATCATGGAA
GATTTCTGCTCACCTGTTATATTGCTATTGAACAAGTCACAAACTACTTACTCTGATTTC
AGGACATTCCTGTCAATATCACATTAACATTTCGCAATACCTCTTCATTACGTGAACTTA
TTTCTGTTGTAGCAGAGAAACAAACTTTACAGCCTGTTGACCATCCTTGGAAATGATAGG
GGATATCTTGAAGGACCTCTTGCCCTAGAATTTAGAGTTGCTTTCACATCTTCCTCTCCT
TCTCACTTAATGAGAATTCTCTGTTTTTGTTCTTGTCTTAGCATTGTACCAAACTGTGAG
TTCCTTAAGAACAGGGATTCTACCTTAATAACCTTTGGGATGTTCCTGCAGTGCTTAGTA
GAGACCTTAATTATTTTTTTGATCAACAGTATATCATTTTGAACTCATTTTCATTTACTT
GGTCTTATACTGGGAATCTTTGGTTGAGAAAGATAACCAGAGTTGATCCTTAGATCAACT
TATGTTACAGTGTCACTTTAGCTAAATGTTGGAGGTTTGTCAGTTTCTTTGAGACAATGG
GCAATAATAATGGAAAACTTCATTTAATTTTTTTTGAGGAAGATTAGCCCTAAGCTAACA
TCTGCCGCCAATCTTCCTCTGTTTTGTATGTGGGACGCCACCACGGCATAGCTTGATGAG
CAGTATGTAGGTCTGTGCCTGGGATCCGAACCTGCAAACCCCAGGCTGCCAGAGTGGAGC
ATGTGAACTTAACCACTATGCCTCTGGGCTGGCCCCTAATCATTTTTTTTTAAATTATTG
CTTTAGTAAACTATTTATTATAGACTCTTTAGAATATGTAGATATGCTTTTACTATAATT
TTAAAATTACCTTTTTTGGAACTTAAAACATTTTTTAAATTGTGGTAAAACTTACTTAAC
ACATTTATCATTTTTAGCATTTTGTGTGTGTGTGTGTGTTAGAGGAAGATTGTCCCTGAC
GTAACATCTGTGCCAACCTGCCCCTACTTTATGTGAGATGCCACCATGGCGTGGCTTGAT
GAGTGGTGCTGGATCTGTGCCCGGGATCCAAACCTGCGAATCCTGTGCTGCCGAAGCAGA
GCGTGTGAACTTTAACACTATGCTGCCAGGCCAGCCCCAGTTTTACCTTTTTTTTTTTTT
TTTTGGTTTTGTTTTTGTTTTTGAGGAATATCAGCCCTGAGCTAACATCCACTGCCAATC
CTCCTCTTTTTGCTGAGAAAGACTGGCCCTGAGCTAACATCCATGCCCATCTTCCTCTAC
TTTATATGTGGGACGCCTTCCACAGCATGGCTTGCCAGGTGGTGCCATGTCTCCACCCGG
GATCCAAACTGGCGAACCCCTTGCTGCCAAAGCAAAACGTGCACACTTAGCCACTGCACC
ACTGGGCTGGCCCCTGCCGTTTTTAAGAGTACAATTCAGTGGCATTAAGTACATTGACAG
TGTTGTACAACCGTTACCACTATCCATTTACAGAACTTTTTCGTTTCCCAGACAAATTCT
ATATCCATCAAATAATAACTCCTTATTCCCCCCCCCCCCCCCCAAGTCCTGGTAACTTCT
TCTATTTTCTGTTTCTATTAATTTGCCTATTCTAGGTACCTCTTATAAGTGGAACCATAG
AATATTTATCCTTTTTGTCCTGCTTCACTTAGCAGGTTTTCAAGATGTATCTATATTGTG
GCATATGTCAGAATTTCACTCTTTTTTAAGGCTGAATAATCTGTTATTTTTATATATACC
ACATTTTGTTTATCCATTCATCCAATGATGGGTAGTTGGAATTATTTAGAAGTTGTAGAC
ATCATAATACTTTATTCCCTAAATTCTTCAGTGTGTTTCTTTTAAAGAAGGATTCTCTTT
TATATGACCACAATATTATTATCAACCCTGAGAAAATTAATAGTAATTTCATATTATACT
TGGTCCATATTCTTTTATTATTATTATTATTTATTTTTTAATTTTTTAAAATATTTATTT
ATTTAGTCATTTTTTCCTGTTCTCCCCAAAGCCGCCCAGTACATAGATGTATATTTTAGT
TGTGGGTCCTTCTACTTGTGGCATGGGGGATGCCACCTCAGCATGGCTTGGTGAGCAGTG
CTCGGTCCACGCCCAGGATCCGAACCAGCAAAACCCTGGGCTGCTGAAGTGGAGCATGCG
AACTTAACCACTCGGCCATGGGGCTGGCCCCTTGTACTGGATCCATATTCTTGAAAGTTA
TTCGGTAGCTGTTGCTAAGCACCAGGACTGTTGTTGTTTGAGTTAGATGGTAACTAGGAT
AGTAAAAATCTGGTAGTCTTGGTGTTTGTCCTGGAACTTTAATTTGTACATATTTTCTGC
AAAAATGTGTAAATCAAGGTTTGTGTGCTCTTAAAACTTTAAACTTATAAAAGTCATTTT
CCTGATGAATGAGTCTTCTTGCAGGACTGGTTAGCTTATTTTCTTTACCATAAATATTCC
CTCCTAAAATCTGGAAGGAATCATAGATTATTCTGCTTTGGGGAAAGTTGAATTGGGTTC
TGTCAGTTTAAGAAGTATAGGGAGAACACAGTGGATAAAACCTAGAATGGAAGGCCTCCT
ATAGTCAGCACGTCTTCCTGATTGCTTCATGATTGCTATTTGGTCTTTTTTTTTTTTTTT
GAGGAAGGTTAACCCTGAGCTAACTACTGCCAATCCTCCTCATTTTTCTAAGGAAGACTG
GCCCTGAGCTAACATCCATGCCCATCTTCCCGGGACGCCTACCACAGCATGGCTTTTGCC
AAGTGTTGCCATGTCTGCATCCAGGATACAAACCGGCAAACCCCGGGCCGCTGAGAAGCA
GAATGTGCACACTTAACCGCTGCACCACTGGGCCGGCCCCTGGTCTTTTAAATAAAGGAA
ATTGGTGTGTGTGGAGGAGGTTGTAGCGAGTGGGTATAGTTGTTTTCCTCCTAAATTCTG
GGTTGCGTGACTAGAGAATGTGCCCAAGAGTCAAATGGTGCTCATTTATTTTGAATTCAA
AGTTAACTTTTAGAAACTTTGTTTTCTTTTTTGTTTGTTTTATTTGATGTGAATAAGACT
ATAAAAAGTTGAGAGCCACTAAATCCAAAGGAAATTAGTGTTTTCAGTCCAGGAAACACT
TGAAAGATAGGAACCAGTAACTAGATTTTTTGACTAATATGCCAAGTGACAGAACTGAGT
AGAGATCTTGGTGATCCTTTTGGAAGTGATCTCTGCAATTCATTAGCTATAAGCACCTCC
CCTACGAAAAGGAATTCAATTTTACGGTGATAGGTGCAGAATTTGTTTTAAGGTTCTGTT
TGTACCGTCCATTTAAACAGAAGTAAACTAGTAGAAGTATCTTAGACATGGATGCTAAGA
GGAGAATGATTAACATTTGTCTCAGCTTTTATCTCTGGTTTCCTGGTAGCAATCCATATT
AATTAGACATAAATGCTCTGCCCTTCTTCAGCATTCCTGGGAGATGGTCGGGAAGAAGAA
GGGAGTCTCAGGACAGAAGGATGGCGGCCAAACCGAATCCAACGAGGAAGGCAAAGAAAA
TCGAGACCGGGACAGAGACTATAGTCGGCGACGTGGTGGGCCACCAAGACGGGGGAGAGG
TGCCAGCCGTGGACGAGAGTGTATGCATGGGGCTTTAACAAAATCAGCTGTGGATCAGTA
ATGTCCAGACTTCAGGGACATTAGGGCTCTGCTAGACTGGACTTAGCAACGATTGTATCA
TATTTTTGACTTTTCTTGGCCATCATCTTTTCTGAGACCTTGGCATCTCTTACATGTTGC
CTTTTCTAGCAACAGCCACCAGTTTGGCATGAAATTACCCTGTAGTCATTTGTAAAGTTG
TTTGACTTACAGCTATCTGTTGTGGTTCATCACCATTCCCCTAGTAACCATCATGTCCCA
TCCTTCCAGCTCATTTTCTCTTCTTTGTCTCCCCACTACTGTATATACATGCCTTTTTTA
TATTTTTACGTATCCTATTGACTCTGCTCTGGCTGTCTCTATGTTTTGGTTTTTTTTCTT
CCTAATTTTAGTTCGGGGTCAAGAGAACGGATTAGATGGCACCAAGAGTGGAGGGCCTTC
TGGAAGAGGCACAGAAAGAGGCAGAAGAGGTCGTGGCCGAGGCAGAGGTGATCAGTTTGT
CTAGGGGATGGATACTGGGGGCAAGCTAGTCTTATTAGTTCTGTAGGGGTCTACTTTATT
TAAAAACAAACAAACAAATTCACAGGGAGTCTGGTTACCTTAATTGTTGAGATGTTATAC
AGATTTTAGAGATTACTGAGTGGGCAGTGGGAAAGAAGGTAGATGTCATTTCCTCTGGTC
ATTATTGTTGATATTACTGCATTTGCTTGGGGACCCAGCAGTTTGATGAACAAACAACAA
TCTATCAATAGTAATGATTATCCTGTTGTGTTCAACATTAACTGCTCCGCTACAGAATGA
GAGAAGGAACATCTGATAATATCAACACTTACTATTCCAGAGCTGCCTCAGTTGGCAAGG
AAGTTTTATGTCAACTTCTAAAATATTTCTCCCTCCCTCTCTTTCTCTTTAGGTGGCTCT
GGCAGGCGGGGAGGAAGGTTTTCTGATCAAGGAATGGGGTAAGTTTCATTGATCTGATGG
CCACAAAGTCTTTAATTTTTTTCCTCTAAGAATCACCATAATTAGGGGCCGGCCCTGTGG
CCAGTGGTTAAGTTCGTGTGCTCTGCTTCAGCGGCCCAGGGTTTCGCTGGTTCTGATCCT
TGGTGCGGACATGGCACTGCTCATCAGGTCATGCTGAGGCAGCATCCCACATGCCACAAC
TAGAACGACCCACAGCTAAAATATACAACTATGTATTTGGGGAGAAAAAAGCAAAAAAAA
ACAAAAAATGATTGGCAACAATTGTTAGCTCAGGTGCCAATCTTTAAAAAAAAAAAAAGA
ATCACCATAATTAGAGTGGCTGATATCTTGAAGATAATAGGCAACCTTAACCAAAATGTG
ATCAGAAGATTTCTAGACTATTTAATCAGAAAGGTGTGTAGACTTGGAACTTATTTTTTA
GGGATAAGCATTTACCACTGGATCATTATGTCTGTCTCATAGCTTCATTTGAATGCATAT
ATCTGATATTTTTCCAGAATTTTCATGTAGATTCTATTGTGATTATTGGTATTCTAACTC
AAAATGGATAGTAGATATAAATTGCCATTATACCATGAAATTTTTGGTAGGTTGATAAAT
GAGGAAAAGTAGATGGCAGATAGTATATAGAGTGGGGCCATGATTGATCTGTACTAGGAA
AGAGACAGTCAAGATTCTGATTGCCCACCTCTTTGAGTTATTTTTTTTGCTGGTGCTGCT
TAAAAGCCAGAGACTCTTAAGCTTTTTTTTCCCCATCAGAACCTTTAACCCAGCTGATTA
TGCAGAGCCAGCCAATACTGATGATAACTATGGCAATAATAGCGGCAATACGTGGAACAA
CACTGGCCACTTCGAACCAGATGATGGGACGAGTGAGTGACCATTTATTATTTGTTTCTT
GTCTCTGGGAACCTAAGGACATAACTTTTTTTGAGGTTACAGTCACATAAAAAAGTGAAG
GAATAGTGTTTGGGTGCAGAGATAGGGGGAGAAAGGGATGGCAATTGAAGTACTGTGTAT
TGTCTTTACTTACTATGTGCCTATGGGCAAATTATACATGCTGTTTCACCTGATAGTCAT
CACTATTTTATGAAATAGGTATTATTTATCATCACTTTCCAGATGACAAAACTTAGACTA
AAAGAGCATTTATGGGGCCGGCCTGGTGGCCGAGTGGTTAAGTTCATGTGCTCCATTTTG
GCGGCCCAGGGTTTCACTGGCTCGGATCCTGGGCGCAGATCTAGCCCTGCTCATCAAGCC
ATGCTGAGGTGGCGTCCCACATAGCAAAACTAGAAGGACATACTACTAGAATATACAACT
ATGTACTAGGGGGTTTGGGGGACAAGAAGGAAAAAAGTAACATTTATGAACTTTGCTAGT
ATTTGAACTCAGAGTTGTTTGACTCTAAAAGCCCATGCTTTTTCCATTATACCGTGTGGC
TCCAATGTATCAGGTAGCTAGCTTTGCCTTTTGAAAAGATACCCAGGATTAATTAAGCCA
CTACTTGCAGAGATGAACAGGGCTCAGAATCAAAGCCCACTATCAGTTTGTTTTCTGGTA
CCGAGATGAGAGTATCTTTTTTCCCTTCATTTTTGGGAAATGTCTATCTGGGCAAGAAGA
TCTTCTAGCTCTCTTTGTTGGACAGTCTTCTGGGTGTGGTAGAGTATTATGTGGTTTCAA
TAAGGTTGCTTTTTTTGTTAGCTGACTTTGGTGCCTGTATCTAGGTAGGGTGTATATGTT
TAAGGATATGTTAGGCTTATGGGATACACCAAGACGTGATTGGGGGTAAAAGATACTTTT
ACAGCTTTAAATAAGATCAGTCTCTGGGCTTTCTACTTATGCGATCAGCTACTCTTTCTG
GCTGAGCCAGCACATGGAGAACCTGAGACTTTTTCCTCTTATAAAGGGGGGATGAATTAA
TAGTAGAACATGAAATAGGCTCTTTGACTCATTTATCCATTTAAATTTGCCTTGCCCCTT
TTGAAAGATCAGTGATCTCTATCTCTGTGTCTTTAGGAGGGTCTTTGGCACAAACAACTT
CTCAGCTGCTGCCCACAAGATGTTATACGTCAGGTCCTGAATGTCACTTGCTTTTTGTTC
ACCAAGCTACTTTATAAACTCATTTTGAATACCAGTTTCCCATTGGTGGAAGCTAAAAGT
GAGTTATTGGCAAGATATGTTTTTGAATTCCCTTGACCATTTGGCAGTGAAGTGTCCTTT
TCTATTTTAACTTACTATACTTTGAAGGCATTAGAACTGCTCTTATTCATCTCTTGATGG
CTTTGTAGAGGCAGTACTAGTAGTCTCAATAACAAAAGTTACTATTTTTGAGCTCTTGTT
TGTTCTTGGTTATTTGGCTTTTTATCATTGGCAGAAATGATGATAGAAGTTAAGGGGTTT
GTTTTCAGTTGTGGATAGAAAATCTGGCATAGAGTCCCAGTCCTAGATTGCAAGCCTTAG
CTGTTTTCAACAAGGATCTGGTTGGAAAAACAGGGAAGGATGGATGAGGTTGTGTGTTTA
TTTCTACTGAGTAGAGAATGGCAGATTTGGGAGGCTAGAATCAAAAATCTGTGATATGAG
GCTGAATGAAAAGTTGTGTGATGCTGCTGTCGTCTTGTTAGTGTCGAAGTGTTAGCTATA
GCTTCATGCACTCCCATCATTGGTAATTTCATGATATGAGCATAACTTCATGCATATGAT
CTCTTTTTGTGTTTTCATGATAGCAAACTTCAAGTTCCCTTTTTAATTTTAAGAGAAATT
CAAATCCAGCCTTTAAAATATCCACAGGTACAGTGGGAATTGTGTATTGGGGGCAGACGT
TCTCATTTACAAGCAAAATTCACTGGTGGTTTTTTTCTTTTCATTTGTTTTTTGTTTCAG
GACTTGATTTCATTGGGGTTGAGGGGTCAAATTATCCCCGAAAATTTGAGACTGCTCCTG
GTATGATACATCCAGGCGCCTAACTGCCCCGGATATTTTTATAGATTTTTATGGACTGAA
ATATCTGTGGATATGTCATTTTTCTGTTTTCCTGCTTTTTCTCTCATATTCTATGCCTGT
TTTTCCTTCTTCAAAAAGTTATTCATTTAATGAATATTTAGCGTTTACATTGACTGGGCT
TTCTGCTGATGGAATGGAAGCCCTAATTTGTTGTTTAGAGCACTGGCGCTCTTTCTATTC
CTTAATGCTTCCTCAGTATAGTCTTCTTCTTTAACTGTGACTGCACATTCTATGTAGAAA
AGTCTCAAGTAGGTATCTACATTCGTTCTTTCCATCCCAGCTACAGCACAGGGAGTGCAG
AAAAAAAATTCTTGCATTTGAGAGAGAGCCTCTCAATAGTAGATAACTTTTCAGGTCACT
TCCAATCCCAGGATTGTGTGTGTTTAACCCAGATCTTAGGTTCCATTTAGCCAGGGTGGA
ATGGATGTCAATGGGAGGAAGAGTGGTATCACTGGAGAGGGAGAAAAGAATGTTTGTAAC
TTGTCTAAACTGAGATATTGGACTTGGGTTTGATTTCAGGAACATTGTTGTCGTTAAGTG
GTTTGGAATTTCCCTGGTGCAGTTTTAACATGGTCTTGGGAAAGGCATTACAATGAGCAT
ATTTTTCTCTAGGAAATAGGATTATTCATTATCAAATGTTTAGAAGAATTTCTGATGGGT
TTTGTAGGTGTTGGAATATTTCTCTTCAGTGACAGTGTAAATGCCAGACTTTCATTCTTG
CAAGAAGCTTTCTCCATTTGAAGAGAAAGTTTTAAGAGTTATCCAGTATATGCTGTTCTG
GAGAAGAAAATGAGTGTTCTTGTCTCTTTTCTAGATAGGTTCTTATTTTTTACTATGGTC
CTTTGGTTGAAAAGAATCCTGGGTCTCACAGAAACTCTCACCTATGTTCCTTAAGAAAGG
GCAGCTTCCCTGAGGATGTATGTGTACATGAAGCAAATCAAGGGGAATGTGCAAGGTGGT
TTGATTGCTAATGGACCCATCCTGTAGAAACTGTGTCCTGACTTTGTTATTACCAACATG
AGGATGGTATGCACCTCCATTGTCTGCGCCTCGACTTTGGCAGCTCAGATTTCACGTTGT
GTGTGATTAGGATTAGGACGATAACTATCACACATACTTGAATCTTCACTCTTGTCCAGG
GTGTTCCAAAAAGAACAGATCCATGGGGGAGTTTCTTATAGTTAAACCAATAAGATCCAT
AAACTTGACTTCTGCTGAGTATGCATTTTTAAATTTAGTTCCAGTAGCAGATAGTTGTCA
GTGCCCTCAGTCTAGATTTCAAGTGTTTCCATCACTGCCCTTTCACCATCGTGTGGCAAC
TGTTTGTTTTCCTGTGTCACTGCTGCCATGTCTCTTCAGACTGCCTGAAGTATTGTCTTA
TACCTGATGAATTGGTGTAGTTTTCATGTTCTGGTTTGAATTGGCTACTGCCGTTTCACT
GAATTGACTACTAAGTCAGAAGGCTGAAGGACCTAAAGAGATTACCTGGAGCATTGCGTC
CGTTGGGATCTCTGGGGTCTCGTGCTCTCTCTCACATTCTCTGTCTCTCTCTCTTGCTCT
TTTTGCTGTTATAGCTGTGTAACAAAAACTGAAAGTAGCTGTGAAATCATAATCTTATTA
AAGCTCTGGTGATCTGAGGTATCTCTTTCTAAATATTAGTCTTTTCCTCCCTCTGAAGCC
CAAGAATTCCTTCTGATTACTAAATTCTGGTTACACTTTTGGCTGCCAAAAATGTTAATT
CATTAGTGTTTTCTGCACGTTTTATACTGGTGCTTAAAATTACTTTACTGTTTTTCCTTT
ATTCCCAGGTGCGTGGAGGACTGCCACAGAGGAGTGGGGAACTGAAGATTGGAATGAAGA
TGTAGGTATTGCCAGGTCATTCCTCATTAGTGCCTTCTATCCCTAAGTGGTGTTTAGGGA
TAGAAAATGGGTATGTTTCTACGCCTCAAAATTCACCCTTAAGATTCTGACCCAAAACTT
TTACATCCAAAATAGTGTTCTGAGCCAGAACATTTCACATATGTTATATGAAGGAGACTG
GGCATGAACAGGACTCTGTGGAACCAGACTATGGAAAGGGCAAGTGCACTTGTGTAAGTC
CAATATCTGATTGTCGGATTTATCCCAGGAAGAGATGGTGGTTGGGTAGGGCACAAGAAA
TGGAGTTAGGCAGGTAGTGCATTGAGTAACAGCTGCTGGTAGCACATGACTTTACTTGGA
GCAATTCTCTTATTTGGTTGACATTCAAGCATTGCTGTATGGTCCTGTAATTGGCTTGAA
GGTGGGTACAAAGGAGAGTTACAGTACCAAGTCCTCCCGTTTATAATCTGGTTGGCTCTG
GAACCCTTTTATTTATTCGAAGCCCAACGTTGTAATTGAGATGAATGTGTAGAATTGGCT
ATCTTCCAGCTTGACTCAACTTGGAAACCTCATAGAAGGGTGATACAAGGTGGCACATAA
ACAAGCTCTGTGAATTCACTGGAGTAGTACCTGAGTACAAGAATTTTGCCGATTCCTGGT
CACAGTCAAGTTTTTGCTCTGAATTACCATTTTCAGTGATCATGAATACTTGTTTTAACA
TTTTTAAATCTGCTTTTCTATGCTGGTATATATTCAGGCAAGACAGCTTTTATGGTAAGA
GGAAATGATATGTCAAACTGTTTTGGTTGCCAGGCCTGAGTTTTTAAAATTTTAGACGCA
TCAGCATCAGAGGGTGATTATTTTCTGTTATAGCTGGGCTTGTGAATACTTTCTAAGATT
TGACTTGTCTGCTTAAGCAACTTTCAGAGAATGATATATTTGGGGGAGTGGATTCCCTGT
TTTTAGAGGAGAGATTTTAATCCAAAAATAAAAAGAAAACAAAATCAACTTTTGAATAGT
AGGAAGAGTTACTCACTACAATTGCTTACCTTATTTTAGTGTCTTACAGTGGAGACACTA
GGTGTAGCAAGTCAGTATTAGGGCAAAAATTGCATATAGTTAAAGTTATCCCTGAAAAGA
CCTTAACTCACCAGCACTTGGGTCCTGACTGCTCAGAAGCCAAGAATTAACTTCGTTCCT
GTCTTCATCTTGACTGTGATCTTTCTTTGAGAAGAGTGGTGAAAGATAAAGTGTGGTTTG
GGTAGAGGTGGGAAGTTGGGAACTGTAATGGGAAAATATAAAGGGGATTTCTCTTTTTCT
GTCTAGCATGTATATTCACCTTCCTGTAAGTTTAGTGTGCATATTATGTGACTCCACTAT
TTTTTTTATTGGGTTTCTTGATTCTACCTCTCTTTTGATAAAACAGTTGAACATATATAG
AAGGGGCTTGAAGGTAAATCCATTCAGGATTCCTCAGGATAGATAGTTTCTGTTCTAAGG
GTTTTCCCTCTTTTTCCTGTTGAATTCCCCTTACCTATGCTAGATTTTTGACCTTCACCT
GCCTAACACCAGGAGTGACTAATTACTCTGTTTTCCAGCTTTCTGAGACCAAGATCTTCA
CTGCCTCTAATGTGTCTTCAGTGCCTCTGCCTGCGGAGAATGTGACAATCACTGCTGGTC
AGAGGCAAGTGTGTAGTAAAATTCACTATCTTTTCCCAAAGGGATCTGCTGAGATAGCTG
TAAGGAGAAGTGGCACTGGGCCTTTGCAAGCTCCCATGGTGTTGGTAATGAGAACCACAT
CATGTTAGGATCCTCTCCAGTTAATTGATAGGTTTTATAAGAGTTGATACTAATTGATCT
ACTGAATGAAAGTCTATATATTACAATTTTAAAGTTGATTCTCCCCGTAATAGCCCTTTA
ATTACATAGATCGGCCTGTCAGCATCACAGGCATTGATTAAGACTTAGCATGATGTAACT
TGTCTTGTAGTAAGTCAGATGGAAAAAATCTAAAAGTAGAAATGTTTTCATTCATTTCTG
AATTTGCAGAACTGTTCAGTAGCTTCTTCTCTTCCTTTATAATTGTGATCTTTGTCTGCT
GAGCCCACTGAATATAGTGATCATTATTTTCCCTGGAATCCAACTAATGAACTTTTTAGA
ACTTGAACCTAGGTATTGGGGTCAGTAGAGGGAGATTCACTCATTAGGGAATATTTTTAT
CCCCTGAAAGCCTCTTGGATTATTTCTAGACCTGGGTGTGATAGCTCTTGACTCAGAATG
TCCTAAAGAGAAGTGCGATGGGAGTAGGATGTTAGGGATGTCATATTAAAGGTAATGTTT
GCTTTTTTTCCTGACACCAAATACCTATCGTTTTTCTGCATCGATTCTCCAGTTCTTTGA
CACCAACTGAGTGTTCAACACTTCAATTTAGTTCTGACACTAACTGTACAGAGTTAGCTC
AGACCCACGTTGAGGGCTCAGACCCACAAGACTGCCCTTGCTTCAGCTGCAGATGGGTGC
CCAGGCTACCCACACACTTCTGTCTGGCTGACTACAAATTTTGGGGTTCCCACAGCCCCC
TCCTCAGGTTTAATAATTTGCTAGAACGACTCACAGAACTCAGGAAAGAGTTTTACTTGC
TATTACTAGTTTATTATAAGCAGTAGTCAGGAACAGCCAAATGGAAGAGATGTATAAGGC
AGGGTATGAGGGGTGGGGCACAGAGCTTCCATGCCCTCTCTGGGTGTGCTGCCCTCTCTG
CTCATTGATACCTTCAGATATGTTCACCAGTATAGAAGGTCACTGAATTTCGTTCAAGAA
TTTTTATCAAAGTTTCATTGCATAAGCATGATTGATTAAGTCATTGGCAATTGAATTCAG
TCTTCATCTCCCCTTCCCTCCCTAGAAGTGGGCGGAGTGTGGTGGAGCTGAAAGTTCCAA
CTCTGTAATCACATTCTTGGTGTTTGTGGTGACTAGCTCCCTTCCTGAAGCTATGTAAGG
TCTCGGAGAGGGGTGGCAAGGAACGGGTCAGGCACCCTGAGTAACCTCATTAGCATAAAA
CTGTGATTGAAGAGGGCTCATTAGGAATAACAAAGACATTCCTGTTACTCAGGGATTTTT
TTTTTTCCTTTTTCTCCCCAAATCCCCCCAGTAGATAGTTGTATATTTTTAGTTGTGAGC
CTTTCTAGTTGTGGCATGTGGGATGCCACCTCAACATGGCCTGATGAGTGCCACGTCTGC
GCCCAGGATCCAAACTGGTCAAACCCTGGGCCACCAAAGCGCAGAGTGCAAACTCAACCA
CTCGGCCATGGGGCCAGCCCCTACTCAGGAAGTTTTAAAGGTTTTAGGAGCTCTATGCCA
AGAACTAGGGGCAAAGCCCAAATATATACTTTTATTATACCACAGGTAACTTTGGAAATG
TTGAGAAAAAAATTCCCCAAACCCTTTTTGTTCCAAAGCCACTTGGAGATGAATGTTCTA
GTATATGGTTTTATATATTAGATATTGGTAATGACAGATATTCAGTATTAAAATCATGGG
TAAAAATCTGTAAATTTTGGCCCAATTATTGAGCTGTATTAAAACTAGCATTTGATATTT
TATTAAGTTAATATCACTAAAATATTTAAATAACATCATTATAGTTGCCAACATCATTAG
AATACAGCTAGATACTATAGTGGCTCTTGTACATCAGTTATGTTAGTAAATTAAGCATTT
CAGGGCTTTGTGTTTCTGGGGAGCGACTTCATTTTGATCTGACCATAATCTGAGTCAGGT
GTTGAGGAATGCTAGAATATTCAGTCATTATTCATCGAGATCCTGTCTCGTCTCCACTAG
AATCGACCTTGCTGTCCTGTTGGGGAAGACACCGTCTTCAATGGAGAATGATTCATCTAA
TCTGGATCCATCTCAGGCTCCTTCTCTTGCTCAGCCTCTGGTGTTCAGTAACTCGAAGCA
GAGTGCCATATCACAGCCTGCTTCAGGGAATACATTTTCTCATCACAGTATGGTAAGTAG
GAGACACGGTGTATCCTAACCAAACTTTCCTGCTGACTCCAGCACATACATACAGTAATT
CCTTCCAGGGACAGTCAGAGGTTTGGGGCAGGGTAAAGCATCCTCTTTTGTCCTCCTAAG
CAGACTTGGGTGTAGAGATGTTGAGTTGGGTCATAGAGGGTAGCTCTGGGAGGGGACGTA
GTGTTGAACAGACTGAATCTTATAAAAATGAGTTAACGTCATTTACTGTGCTAAACATTG
TTTGCTGTTACTCTTGAGGAGAGAAGAGAAAGTCAGTTACATCAACAAATTTTAATCTTT
TTGTAGACCTAATTAAAACTTTGATGGCAGGTCATAGCAGTTCCCTATTTCTTGATAAAA
GCAGAATTGCCATATACATTTATTTAGACCAGTTATTTCTGGACCAGGCTTCCAGAAACT
TGGGGTCTTCCTGAATCTGCCCACCAACTAGCTGTTTGTCCCTTTCTCTTTAAATGGGGA
TAAGAGTGGTTGCTCTGCCTATCTCACAGGGCTTTAGGAAGATAAATAAGATAATGGGGG
GGCCGGCCCCGTGACCCAGTGGTTAAGTTCTCACGCTCTGCTTTGGCGGCCCAGGGTGTC
ACCGGTTTGGATCCTGGGCGCGGCCATGGCAAAGCTCATCAAGCCATGCTGAGGTGGCAT
CCCACATGCCACAACTAGAAGGACCCACAACTAAAAATACACAACTATGTACTGGGGGGT
TTTGGGGAGAAAAAGGTAAAATAAAATCTTTATTGAAAAAAAGATAATGGGTAAGGGCTA
TACAAATGTGGTGGGAGTAGTGGTATTATTTATTAATATCCTAGAACACTTATGGCACGT
GACTTGTTGATTTAGAACATTAAAAAAATTCAAGGTCGTTAACTATAGCAAACGAATCAT
TTAAGCTAAACAAAGATGGTGGAAGGAACGATTTTCTTATAGTCAGTAAATCCCAGTAAG
TACTGCTTTTTCTCTTTTTTTTCCTCCTCTTTGCTTTTCCTTTCCTGTCTTTTTATTTTT
TGGAGTAGGGATATTATAGTTATTTCTTGTCTTTTTGTTTATTTTTTGGTGAAGGGATAT
TATAGTTCTAAGAGGTAAGAGACCATGTGTGTGTGTATAATTTTGTTTTACCAGTAGTAG
GGTTGTAGTAATTATTTTAACTAGAGAACTGCTGAGCTAGCCTCTAATCCAGAGCTCTGT
CAGTTTTTAACTATTGTCTTAAAATGTTTTTTTGTGTTAATAGTAATTTAGTGGTTGATG
TTCTGCCATATATGAAAGATGACAGGTGAGAAAAGTTAGGGGAGAAGGGAAAGGGAGAGG
GGTGATGGGATTAAAACGAAAAAGAAGAAAAACAAAATGGGACAAAGGCCCTAAGAAGGT
GTAAAGAAGATCAGGAAATAACTACCAACCCCTGAGATATATGATGGGAAAATGTGGTTA
AGTGCCATATGTCTCTCTTAATTGATTTTTAATGTCTGGAGTTGTGAAGATTTATAACCA
AATCCAAATTCTGATATCAAAAATAAGTTTTCAACATACATCCACTTTAACATTCTATTT
AATCTGTATCACATATGTTAAACTAAATATAAATACTATTCTCTTCTTTCTCATTACTTA
TATTAATCAGTATGCTATTTAATGTAGTTTCTTTTCCATTGAGAATAAACGTTAGAGGAT
TAATTTCCCTGGAAATTTAATAGATGTAAATAATATAGGAGCTCCTCTATTAATTATCAT
GTATAATATATGAAAATTAGGTAATTTTCTGTGCCTTTAATATAATGCTTTGCACTTGCA
GAATATTTGATAATCATTGCTGTGTGAGATCATCTCTCTGCCACAGTCCCAGACTTTCAA
CTAGACTTCTGGTGTTTTTTGTTTTTATTTGTATAATCTTGAGATATGGACTAAAAGGGA
AAAACATGCCCTACCTTGAGTTGGACAGACTAGTTTTATATAAGCAGTGCACACTGATGA
TGAGGAGGATATAATTAAGAACCTAAAGAAGAGTAGAATAAGTCTCCGTGGAGGTTTTTT
AGAATAGTAGGGCCACATGGATCATCTTCTGGACTAGGCTGGTGGTTTTACTTGGTACTA
GAGAATGGGGAGAATCCTCCAAAAAGCATTGAGAGTAAATTTCGCTTTATTATTGTGATT
ACTCCATAGAACTTGGATACACACAGAGAAAACAAATTATATTGACTTACTATCTGATTG
TCTAGTGCAGAAGTTGGGCTGGTCCCTTAACTTTTCGTCTTTCCCTCTATGCTAGTTATT
AGCAAAATTCAGATGAGGCTCCAGTTAGTTAATTGTTTTTGTTCCTTTTGAGCTGTTAGT
GGGAGGGGCAAGGACCCTGATGGCTAAAGTGAAATTTTATCTTACCTTCACGTTAATTTA
ATAATCAAACCTTGGTTGATTTAAAACTTTAAAAGGGGGAAAACCCCCTGTAGTCATTAG
AGCTGTGTACTTGAGAAGGAGGGAAGAGGAAGTGATGATAATGGTATAAATTTTAATGGC
TCATTTTTTTGCATGCTTACTGTGTGCATAGCATATAGTTAATGCTTTATGTGCATTGTT
TGTTTAATCCTCCTAAAACTTTACGAAGTACTACTTTTATTTCTATTTTCAGATGAGAAA
AGTGAGGTTCAGAGAAATTGCAAGTTTTTTTCCATGATTGCATAGCTGCTATTTGAATCT
AGACAGTCTTACTCTGGAGCATGTGGTCTAATGGGCTATGCTGTCTCCCCTGTCTGGGTG
ACCTTCTGTATTTGTCTCATCTGTACTGGTTCTCACCATGAATAAGTGTCTTTTTGAGTA
GCTGAACAAAGTTGCGGGCTGCAGATTTCTCTAATCTGTTGATCTACAGGTGAGCATGTT
AGGAAAAGGATTTGGTGATGTCGGCGAAGCTAAAGGCGGCAGCACCACAGGCTCCCAGTT
CTTGGAGCAATTCAAGACTGCTCAGGCCCTGGCTCAGTTGGCAGCTCAGCATTCTCAATC
TGGAACCACCACCTCTTCCTCTTGGGACATGGGCTCCACCACACAGTCCCCATCGCTGGT
GCAGTATGGTGAGAAAGATGGAAAGTGATTTGAGTTCTTTAAGCATTGGAGCATTACTGT
CAAGAGAGTAGCAGGAGTGAGTGGGAAGAATGTGTCAAAGTGAGAAGGGCAGCCAGCTGG
CTAGTTTCCCACACTGATTTCCCCTGCTCAGATAGGCTGAGTTCAGGAAGCTGGTAGAAT
AATAAAAAGTTGAGGCTGTAGATCTCTTTCATTAAATTTAGCCATATACCTAGGTTCCGT
CTTCTGGCCTAGGGATTTTTTGGATTCTCCCTAGATTTATCTTTAGTGTTTGGAAACAAC
GTATTACCTTTGAAAACATTCATAGACTTGGCCATTTTAGGACTTTCTACTCTAAACGTC
GACAATTCCTAGGTTCCTGTCTTACATAGGCAGGGTCATAGTGTTGATTTGATTAAGCTC
TACTTAAGAACAAATATGAGGGGCTGGCCCAGTGGCGCAGTGGTTAAATTCGCATGCTCC
GCTTCAGCGGCCTGGGGTTCGCTGGTTTGGATCCCAGGCACCGCTGCTCAAGCCATGCTG
TGGTAGGCGTCCACATATAAAGTAGAGGAAGATGGGCACGGGCTAGTCTTCCTCAGCAAA
AGGAGGGGGATTGGTGGTGGATGTTAGCTCAGGGCTAATCTTCCTCAAAAAAAAAAAAAG
AACAACAACAAATATGATTGTCACCTATAGAAATGAGGTTAGGCCCTAAAAGAAGACTTA
TTTATAAGATTCTGATTCCTGATGGCCTAATTCATGGCTCTAGAGCAGGATGATAGCATT
TTTTTGAGGTTCACCAGCCCCTCTGGCCTCATACATACTGGATTTCCTCGTGCAGATTTG
AAGAACCCGAATGATTCAGCAGTGCACAGCCCCTTTACAAAGCGCCAGGCTTTCACCCCA
TCTTCAACCATAATGGAGGTGTTCCTTCAGGAGAAGCCAGCTGCAGTGGCTACCTCCACG
GCTGCACCTCCACCTCCCTCTTCTCCTCTGCCAAGCAAATCCACCTCTGCTCCGCAAATG
TCTCCTGGGTCTTCAGACAACCAATCCTCCAGCCCTCAGCCGGCTCAGCAAAAGCTGAAA
CAGCAGAAGAAAAAAGCCTCCTTGACTTCTAAGGTACTTGAAATTTTAGATAGGTGCTTT
CTGAGGGCCGAGGGCGTGTGGGATTTGGAAATTAAGATTCTAAGGATGTAGCTTGGAAAT
TTGAAGCAGAAGTTTTTTATTATTCTTACAGTAAGGTTTCAATAAACCATTGTTTTCTTT
TCTCTACAGATTCCTGCTCTGGCTGTGGAGATGCCTGGCTCAGCAGATATCTCAGGGCTA
AACCTGCAGTTTGGGGCATTGCAGTTTGGGTCAGAGCCTGTCCTTTCTGATTATGAGTCC
ACCCCTACCACGAGCACCTCTTCAAGCCAGGCTCCAAGTAGCCTCTATACCAGCACGGCC
AGGTAGAGGAAACACCAGTCATAAGACTTATTTTATTAGGCTTTTACCACTTTTTCTAAA
TCTCTTTTTGATTCCTAGAACTCTGGAGAGGCCAAGCCTCTGACTGAATGAGGGAAAAGT
AGCCAATTGTAGCATTTTATTGAGCACTTTAAAATACTGTTACTAGGATTATCTATAACT
CTAAACAGATAGAAATATACCCCTCAAATACCTCTAGAATGTCTAAGTTTAGGTCTTAGA
GATGTGTGCAGCACCTCTAATGGAGAGTACTTTGGCATCTGCCACAGCTAAAAATGCTTT
TGACACTTTTTAGCATTTTGGTGTGGGACTTATGCCTACGAAGGGTATAACTTTGAACTC
CTAGGAAGGATACTCCTGTCTTCTCTGATAGCTGCCAGGGATGGCCATCTTAAGCAATAG
AAAATCCAGGAGGAATTTCAGGGGACTAGGCTGTTTTTCTCAATCCTTAGAATTTAAAAA
TATAAATGTCTCGCCCTAGCCCAGATCTATTGAATCATAATTGCCATTAATGCATGTGAA
TATTTTAAAAGTTTCTCTCAGGAGAGTTCTACCAGGAACCTTATCTCTAATAGGGTTTTT
GAGAGAGCCAGGAGCTCAGAATTCCTTAAAATGAATATGAGGAAAAGAATACTTCCCAGG
CTTAGGGTTCATGTTATGATGTATTGAAGGGACCAAAAGTAGTGTATCCTTTCTCCTGAC
CTTTAGCCTCTTTCTTGTAACAGCAAAATGTAGGGGAACAGGAAATTTTTTCTCTTCCTT
TAAGAGTTGAAAATGTTTTAAAACTCCATTCTTAATTCAGATTCCTGGCTGTATGGCATG
TGGAAATTCCTCCTATTGTCAGGAGAAGATTGTGGCAGTTTCTTTTATTTGTTGCTAGAA
ATTTTCTTTTTGATTGTAATCAACTTACTCTAGTATCTAGTAGTAATCTCTATCATTTCC
TTAGTATCAGTGGATCTTCTGTTTTGTTTCTCTGAGTTTCCTTCTCCATTCCCCACAGTG
AATCTTCATCCACAATTTCATCTAACCAGAGTCAGGAGTCCGGTTATCAGAGTGGCCCAA
TTCAGTCGACAACCTATACCTCCCAAAATAATGCTCAGGGCCCTCTATATGAACAGAGAT
CCACACAGACTCGGCGGTACCCCAGCTCCATCTCTTCGTCACCCCAAAAGGACCTGACTC
AGGCAAAGGTAGTGGCTTTACGAGCCCCAGGGCATTGGTTATCGGCTAGAATAGTGGGCA
AAGTCCTTTAAATATTAGTGTTTCACTTCCTGATGAATAATGCTAAGACACCTCCGAAAT
GCTGATTGAGAAACTGAATAAAGCACATTTTTGTGGCAGATGAAGTAAAAAAAGTGCTTT
TCAGCAAGCCTGGAGACTCAGAGCCAGAAAACCATTCTGTTTGTACTGAAGATTAATTCT
GTCTAGTATAATCAGTTTTAAGTACCTCTTTTCTTGGAAGATTTGATTGCTAGACTTCTA
GGTGCATATCAGTGGACCTCTCCTTGCTATATCTTGGCTTGGTGAGGGGGACAGCATATG
CCAGAGGTGATGTGGAGTGACTGTCAGATACAGCCAGCAGAATAGATGGTTTGGCTGAAC
TGTCTTGCTCCCACATCCATCCTCCCCCGGGGATCACTGGATTTGGGCCATCTATTTTGG
GTTTGGGATCTTTGCAGTAGTTTGGGGATGCCTTCTTTTGTCCTGGGTCACGCAGCGTTG
GTATATGTTGTTTTTATTGTTGTTTTTAATTTTTGTTATTTTGTTTGGATAGTCTGCATT
ATGTTCATCTTTTGGTTAACTTGCAGAATTTCTCTGAAAGGTTTGTTGGTGGGAATTAAG
CTGAGACAGTGCTAACCTGACCTATTCACTTGACTTTGTTTCTTATTCCTCTGTTTTGTA
CCAGAATGGCTTCAGTTCTGTGCAGGCCACGCAGTTACAGACCACGCAATCTGTTGAAGG
TGAGTGTTCTCCAGGCTTTTTCCTCTGAGTTCTAGTGTTTTTCCTCCCCTTTTAATATTT
TTGCATTTCTTAGATTGTAGTGAAAAGGGCCGTGGTTCAATGATCAAAACTTCTTGTTAT
AGTCTTAGCTTGGCTCTCCCTTGCTGTTTAATCTCAAACCATTCTAAGTTTCAAGTTCTC
TGTCTTAAAACAGTGATAATCCCCTTGGTTCCTTTCATTGGACAAATGAGATCAGTGCTG
TGAAATGCTTGGAATTTAAAAAAAGAAAAGATTCTACTTAAACACAAATGGTCCATTATT
AAATAACTCACTCTTGTCTTTGGGACAGCCTAGGACTGTGGTCACCTCTTCACTTATTAC
AAACATTCCCTTTCCTCTGATGAGGTGAATTCCTTTCTTTATTGCCAGGTGCTACAGGCT
CTGCAGTGAAATCTGACTCACCTTCCACTTCTAGCATCCCCCCTCTCAGTGAAACGGTAT
CTGCAGCTTCTTTACTGACGACAACCAATCAGCACTCGTCCTCCTTGGGTGGCTTGAGCC
ACACTGAAGAGATTCCAAATACTACCACCACACAACACAGCAGGTGATTTGGGGTGAGGG
TGGAGGATGGGGTTGGTGAGTAGTAGTACCAGAGCTCTCTGGTTCTAGCTTACGCTCTCT
ACCTGCCAGAGATCACATGAGCTAAGTGGATGACCCAAGAGCTATGAGAAGTAAAGACAG
GAGGCTTATTTTCCCTTTTCAACATCCATTCTTGCTTTAGCTGCTCACTACCCCTGGGTG
GCCTTTGTGCTTACCATATGGTCTCAGATCTCCTTGGTCTCATATTCTATCTTATTTCCT
TTCCTGTGTTTTTGACTGAAGCTCCACGTCAGGTAACCATAGCACTGTAGCTGACGGCAA
CCTCTTTTTCCTTACAGTGCGTTATCTACTCAACAGAATACCCTTTCGTCATCAACATCT
TCGGGGCGCACTTCAACATCCACTCTTTTGGTAAGCATGATGCTGTAAAAGAGGAAGTGT
GGTTTTCTTACGCTTATAACTATCCAACTATAAGATTCTCCCAAGAAGGGATTCTTGAAA
TTTTTTCATGACCTGGCAAAATGATAATTGATCTGAGGTTGCAAGAAAGGGGTAAAAGGA
TGTTTGAGGCCAAGAGAGGCAGAAGAATCCAGAAATATTGCAGAACTGTGGGCCAATTCT
CCCAACCCTGGAAGTGACTTTCCGAATCATTATGTGACCTTTTTTTTAAACACTGAAGCT
GGGTGAGGCTTTGTGTGCTATGATAAATTCTGTAAGAACATCCCTTTCTGGGAGCTGGTA
TAGCCATTCTCATTTCTTGGTCTGGGGTATGCTGAACATGATTCCTAAAAATAATCAGTG
TGAGTCTGGGAATCCTATGAAAGTAGGGGCCAGACTAGAGCTTTTGGTCAAAGAATTGAT
TTCACTGTTGGGATTTATAACAACTATTTGTGGCATTAAGCTGAGATGGTAAGGAAGACA
ACTAACTTAAAAAGCAGCCATTTTAGGCAAAGATGTCTGCGTTGCCAGAAGCCGAGGGAA
GATAATGAGGGCTTAACGTTTTCTTAGGAGCCTCTCTTTTCTCAAATATACTATTTCAGG
TTTAAGTTCATTAGAACTTGTACTTCTTTCTAGCCCATGAACTGGTTTATTGTGCTGAAT
TAGTGAGGAACAGTGTGGGAGAGAAGGCTGTGATAGATTTTTCAGATCTAAATTATCTCT
GTCTCCTTACTGGCCAATCAGTGTCGGTGTTTAGGGAATTTGTCCTCACTCACTCTGCTG
CCTTTCTGAACAGGGTGATGGTGTGCAGTGGGTCTCTTGTAATCCTTGCCAGATCAATCT
TGGAGAATGTCTAGCTGGAGAATATTTAGTAATTTCTTCTAACTAGTTTGGCAGAGGGCA
CCCTGGTACCCTGCCTCAGCCTTTTTAATTGGGAAGTTGACGTGACAGTATAATCAGCAG
AGGGGATTGTTTATCTTTCCTGACCTGTTCCGCTAATCGCTATTTCCTCCTCCTCTCTTG
CACTGCTCCCCCTTCTTGAAGCACACAAGCGTGGAGAGTGAGGCGAATCTCCATCCTTCC
TCCAGCACTTTCTCCACCACGTCCAGCACAGTTTCTGCACCTCCCCCAGTGGTCAGTGTC
TCCTCCACTCTCAATAGTGGCAGTAGCCTGGGCCTCAGCCTAGGCAGCAACTCCACCGTT
ACAGCCTCAACTCGAAGCTCAGTTGCTACAACTTCAGGTAGCCCTGTGCATAGAAAGTGG
GCAGCATTCCTTTGGGATGAAGGAGAGAAGTAATTGGGTGACAAGATAAAAACGTACTTT
CTTTTTTAGGAAAAGCTCCTCCCAACCTCCCTCCTGGGGTCCCGCCATTGTTGCCTAATC
CGTATATTATGGCTCCAGGGCTGTTACATGCCTACCCGGTAAGTGACACTGAAGGGTCTT
CAAAAGATGACGATGATGTGGCTATTCTTTATAGCTCTGGCTTTCATTGGAAGACTATAA
TTAACATACAGAATGAAGGAGTGGTTGTCGCATGTAAGCAAACAGGTTTTTAATCTTTGT
GGTTTTGTAAAAAGTAACAGTTTTTAGAGAGGAAGGACTAAACTGAGGCCAGGCCCTCTG
CTGTGTATTTTCTCTGTGTGAAACAAATTCTGGACCTCAGAAGCCAAAGGCCAGACAGTC
CACCTGGAATCCCTTTCAGTTTCTTAAAGAATTATTTTCTCTAGTTGGATTGATCCGTTG
TCTCTGAAGATCTTTCCTGGCCCTGACCTGGTCAGAGCAGAGTTCCCTGGCTCCATCTGG
GATATCTGAGAATAGTAGTAGCTTTTTGCCCTGGTGTATCTTCTGTCAGCTTCATGTATT
CAGTGCCTATTAAGATGAAGGGTATTTATTAAAAAAATTTTCATAAAGACACCTGTTCTT
ACCCTCAGAGAATCTAGATGAATATCATACAGATGAAACATCCAGTACGACTTTCCACAT
CTTTTAACAATAACACACTACCTTAGTACCCAGACATTAGAGAAAACAAAAGTAAAATAT
GAATCTTTTAAGTCATATTTGGAAGGCTTACGCAAGAGACAAAAACTAGTAGAATAGAGA
GTAAAGCAGGCTATTCATGTATGACTTGTGTCTGCTCTGCTGCTACCCAGTGGCCAGCCT
AGTTGAATCAGTAGTGTGTAGCTCAAGGAAAGCTTCAAGACCTTTCATGAGTTACTTAGT
CTCTTTGTACTTCTTTTCTCTTAAAGAAAACTGAAGGGAATCTGTGTTTTGTTGTCCCTA
TTAATGAGAAAGAATGTTCTGTTGCTTTATCATGTCTCTTAGCTCCATGGTTTGCTGCCG
TCATGACCAGTCCCCATTAATATTGTTACATGTTTGTATCTTTCAGCCACAAGTATATGG
TTATGATGACTTGCAGATGCTTCAGACAAGATTTCCATTGGTGAGTATGTGATGTAGAGC
TTAGGAAAAGAAAATGATCTTAAAATTAATGTTGGGATTATTTTAAATGTTTAATTGATA
AGTCACAGACTTAGCTCTTTCCCAACCCATACTTTGATTTAAGCTATATTAGAATATAGT
GGCTTGGCAAGTGGTTCTAACAGAAGGTAACTATTTTTTTTTTTATTAAATCAGAGTTGT
TACATCTTTAAAGGAAACAAATTTTAACCTAATCTATAGCTTAGGGTACTCTGGAGCAGG
ATGTGTTCTCTGTGTTTCAAACACTTTAATTTCCAGAAAGATTTATTTTATCAGTAGTAG
TAGACTATTAGGGATAAATCTAGAGGTTTGAGAATGTTATTGGTCCTAATGGACTTAATG
TCCATCAGGTTCTAGTGGGCATACCCGTAGACCTTGCCTGACTATGCTCATGGCCAGGCA
GGGGGGACAGTGTATGCAAGAGTAATTTGGAGTTCGTGCCGGCTCTCGCCAGCTTAATCA
GTGGCTGGATAAACTGCAGTACTCCAACATTCTCCTACTTCTCACCCTGTGGAGTTACTC
ATGCTGAAGAATGAGTGGCATTGAGTCTCTGCTGTTTTATTTCTTTGCTTTTTTATTTCT
CTCTTCTAGGATTACTACAGCATCCCATTTCCCACACCAACCACTCCGCTGACTGGGAGG
GATGGTAGCCTGGCCAGCAACCCTTATTCTGGTAGGACTGGGATGGGGCTGAATAAAGGG
AGATTGTGTTGGGATTGGTGGCAGAAACCTGATTAGTAGCAGAAAAGGACCCAGTTTTCA
CATTAAGATTTTTTAGCAAAAGTATAGAATGGACATGATGAATCAGAGTTGGTAGATTCA
AAATCCTGCTAAAGATGGGCACGTAGCAACTTTGTCCTTCTCATTCCACTTTCTATTTGT
CCCCCTGATTCCAGGTGTTGACTTGGTTCTCTCAGCTTTTTCCAGGAAGTACAGTGGTTG
AACTGGCCTTCTTCTGCTCACCTCTCCTCCTGTACCCTACTCAGTGGCAGTATCATTGCT
TTGCTAAGCCATGGGCCTTTTTTTGCCTGACTTAGCGTTGTCCTCATTGACTTGTCATTT
TCTCTGACCCATCATTGTTTTTTGAGTCCAGCATGAAGTGTTTCCCCTGGAGGAGAAGGG
GGAAGGGGCAGTGGTGGGGAGATGAAAGGACATGAGTGGACAGAGAAATCATCCAGGAGC
TTTATTCTGGGAGCCTGTCTCTGCCATAGCATTGTACAGTCATTCAGCGTTAGCCCTTGA
CTAGCACTAAGCTAAGCGTGTGCTGAGCCATGCTAAATGAAGCCGCCAAGAAATGTAATT
CAAAGAATAGTGTTTGAACAGGATCTCCTGGAATCATGTGAAACCAAAAGAGGTAATTGT
GTATTGGTCTTGGGGGTGAAAGATACAGGCACATTTAGCCTCTCTTGTCACAGGTGACCT
CACAAAGTTCGGCCGTGGGGATGCCTCCTCCCCGGCCCCAGCCACAACCTTGGCCCAACC
ACAACAGAACCAGACGCAGACTCACCACACCACGCAGCAGACATTCCTGAACCCGGCGCT
GCCTCCTGGCTACAGTTACACCAGCCTGCCATACTACACAGGGGTTCCGGGCCTCCCCAG
CACCTTCCAGTATGGGCCTGCTGTGTTCCCTGTGAGTACCTAGGCTTGGTCTTTTCCTTA
TGGTGAGGAATCCTAGCCCTGGATGCTATCCTAGCTGCTTTCAAGGCTAGATGACTTTTT
AATAATATATGAGGAGGAATAATTTCCACCTCTGGTCTGTTTCTGACCTGGGAGAGGGGG
TGGGGCTGGAATTGGTGGTATTGGGTTAGGGATTACCTTTTCTTGGAATTAGCTAATGGA
ATAACGTGATATCGTACAGCTTTGCTTCTCTTAGACTGTCATTCATTCTTTGCCCCTTTC
CCTTCCTCCAAACTACCATTTCTTGACTTCACTGGTAGATTTTAGAAAGCTCAGTAGGGA
GCCCATTTCACTAAGCAAGCTGTCATCTGCCTACATCAGGATGGGTATCCATCTGAATGC
CTGATCCCTGGAGTAGGACAGATGGGGTGAATTGTACTCTGCTGCCATTTCACTGCAGTT
CTGGCCTTTTTTTTCTTCAGGTGGCTCCTACCTCTTCCAAGCAGCATGGTGTGAATGTCA
GTGTGAATGCATCGGCCACCCCTTTCCAACAGCCAAGTGGATATGGGTCTCATGGATATA
ACACTGGTAAGCTCACCTTGACCTTGGCTGTCAGTGGTGTCTGTAGGATGTTATTAAACG
AGTTTTAGAGAGGAAGACTTGGTGCTTGAGAAAATAGAGTTGGTGAGGGTGTGCTGCTGC
TCCATGTATGATTGTTAACATTTGACTGACTTGAGTGTCTGTCTGAGCAGCAATAATAAA
GGAGCTTGATACTATCCCATGTGTCCACTACTCCTGACAAGAATGCCCTGGGGCACGTGT
TGGTTATTAGAATGTGTTGGCTGGCCTAAACTGGGTGGGAAGCAGGGCAAGGAGCCCCAA
GATTTTACTCAGATGTCAATGGAGGGAAGTGTTAAGGTGTGTGGTACTGATAGTACAAAA
GGGGATATATTTACTGAATAGGAGGGTTAAGTGGGTTCTTAGCTAGCTTGCCATAGTAGG
TTTGGCTTAAATCTCTTTGTAGCACTATGTTTCTTATGTGGCCCCTTTTTATTCCCTAGC
TAGAAGACATAAGATGTGGAGAGAAAGGAGTAAGGCATGAGTACTCAACAGAGTGAGAGT
TGGGCTGGGAGAGTTGGACCTTGAGGTTTCTTAATATGTATGGCTGGTCTCTTTGCAAAA
GTCCATTTGCACATCTGATGGCAGGGAGGGAAATGTAGGAATCCTCTGAATGGTACTGAC
CTAAAAGATACTTAGCTTCTCCCTTGCCTCCCATACCTGACACTTAACTCTCTACTTTCA
GAGGACAGGGAGTAAGAAGGAGTCTTTGAATAAAACAATTCCATCTACTTTTTTCAGTGA
CTTGTAGATGAATATGGGGAAGAGGTTGTTGCAGTTGCTAGGGGTTGGGGTTGAGGGTTG
TCCTTCAAAATTCTCAGCTCAGTTATGGTTTCATGATGGTTTGGATGGAGCTGCATGTGT
TCTGCACTCTAGTGTGGGCTCCAGGTGGGTAAATTGCCCAAGGTTTTCAATAATTGGGAA
ACTCTGAGCTGAACACAGAGAGCAGTAGATTGGGAACTAATAGCCAGGTGGAGCTTTGAA
CTGTGTTGTATGACTTAGAGTGGGTGAAGATTTAAAATAAAGACATGCTGAGACACCTCA
TTGAGATTTAATACCTAGACTCCTTGTGGGTACCCCTCTCAACTGAGCAAGGTCCACCCT
GATTGTTGGTGGGGAGGATTATAAGCTTTTTGACTTGGAGTGGTCCCATTCTGAGAATAT
TAGATTTAAATCTTAGCTGGACCAGTTCAAGAATTTTAAGAGATAGGTGATTGATAATAT
AAGAGAATGGCATACCTGATTCTGGAAATCCTAGCTTCTTACCTCCCTTAAGATTTGAGA
AACCTGGTATAACAGCCCTTTGAGAACCCCCAGTTCCCAACCCCACAGAGGGCTCTTGTC
ATCCCATTCCTCATCAACCTCTAAATTCATTTATTTTTATGTATTTGATTCCTTTTAGGA
AGAAAATATCCACCCCCTTACAAGCATTTCTGGACGGCAGAGAGCTAATTTGGCCCAAGG
CTGGGGGCTATGTTTTGTGTGTGTGTATAAATTTGCACTGAAGTCTTGTTTCAGAAACCA
GACCACTGAGGAGAGCCTGCTGAGCTGAGGCCATGGCCTGCGTGGCTTGGGGAAATGAGT
TGGTGGATACCTTCTGGGCTTTTGAACTTGCCCTTCCCCCATTTCCCTCTCCCCCATGTC
TGACCCTGTCTTACCCATTTCGAGTTCAAGCGGTGCAGCACCTCCGAAGCATCAATGCAC
ACACCTGCTGTTGCTTTTGATTTCTGGAAGGCATGTAGTTTCAACTTGTAACAAAAATAT
TTGTAGTCTTCAATAAACTGTGGTATTTCTTTAGCTAACTCTGGCGTTCTTTCCGTGCAT
GTCTTTCTGGACACTAGGAGCCAATGTTGTGCTGTGGGTGGAGGGTGGCCTTTTCAATCA
AACCCCAGCATAGTCAAAGAACTGTTAACTTTTCAGTAAGGTGATTTTATTAAGGTGGGG
GAGGGGAAACAGCTTCAGTTTCCAGCCTCTTGATTGGTTGGTGAAGAATGCTATTTGTAG
AAAATCCCTGCTTCTCCATGCTTATTATAGCTCTTCACTTTTCCATTTAGATGTTCCCCT
TGCCTCTGACATAAGCAGAGGGGAAAGGACAAAAAATTCAGAGTGTCATGTCTGGTGAAA
GGCAGAAGAGATGATGTTCAGAGCTGTTGTCAGGGAAGTATCTTCCAAGGCTTAATTCCC
ACATCTGGTTCCCCAAGGCCAAGTGGCTGATTGAGAGCTGATAAAGTCTTTAGTAACCAG
CTAGTTGATGATGCAGGCTGTGGAAATTGTGCTAGCCTGGAACATTGTTCTTAGTCCCTC
AATGGCTTTTCAGGGATTGTGGATTACTAGTCGTTTTGCACTTGTGGGTGTAGCTAAGAA
TGTGTGGGAGAGGTTTGATTAGACATCTCCTTGACTATGGAAATTCTTCTCCCCATTTAA
TCCAACTAGTACACCATCAGCCCTTTGTTTACAGGGTTGACTGTAAGATGGTGGGAATGG
TGAGACAGTGAGAACACCGTCCTTTGTTAATTGGAAACCTGGGTATTCCACTTTCTTTGT
ATTTGTTCCCAGCCCTCTGGAAGTAATTTTATCTTGTGAGTGTGACCAACTTTCCCAGGG
GCTGCCATGCTGGGAGAGATGGGTTCTTCTTTCTCCTCCCTGCTGTCTACATTGTATTAG
TATGATCATCACTGCTTGGGAGTGAGGGATAGACAGGGGGTGCTGCCTGTTGGAAAGAAA
TGAAGAGAACTCTGTAATCTGAGGAGCTTTCTAATAACTGCTGAAGGGTAGGTAGGAAAA
CTAAGACCCATCATTTTTTAGGGTCTCCAGTGCTTTTACTGAGGATATCTATTATGGCTA
CTATACAGAATATTCTCTTTTTTCCTCCATTTCCAGTCCCTTCAACCAATATCCAAATTA
AGGCTTCTGGACTCAGAAGCTACTTTTTAACTAGTCCAGCCTTTGGAAAGAAATGAGACC
TGATAGGGGCACATCGGAACTAAATTCCTCTCTACCAACCAGCTTATGAATCCAGTTAGC
CATTTCTCTTACCCTGTGTGGGATGACCAAGGGGTGTCAGCAAGCTGTATGAGACTTTGC
AGTAAAGATCGATCAATCACTGACTCTTCTGGTTTCCCTCAAAAATATTCTATTTATATC
CTGTGTATTCCACCTTATTCTAAACCCTTCCACACAAACCTTGTTAGTTTATCCTTTTCC
ATAAATGAACTCCTGTTCTTAAAGTTGTGCCTATTACCAGTGACTTGCCAGATGGGCACT
AGGGGTTTGAAAAGGGAAGGGAAAAAAATACCCCATTGGCTCCTGTATTGTCCCCTTCTT
TTACTTGAGTGCTTTTAAAGTATAAAGAGTTGATACTTTGGAGATGGGGAAATATTTTCT
CATGCTTGCTTTCTGTAGTTCTGTTCTTTTTCCTAGTTGGTGTTTGCTCCTCCCTGGAAC
TATCTGGACTTGTGATGTGGGAGGGCTTTCCAGGTTAAGATGCCACTTCTATTGGGAAGA
TTCTAAAGTGGCTGTCCAAGGTGGGCTAAACTTTTGAAGGCTGCTGTTGTCCTAGGCATT
GGGAGGATTTGAGTTCTAGAATTTGAAGGGGGATTGCTGTTGAATTGTGGGTGAATGGAA
GATTTCTCATTTGTGATTTGGTCACTTTAGTAGAGAGTTTCTAAAGAATTCTTCCATTAG
AGTGTTCCTAACAGCAGAGGAGAAGGATCCAAGGACATAGACTGAAATGCAGTTTTTCTG
AAGTTTCATTTTTATCTCACTTCATGAGAAGTATTATCTTTAAAAAGCATGCTTGAAATT
CCTAGTTAAATTTGAGTTGCTTTTCCTCAAATCTTTGCATAAAATTTCTCTAGTAAGATG
CTGGATTATTTTACCTGATGGCTTTTTCCTATCTCCTTGACCCATTGCCCCATACTTCAG
GAGGTACGGTATGTGTATTTCAGTTGAAGTACAAGTTAAAATGAAGAATTGTACTACTCT
GGTTTCCTTAAAGTTGTAGTGATAGTAGGGTGTTTTTCAACAGGAAACATGCAAGTTGTT
GGAGTATGAATTAGAGCTTATATCTCATGGAGAAGCTGAACTTGTAAACTAGAATGACAT
TTGGATTTTGTGTTCCACCTAGGCTGTAGGAGGTAGCCTACCCCCATCTACCTTCTTTAC
TCCCTCTCCTCCCCATGCTTAGGCTTAAATTACATAAATGGAAATTCATCTTTGTGCCAG
TTCTTTAAATTCTGAGTATATAGCCTAGAAGCTCCAAGACTCTGGAGAAGCTGAACTAAG
TGAGCTGAGGCTCTGAGAATTAAAGTGCTCTTGAGAGTTGAATTGGACTGGTCCTCTAGT
ACTTACCTTATGCTGTGGAGGGATGGATTTTGAGCCGCGAAGTGTCTCTTCATAAACAGA
AAAGAGCCAGGCTACTGTCTTCAGGAGCAGGACTGAGTAGAGTTTGGGTGGATTGATTTG
AAATAGACATGAAAAGTTTAATACATTCTGCTGGGCTTTAGCACAAAGGATTTTGAAAAC
TGTATGCTTGTGAGGTTTGGCTAAATTGTCGTCCTCCCCCCCCCCCCCCCCCCAAAAAGA
AAACAAACCCTCAGCTTACTCTCTCACACATACACTCAGTACACACCTGGAAAGGGCAAG
CAAACCATTAGGGAGCTTTTGTGTCATGAGCTCTTATCCCTCAGGACTGACTTGAAGCTG
GAAAAACAGACCAAAATGCCCTTGCAGTGCTATAGCTAGAAAGGTGGCAGACATCACCTC
CTCCCAGGGATAGGGGCCAGGCAGCTAGCTGAGCTAATCCTCCTGTCTGTTTCCTCCCCC
CCCAGGTGTATCAGTCACCTCCAGTAACACGGGCGTGCCAGATATCTCGGGTTCTGTGTA
CTCCAAAACCCAGGTAGGTGCCTGGCTCTGGATAGAAGTGGAAAAAGACAGATGGACATA
GAGGAGGTGGAGTTGCAATGATAGAAGTACAGTGAACAAGAACAACCCTAAGAGAGGTGT
CAGGAAACCCATCCTACTAGAAAATGGATGGTCTCAGACTTCAGTTTCTCAAAGAAGTTT
AAATTTAGCCCCCTGGAAAAAAAAAAAAAAGAGAAATGTTACAGGAAGGTGAGGTGTGGA
AAATTGTTATAATAGGTTGTGTGAATTATTATGCAACTGTCCTGGCCCTTTACTTACCCA
CTCCCAACCTTTTGATAACTTTCCAAGAGAAGGAGTATGGAATGAAGGGAGACTAGTTCA
TTCCATTCTTTGTAAGTATATCTAGGGGATAACAGAGTGGGAAAGGAGACAACCCAGTCA
TTAAAGTGAGGCATTTGAATCATCCACAGATTTGTATTGTGTTGATCCCCCCCCCCCACC
ATAAATAAAAGTTTGATATAAAGGATTAGGAGTTATGGTGGAGTGTTTCAGGGCCAAGAT
CTTTAACACTCAAGATACCTCAGTGTTTATTCATTTCTTTTGAAATATCCAAGGAGTTCT
AATTTCTATCCAACTCTAGGGGAGGGGGTGCTAAGAGTAGCCAGCAGTTTTCACAATGTT
CCTATATGACATTAGATTTTACGAAGTGCTTTCATACCCATTGTCTCATTTGATCCTTAC
AACTGAGAGGTCAGTAGCATCCCTGTTTGATGTATGAGAAAAGTGAGGCTGAGAGACAGT
AATTTTCTCAGATGACACAGCTATTAAAGGGCAGAGCTGAGACTGAGACTGGAATATCTG
ACTTTAGGTGCAGTGTTCCTTCCATGACACCATGCTGCTTTCTGAGGGTGGGCGAGCTTG
GGCTCAGAAATTCCAAAGATTAGTTTGCTGATCCCTTTTACTTTCTCTCCTCACGTCCTT
CTGGCTAGCAGTCCTTTGAGAAACAAGGTTTTCATTCCGGTACTCCTGCTGCCTCCTTCA
ACTTGCCTTCAGCCCTAGGAAGTGGGGGGCCCATCAATCCGGCCACAGCTGCTGCCTATC
CACCTGCCCCCTTTATGCACATTCTGACCCCCCATCAGCAGCCGCACTCCCAGATCCTTC
ACCATCATCTGCAGCAGGACAGCCAGGTAATAGCCCTTCCCCCTCTCTCCTTTCCCTTCC
TCTTCCTTCCTATCCCTTAAAACTGCCTCCCCTTTCCTTTTCTTACCCTTCCTCACCACC
ACCTTCACCCAGTCCTCCCCAGCGCCAGCCATGGGCACACAGCACATACCGACACAAGCG
CACATAACACAAGTGGCCAGCAAAGGAGATGTCAGAGAAGGGGCCAGATTGAAACCTTTT
TTGCCCAATTCCTTTTGTGCCTTTCTCCTCCACCTCCTCCCGTAGCACAGTTGTCCTCAT
CCCATCAGACCTGGGTCACACCTCCCCTCTTACCTCTCCCAGCCTTTCCCCTTCCCTGAC
ATTATAGCTTTCCCTTCTAATGGTGGAGTTCTATTGTCAAAGTTTGTCCCTTTATTTTCC
ATATATCCTGGTTCTGCCTCAGCTACCATATTTGCAGATGATTCTCTGTTGCCAGCGCCA
GCAGGAGGAGCAGGTAATGAAACTGAATGATGATATGCTTGAACCCACTCCTTTTCAGTC
CCCATTTCACCTCCACAGCCTTAGGGAACTTGAAGAGAAAAGACTGCACGGTCACAAGTC
GGGATACACAAACACAACACCTTGCTCAGCTCTCTGGCCTCCCATTCCTCTTTTGTCCTC
CCCTCCTCAATGCCCTCTTTTTCTTTCTACCCTTCCCTAACTCTGGAAACATTTGGTTAC
CGGAATGGAAAGGATTCTTGGGGCAGCATCTGGAGCCTGGCACCTCAGACTGTCTCTCCT
ATCTTGCCTGAAATGGGCTCGCAGATGTGATGTGTGGTATGGGTGGTACCATGGGGTGGT
ACAAGTGACCTCTCCTCCATCATAGGTGGCTGGGGAGCTGGAATAAGGGCTTCCTTGCTC
TCAAAGACAGCTTTCCAAATTGAGGCATTCATGAGAATCAATGAAAATGAAATCACCTTG
TGGTCACTCATCTCTAAGAGGCCAAAATTCTCTCTAGAGAGTAGCCTTTTCTCAGAGTAG
GGGAGGGTGGAGGTGGGGGGAGTGGAATTGAAAATGTGTGGAACTGATTCACTATCTTGT
CTAAAGATATCTTGCCCTCTTTTCATCTTTCCCCTATGTAAAGTTTGAAAGTGCTTTCTT
ATCAGTGGTGCTCTAGCAGCTATATAAACCAAGTTTTCTATGGTTGAGAAGCTTCAGAGC
AGTTTCTAAGGAAGGAGAATGGGAGAGCAAGATAATTTCCACATTTCCACCTAAGATATA
ACAAATTTGTCCTAACTACACACCTTTTTCCTCCCCATCATCCTCCCATTCCCCTGCAGA
CGGGCAGCGGGCAACGTAGCCAGACCAGCTCCATCCCGCAGAAGCCCCAGACCAACAAGT
CTGCCTACAACAGCTACAGCTGGGGGGCCAACTGAGGCCCTGACCCTCCTCTTCTCCCGG
TCCCATCTTCTGAGAGGGCTTCTCAGCCTGGCAACTATGGAAACAGCATCAAAGAGAGAA
AGGAATGTGGGGGGGTTCCACTGCCCCCCACCCCCAGCGGCCCACCCCATGTCTCAGCTT
CATGTCTGTCCCACTCCCATACCATCCCCACTCTGTTGTATGTATTATAGGATTTGTATT
TTCTCTTTTTCTTTTTTTGTCCTTTCCTCTCCTCCTTCCCCTTGCATTCAAGATTATGAA
ACTTTTCTGTGGGCCCTGCCCTACCTTGTCCTCCTGTTCACCCTGGTGGTGTATGGGTGA
GGTGGGGAGGGGGGACCCCCAAATATATATCAGCCCAACAGCCCTAAGTCTCCTCCTTTA
TTATTAGGAAACAAAACAACAACAAAAAATGGCGTCATGAATATGAACAGCGTTGTCAGA
TGAATTAGTTGAAGTGTTTTTTTTTTTTTGTACTGTGTCCTCAAATTTAATGGATTAATG
TGTCTTGTATATATATAAAAAAAAAAAAACCTCTACCTTCAGCCTCTGCCCATTCTTACT
CCATCTAGGATATCCTCAGTCTCGTCGATGACCGGCTCGGTGAATAAGTATTACTGTACC
ACACTGGGCCTCCTCTAGCAGGCCCTGAAGACAGTGGAATAAAATGAAATCTTCGCCCTT
TAAGAACTCCTCTGACCCTAATGTACTAGTATCTTGCCCTTGAGGGGATTTCCTTCCCTT
CCTCCTCAGAATTTCACAGCCTGGTGCCTGGAAAGAACCACCACAAATCTTCATTTCCTC
CAGAAACCTACATCTACAGCAGATTTTAGGCAGTGAAGGGAGTGAAATAGCGGATATTGG
ATGGAAAGTGAGAGGATGAAGAAGGAGCTGAAAGAAATGGCTTTGTAGTATCAAAGTATA
ATTTAGATCTGTGGAGGCAAATGAACTGGAAAGAAGTGAGGGCAACATGCATTGTTGGCT
AGCAAAACTGAAGCTTGGGACTCATTTCTCCTAGGAGTAGACTACAGTAGTTCCTGCTTC
TTGAGTGCTTTCATTTCGCATAGCTATACCCAGCCTCTTGAAGAATCTAGAGCAAGGCAG
GGGTTGGGATGCGGGTGGCGGGTAAGGGGTGCGGGGGGGCCGCTTTGAAAGTCAATGAGA
GGAAAAGGGGGGTAGCTCCAAATTCTTTCTTCCTTCTCAACACCCTTCCCTAGATTTCCC
TTGCTCTCTTACAAAGTCGTTATCCTGCTGGTTGCAGAGCCTGCCTAGAAGTGAAAGAAT
CCGTCATGGTTGGGACAAACTCCTTAGTTGCTGGAGAGGAAGTTAAGTCCGTGCGTCCCC
GTGTCTTTATCTCCACTCAACTCTGGGGAATTCAATACTAGAAGGAGCTTGATAAAACAT
TTTGTCCATCCTTCTAATGTTAGATCAGTCAAGAAACAAGCAGGACCGAGGAAGGGGCGA
GGTGACTTTCAGAGGGCAGTACTGGTAGTCCACGTCTGAACCAGCGGTGACGGAGTGTCT
CGTACTGGTTCGCTTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1134, 2403..2480, 3045..3155, 6931..7099, 7511..7606, 8032..8077, 8859..8971, 10980..11039, 12908..12960, 14558..14649, 16800..16971, 19849..20047, 20875..21152, 21309..21481, 22498..22687, 23404..23458, 23868..24042, 24377..24449, 25521..25716, 25809..25897, 26866..26919, 27549..27630, 28373..28590, 29060..29165, 34025..34092, 35048..35245, 36539..37175
1045..1134, 2403..2480, 3045..3155, 6931..7099, 7511..7606, 8032..8077, 8859..8971, 10980..11039, 12908..12960, 14558..14649, 16800..16971, 19849..20047, 20875..21152, 21309..21481, 22498..22687, 23404..23458, 23868..24042, 24377..24449, 25521..25716, 25809..25897, 26866..26919, 27549..27630, 28373..28590, 29060..29165, 34025..34092, 35048..35245, 36539..36631
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved