Equus_caballus Locus KIAA0907
snOPY snoRNA Orthological Gene Database
Equus_caballus KIAA0907
Equus_caballus
KIAA0907
5
SNORA42
12000..12134
17411
TGAAAGGAAAACACTATAAATTCGGTTTTTAATGAATTTGTATTCTATTAATCATATCA
GAATGTAAACTTATTTGAAAAATAGCATTGTGTTTTATTTATTCGATCTAAATACTCCTT
GCAGCTACCAGAAACCCCATATGTTGGAAATCGCTGGCTTTCACAAGCACCTCAAACACA
CCTCAGCATTCAGGGCGAAGACTTTTCGTGATCTGGCCCCTACACTCTAGCCAGTCCAAC
TCGAAGTACGTAGATCCCAAAGCAGGATGTTTCATAACTTACTCTGGATCACCACTTCTC
CAGCCCTCATCCAGCCTGTTCAGCTTCCGTTTCTTTGAAATCCCTGCGTCTAAAGCCCCA
CCAAGATGAACATTTCATCTTCTTCACCTTTGCTTATTATACAACCCTATTATATGTATT
TGCCCGCGTGCCTACCCCGCCACAGTGTGAGTGCCAGAAAGGCAGGACCCGCGGCTTACT
TATCTTTACATCCTTATATGCCCTGCTCTTCAAACACTGCTTGGCGCAGAGGAATGAAAA
AAAAAGAGAAACTCTTCAAATGACCTTTGGGACGAATCATTTCCCTTTTCCTAAATAGGT
AACTGTAACCTGAAGTGGGCAAAAGTCGCAGAAAAGCTCTCTCTCCGATCAGAGGCTGGG
ACTCCAAAGGAACGTAGCTGAATTTGGGGAAAAACCTGCTTAACTCCCTGACTCATGCGT
ATTGTCTTCTAGGCTACCGACTTGCCCATAACAAAAATGGATTCTCCTCGCGCCGTTCCG
CCTTGATATGAGACTTAGCAGCCATCTTCCTCTAGGGCAAGGCGCAAGCAGGAAGATCAC
ACCCTGCCTGTCTCCGAGAAAGCCAGACGCCTTGAAATCACCGAGAGTCCAATCGGAATA
GACGTTCTCACCGGAAGCGCCCTGCCTCACGACCGGAAGAGGCTGTGCGTAAGGGCGTTG
GGGGCGGAAGTGACGGTAAGGTGGTAGTGGGGTAGTTGGCGGGTGGTTGAGCAGAGCCGG
TCGCCATGTCCGCGGGGAGCGCGACACATCCTGGAGCCGGCGGGTAAAGCTTCTCGGCGA
GGGCCTCGCAGCGAGCATGGGGCGCGGGGGGGCGGAGGGACCATGGGAAGATGCGCATGG
GTGGCGGGGCGCTTCAGTGGCGAGTGTACATACTGGAAGGCCGGAGTTTTGGGGAGAAGG
ATGGTGACAGGCCTGGGGCCCTGAAAACGGCCGACGGGGATCAGAGGGCGGAGGAAAGCA
GGGACTTTCGGAAGGACGAGGTCATGAGGGACGAGTGGGATCTTCTGATAGAGATGGTGG
AGTAGAAAGGAAGTAGATTCTGGAAAAGGGTTGAAAGAAGGGAACATTTGGGGAAATAGT
GCAGGAATTATCTATTTAAGGAGATGGGGTGCTAAGGTGTATTAAGGGAAAATAATATAA
ATAAAAGCTTTGGGTCCCAATATTTTCCTTTTACTTCCTGTAGGCGCCGCAGCAAATGGG
ACCAACCAGCTCCAGCCCCCCTTCTCTTCCTCCCACCGGCGGCCCCAGGTGGGGAGGTTA
CCAGCAGTGGGGGAAGCCCTGGGGGCTCCACAGCTGCTCCCTCCGGAGCCTTGGATGCTG
CGGCTGCTGTGGCTGCCAAGATCAATGCCATGCTCATGGCCAAAGGAAAGCTGAAACCAA
CTCAGAATGCTGCTGAGAAGGTATTTGGAGTTAAAGGGACTCTGCTAATTGCTCATTTAA
TTCAGGTTATTTTGTAATTCTGTAATCTGACAATCGTTGTGTTAATGAAGGAGAAAACGG
GGGATACAGTAACTTCAACATCACTTAGTTTTGGAATATATCAGATGATAGTTTCCCGGT
TGTTTTTAGGAGGCAATTTTGATTGGACTGATTACATTTCTGGACCAAATGGCTCATTTT
GTTTCTTAGTTCAGCTCAGGTTCTATCTATATAATCATTGAAAGCAATGGTTTAATAATC
GTTTTTGATACATGACTTCCCTAAAGTCAAAAGAGAAGTTCAGGTAAAGCAAGCGAGCTT
TAAAACATGGACTCTAATTAGAATCTATAGATTCAGATTTTTAGTGACTGCCTAACTAAA
GTACAATTAAACATGAACTAAAGTGAATAATTTATATATGGGTTGTTTTGCTGTTTTCAC
ATTATTTGAGGAAATTATTTGGTCATTTCATAGAATGCAAGAATCTTTCTACAGGATAAT
GAGTACAGTGGCTGTTTTTACTGCTAGAATGCATGCTTTGCGCTTAAAATCCTTACAGCA
GTTCCGTGGAATGGATTATTGTCAGTAGTTTACAGATGAGGAAAATTAGGGTCGTGAATG
TAAAGTAACTTGTCCAAGGTCTATAAATGGTAGGCACAGATCTGACTTCAGAGTCAGCTC
AGACACTTGGGTGTTCAGCTTTTCCTTGAAAGCCTGTAGATTCAGAGGATTCCTTGTGTT
CCAAGGCAGCCCATTCCATTGTAATTATTATTTGAAAAAAATTCTTTTGGCTTAAGTTAA
AGTTTGCCTTCCATGGTACCTATGAAGTGACAAGTTCCTGTGTTTGAAAATGCAGTTCAT
GTGAGATGATGGATATGTTCAATTCACTATGTGTACGTGTATCAAAACATCAAGTTATAC
ACCTTAAATATGTATAATTTTTGTTGATTATACCTCATTAAAGCTGAAAAAAAGAAAATG
AAGTTCTTTACAGGCCTTCCAGTTCATTAGTAGATAACATCAGCAGAATGTTTATCAGTA
GGCCATAACCTGTCTGGATGCTTAAATATTCAAGTTCTGCAGAATTAGTGAGAACTTTTA
GTGAATTGGAAGTTCATTGTTCATAGTAGTTTTGTAGTTTGCAAAGATGGTGTGAGTCAC
GTGTCTGTTTCTAAGGTCTACAAGGAAACATTAAAAGCACACTGATGGAGATGGAATGCT
CCTTAAATATTAAAACCCTTCCTACTGGTGTTAATCACTTAGACTTACTCTTTTCCTCTA
AAAGGTAGTCTAAAATAGTAAACTCAGCAGGAGGCAGCATGGTACATAAACGCTGGGTTT
AGAATCAGAATACCTAGGTTTGAAACCCAGAATCCCAGGTATTGTTTGTGTGGCTTTGAC
ATCTTTAGTCTCTGTCCTCATCTGTAATGGAATTGATAGTAATAATTACCTGTGCAGTCC
GGTACAGTGGATACTAGCCACATGTGGCTGTTTGAATTAAAAATAAAATTTAAAATTTAG
TTTCTCAGTCACATTAGCCACATTTCAAGTGCTTAGTGGACATGTGGCTAGTGGCACACA
TGTTGGGCTGCCAGATAGAGAATGCTTATGTCATCAAAGAAAGTTTTGTAGGACAACACT
AATATATGCCTTTAAAGGTGACCATAAGGATTCAGTGTGGGGCTGGCCCAGTGGTGCAGC
AGTTAAGTTTGTGCACTCCGCTTCGCTGGCCCAGGGTTCACTGGTTCAGATGCCCGGTGT
GGACCTAGCCACCACCTATCAAGCCATGCTGTGGCAGGCATCCCACATATAAAGTGGAGG
AAGGTGGGCACGGATGTTAGCTCAGGGCCAGTCTTCCTCAGCAAAAAGAGGAGGCTTGGC
AGCAGATGTTAGCTCAGGGCTGATCTTCCTCAGAAAAGAAAGGATTCAGTGAGATAAGAT
GTGTAAATGCATACTGAAAAGGGCTAAGCAGAAGTAAAGAGATGATGTCAAGTCTATTTA
GTTTGCCTCCTCATTTTAAAAATGCACCTAATGCACAAAGAATCTGTGTTTTACCTTCCT
TGAGCAGATTTGCTAGACATTGGTCCAGGGTAGCTAAGGGTGGAAGAAGGCCATTTTGAG
ATTAAGATTTTTTTCAGGTAGCACTCAAATCCAGCTATCTGGAATTGCCTGTAGTTTAAG
TTGAGAAAAACTAGATCAGATTTTGGGATCTTACCTGGCTGTCTGTCTATTCTGTTTGTT
CTTCCTTAATAAAGGGAGTAATAAGATGTTAATTAGATACAATTTAAGGGTTTTTGAGAT
CGTTGCAAGGATGGAATTAGTTGAATTTGATGTGTTGTGACGATAGTGTTGACACAAAGG
CAACTTTCTATTGCCTGAATGAGATGTATGACTTCTTGGACTCTGCACTGAGTGTTAGCT
CTACCCTGTATTTTACTACACATACAGCTAGCTGATTGAGTTGTAAAGGGTCATAACTCG
ACCCTTTAGCTTTCCCTTTGGAGATTGCAGGTTCTGGTCCATAGAGTTTCTGTAATTATA
TGATCATAAAAATGCGTACACAGCCACGGTTATAGAGAAATCTAATGATGGCCTTCAAGT
AAGTTGACTACCGGGTGTCATTTTAGTGAGGTTTTCTTTGCTTGTTATCTCACTTACGAA
GAATGACCAAGGAGTATTTCCAAGTATGTTTGCAGACAGGTAAAAGGAAAGGTAGGGAGG
CGGTGGTACATGGGAAGGGGCGTTTGACAACAATTAGACAAAAAAAAGATATTTCGTCTT
CTAAACTTTTTAATCTGATTTCTCTTTTTGTAGCTTCAGGCCCCTGGCAAAGGCCTAACT
AGCAATAAAAGCAAGGATGACCTGGTGGTCGCTGAAGTAGAGATCAATGATGTGCCTCTC
ACGTGTAGGAACTTGCTGACTCGAGGACAGACCCAAGATGAGGTGTGAAGATGTTGGGCT
TCTTTGGGGAAGGTGGTGGGTGGGTGTAGTTTCGGGAGGACAAGACCTCTAAACAGACAA
ACAAGAGTCAGATATTTATTAGTGGGTTTGGGTGGGTCATAGTCTCCAAAGTCAGGATTG
GGTTTAATTTAATTGCAGAGGAACATCTTAGTGAAGGTGAAGAGACCTGGGTTGGTTTGA
GTAGGAAGCAATGGAACTGAAATTTCAGATATGGGCGAGAACTCACTCCTGCTTTATTGG
TGGAGTGAATGAATAGGGAAAATCTATCCTGTTACCTGTCATTGAAATCAGTCAATTGCC
ACATCATCGTTTTAATAAGATGTTTGCTTTTTAGATCAGCCGACTTAGTGGGGCTGCAGT
GTCAACTCGAGGGAGGTTCATGACAACTGAGGAGAAGGCCAAAGTAGGACCAGGGTATGT
ATGCATGTCCTCTGCCTTGAAGAAGGATTGGACGTATGTTTCGTATTTTTCACTCTTAGG
GAATATGTGTAAATGTTTGGTTAGTAGCTTCATATATATATGTGTGTGTGTGTATATATG
CTTTATTGCAGAATTTGGGACATCTCCAACAGATGTAAGAAGTGTTGGCAGCTATTTATC
CTATTGTTCTTTGGTTTTTTATTTCACAATTAATGGTTTTATTAGAGGAAACAGATTACA
TGAAGTGTAAAAGAAGATAATAATTAACTTTTTTTTTTGAGGAAGATTAGCCCTGAGCTA
ATATCTGCCACTAATCCTCTTCTTTTTCTGAGGAAGACTGGCCCTGAGCCAACATCCGTG
GCCATCTTTCTCTACTTTTTACATGTGGGATGCCTGCCACAGCTTGGCTCAACAAGCAGT
GTGTAGGTCCACACCCGGGATCTGAACCGGTGAACACCAGGCTGCCGAAGCAGAACACAC
GAACTTAACTGCTGTGCCACCGGGCCTGCCCCAAATGTTAACATTTAATGAGTATACTTC
TGAACTCTGAATATTTAATGAGTATATTTCTGAATATCTGGAAATATTTCTTTCAAGAAA
TGGGCTCATGTTTTGTTGTCATCTCCCTGTAGAAAAATTTTTTTAATCAAGCTCCTTAAT
GCCTCTATGATGGTTATAGGTTATCCATGTAAAGATTTCATCTCAATTTAGTTTCATCGC
TTCCATTATTTAGTTTTTGAGGAAAGGTACTTGAGGTAATGCAACGTTTTTAACATTGGC
TTAAACCGAATATAATTAGGAGCCAAAATTTGCTCCCCAAACCAAGAGTGTATTTCAACT
TTGTGTATGTGCTAGTTGCTGTTTTGAACATTTTTGTCTTTAAAGAGTTATTTTCTACGT
ACAGCTTTTTATTTACTGTATGGTTATTGATCACTTTCTCTATTATTATAATCAAAATCT
GAATCTAAGCGGGGCTGGCCCCATGGCTGAGTGGTTAAGTTCGCGCGCTCCGCTGCAGGC
GGCCCAGTGTTTTGTTGGTTCGGATCCTGGGCGCAGACATGGCACTGCTCATCAAACCAC
GCTGAGGCAGCGTCCCACATACCACAACTAGAAGAACCCCCAACGAGAAATATACAACTT
TGTACTGGGGGGCTTTGGGGAGAAAAAGGAAAAAATAAAATCTTTAAAAAAAAAAAAATC
TGAATCTAAGCTACTTTACATTTAGAATCTAAAGAGTCTTCTCAGTTGGTGTAGGCCGTT
AAAGAAATTTATCTATATGCCACCATCGCTTTTTTTTTTTTTTTGAGGAAGATTAGTCCT
GAGCTAACTACTGCCAGTCTTCCTGTATTTTATACGTGGGATGCCTACCACAGCGTGGCT
TTTTGCCAAGCAGTGCCGTGTCCGCACCCAGGATCCAAACCGGTGAACCCTGGGCCGCCA
AGAAGCGGAATATGCACGCTTAACTGCTGCGCCACCGGGCCAGCCCCACCAGCATCACTC
TGGACCCATTAATTTGGGCAGCCAAGAGCCGATTTACCCATAACCTATTAGATAACTAAC
AAAAGGGAATTCTGTTCTCAAACACTGGTTTTCTCCTCTGACTGGATATTAATGTTCATG
AGCCCATAAGAACAGATTTGATCCATAAGTGAGCCAGTTAACTTTAGGCTCACATGAATG
GATAACCAGAAAATTTTATTCATTTACCGGCTGTTAAACCATGTTCTTAGAAATTAACTA
GCAATAGCTGTTATTACGTATATAGTCCCTTTTACTTGTTTGGAAACTTTAAACATTGCA
AATTACATTTGAAGACCCATTTGGCTCTTTTGGTTAGGACCAGTTTGAGATCATCTTTAT
ATTTCTCTTTATAGGGATCGTCCATTATATCTTCACGTTCAGGGCCAGACACGGGAGTTA
GTGGACAGTAAGTAATGTTTTTGGCTCACATATCGCTTTTTGTGAAGGGCAAAGTAGAGA
CCTGTATGTAATAAATTAGCAGGCTGTTCCTGAATGTTTTCCTCTTATTTATGAACTACT
CATGGATATGCATGGGGAGCGAAATACTTGGGTGATCTATAAAATGAGTTAATGCTTGAG
CGTTGGCTTGCATTTATCACTGGGTACTAATCAGTTCATTCAATTCTTTGGTATAGTATC
TTCCTATCTGTGTTTTTCCGTAGGAGCTGTAAACCGAATCAAAGAAATCATCACCAATGG
GGTGGTCAAGGCTGCCACAGGGACGAGTCCAACTTTTAATGGGGCAACAGTCACTGTCTA
TCACCAGCCAGCGCCTATTGCACAGCTGTCTCCAGCTGTTAGCCAGAAGCCTCCCTTCCA
GTCAGGGGTATGTTTTGTGGAGAGATTATTAAGTGCTTTATCATTTCTGTAAAAATGATG
TGTGCCAAGTAATACAGAAAGTATGAAGAAAATAATAAAATCCTGAAATTCCAATCTGAA
AGTTACCCGCTGTTGCTATCTTGTTAAGGGACCATTTAGGTTTCCAAGATGTAATGAACA
GCTGAGCGCACATCTCTTTATAGTGATATCCTCTAGGAAGAGGATTGATAGATCAAAGAG
TATGCACATTGTACATTTTGAAGTTAGTGGTCTGAATTTATACTTGCAAACTTGATGGCA
GCTGGAGGACTAAGAAGGCTGAGTCTGATGAAGCAAGACTCGGCTGATACAATCCTCCTA
GAAAAAGGGGTTGGAGAGAGCAGCCCTTATTGGAGAGTATCACAGGGCTGACTGTACTAC
CCAACACTCCACTCCAGTTTTACAGGAGACTGTCTTTGCCATGATTTCTTATTAACATAA
ATTAGTCAAGGGAAGTGGGTATGCTTACTCATTGTTTGATCTTGGGTTTTTCTCTCTTAA
ATAGATTTTGCTGAACAGAGTAAGGTGTTAGTGTTGTAGGTAGGTACATGGAATATGTAG
TTTTTGCTTAAATTAAGCTTCTTAGTAGTGTTTATGTTTATGGACTCTTGCTAGAAATTA
TAGGGGTCCTTATTCTGGAAGCTATTAAAAGTATCTGGAAGATTAAAGTGTTTTGCTTAA
TATCAAGATTAGGATTTAATTACGTATTCTCTGTTTAATCTGGGCTATTGTGTTCTTCTA
CAGATGCATTATGTTCAAGATAAATTGTTCGTGGGTCTAGAACATGCTGTGCCCACTTTT
AATGTGAAGGAGAAAGTGGAAGGTCCAGGCTGCTCCTATTTGCAGCACATTCAGATTGAA
ACAGGTGCCAAAGTCTTCCTACGAGGCAAAGGTTCAGGCTGCATTGAACCAGCATCTGGC
CGAGAAGCTTTTGAACCTATGTATATTTACATCAGGTATGAATGGATGGGGCTGAAGACG
TTTGAATCCTTGTTCAACTTACCAGTACAGGCAGGAATGATTCAGGAGTAAGAGAAAATG
GGCTTAATCAGTAGTAACATAAGGAACTAAGGTAAACACTTAATCGCTTTATGATTAGTT
AATAAAAATTGTTGAATTAGGGCTGGCCCGGTAGCGCAGTGGTTAACTTCGCACATTCCA
CTTTGGCAGCCTGGGGTTTGCCGGTTCGGATCCCAGGTGCAGACATGGCACCGCTTGGCA
AGCTATGCTGTGGTAGGCGTCCCACATATAAAGTAGAGGAAGATGGGCACGGATGTTAGC
TCAGGGCCAGTCTTCCTCAGCCAAAAGTGGAGGATTGGGAGCAGGTGTTAGCTCAGGGCT
AATCTTCCTCAAAAAGAAAAAAAAAGCTATTTAAAAATTGTTGAAGTAGAAGGTGGAATT
CTCTTTTTAGTATTCAAGTCCCTGGGTTTTACGCAAGTGTGTGATCCTAAAATGAGCTGT
GATGAGCCTAAAATAATTTTCGTTTAAACCTATGACAATATTTTAAATATCTTTTCTTTA
TATCAAGAAGTATCACTATTCAGAAAAAGACCAAGAAAATATTTGTGGTGATGATACCAG
TTATATCTTAAAGGACTTCTCTGACATTTTGTGTTCCTATTTTGTGATTTTCAGAAGCTT
AGATTTGTGCTGCATTGACTATATTCAATTTATAAAACTGCATGCAAAATGAAAGTAGAA
TTCTTTAGCTTTTATTTTTCTCCTCTTTGAATTTTTGTTTCTTTTTTCTTTGCAGTCATC
CCAAACCAGAAGGTCTGGCTGCTGCCAAGAAGCTCTGTGAGAATCTCTTGCAAACAGTGA
GTTATATTTGTCTGTCTGATACTCATTCAGAAGAGCTGCTGCCATTTTGGATTGTGTCTT
AGCTATTTTTCCCACCTATATTAGTTTCCTAGGCTGCCATACAAATTTACTGCTACTTGG
GTGACTTACACAACAAAAATTTACTTTCTCACAGTTTGGGGAGCAAGAAGTCCGAAATCA
AGGTGTGGGCCGGGTTGATTTCTTCTGGAGGCTGTGAGGGAACAGCCATCCCATGCCTGT
GTCCTAGCTTCTTGTGATTGCCTGCAGTCCTTGCCTTGCCTTGTATCAACATGACTTCAA
TCTCTGCTGTCATCTTCATCTGGCCTTCCCTGTATTTCTGTGTCTGTCTCCTTTTCTAAG
GGTACCAGTTGTTGGATTTAGGGGCCACCCTAATCCAGTATGACCTCATCTTAACTGCTT
ACATCTGCAAAGACCTTGTTTCCAAAATATATAAGGTCGCATTCTGAGGTTCTGGGAAGA
CGTGAGTTTTGAGGGGGACACTATTCAAACCACTACACCATTACAGCAACTACCATTCTC
TATAAGGAAGTCAAACTCCCCTAGCCAGAGTCACAGTTGGTATGCGTTTCTTCAGGCGCT
GTTTCAATATGCAATTTTGAAATCTATATTACATTAGTATCATAAAATCTTAATGTTTTC
AGCTGTTTAAATATTACTTTTAATCCTGGTCAAGTCATTTATGATGGGCATTTCAAATTC
TTTTTAATATTAGCTTTAGCTAAAGTAAAGCTAGAGCTGTAATAGTTTAAACCAGTTAGC
ATTGCCTTTGGGATACTTGCTTATTTGATTATTCATTCTTTTCATTCTGTAATCAAATAA
CCAAAAATTAAATCATAGGGTTGTTTATATATCACCTAAAGGATATCAGGTTTGGGAGTT
GAATATGTTCAACCTTGTGTTATTTGGTATTTAATGGTGCCCTTTTGGGAAGCTGTTGTT
TACTTTGCTTTTGTGAGATAACCTAATTTACCATCTCTTATACCAGATAACTTCCCTGAC
CATTCCCCATCTGTTTCTTTGTTGCTACTTGAAGTTATGGACTTAGTAAGATGCTAATAA
TGAAGAACTGGAGAGGGGCCGTGCTAAACCGTTATTAAACCATGAGCTCCTTGAGAACAA
GTCACCCAGCAGATAAAAGAATGAATGAATTCTCAACAGTTACACTGACAACTTAGAAAT
TGCATAACTGCTTAGTTTCTGTGGCACTCTGAATGATTTGTACCCCAGAATTGGATCTAG
TTTGGAGGATTTAGGATGCTCCTGATGTCCATGCTCCTGATTCCCGAAACCTGGCTTAAT
TTATAGGTGTGCCATATTAAAATTTAGATCAAACAAGTCTGAATTTGATTGAAACATCGA
TGGAAATATTTCAATTCCTAATTGCTTTGGTCCTGAATTGTAGAATTGGATCTTTATAAA
TACTCAGTGCATTGGGACTGTCTCATATTAATTTTGTCCCTTCTCTTTCAGGTTCATGGT
GAATACTCTAGATTTGTGAATCAGATTAATACTGCTGTACCTTTACCAGGTGGGTGTGTC
TTGAAGTGTTTAAAAAATGTTTTGGTAGTGAGATTTATGCATAAAATATACTTGAGGCTA
GCCTAACTGTGCCAGGGCACTAATAATGTTCCCTTCAACTTAGGGTAATTCATGCCTCAG
TGTTATTCTTCCCTAGAGATTAAGTTTAATATTCAGCTAAAATGTCTCATTCTGCTGCAG
CTGATTAAACACTTTTTTTCTTCCCCCTCAGGCTATACACAACCCTCTGCTATAAGTAGT
GTCCCTCCTCAACCACCATATTATCCATCCAATGGCTATCAGTCTGGTTACCCTGTTGTT
CCCCCTCCTCAGCAGCCAGTTCAACCTCCTTATGGAGTACCAAGCATAGTGCCACCAGCT
GTTTCATTGGCACCTGGAGTCTTGCCAGCATTACCTACTGGAGTCCCCCCCGTGCCAACA
CAATACCCGATAACACAAGTGCAGCCTCCTGCTAGCACTGGACAGGTAGGATGCAAGGAT
ATGAAACATGATGCCTTTGAATTAGGAAAAACTGGGGCAGGCAAGGGGTGGGAATGTGGT
GGTGGTATTCAGAAATGATATGTAATGTGAGGTATTTTATATTGTCTTCCTGTGTTCCCA
CCACCAAACCACCTGAATTCCTTGAGATAGGGTGTACATGTGCGTATTCATCCTGAAGTT
TACGGTTGGTTTCACAAGTCTTGACACCGAATAGCAGCAGGAGTTGGTAAGCTTTCTATA
AAGGGCTAGATGGTAAATATTTTAGGCTTTGTGGGCTGTACAGTCTGCTATAACTACTGC
ACTCCATCGGAGCACAAAAGCAGCCGTGGACAATACCAAATGAATGGCTGTGTTCCAGTA
GAACTTGATTTACAAAAACAGGTGGCAGGCCAGAATCATAGTTGGCCGTACTCTGGGCCA
TCATTTGCCTGTGTCTGGCTCAAGGGCACTGGCCTATTCCACACCTCTAAATGATTGGGA
CTGAGACACTAGTCTTAGAAATATTATACTATGTACAGGTGTTCCTAGGCCAAGAGATGT
GAACTTTCCAAACTTAAGGATCAGGAAAGCTAGTATAAAAGAAACTAGAATTTTAGGAAA
ACAGTTGGTGGCCGGGTCATCTAGGTAGATTATATACAGTCCTTAGAGACAAGGCAGAGA
GCATGGTAATGGATTTATGGCAGGCCCTTCTGTGGGCCTCTCATAGTGTACCCATGCAAG
AGTAAACTGCAGCCTCGAACCATTGCCCAGCCTCCTTATCTGTGGGCTGTGAGCACTGAA
GGGGGTTGTACAGTGTGAAATGAAGAAGGGCTGGTGAACTAAATTCTGTTTGTGGTCCCT
AGTCATACTTATTTTACTTTTTATATTTAGGCAGAGCTATAGTTCTCCAGCTTTGAGCCA
CACTGTTTTGTAATTTGGAAGCAATATAGCAGAGTGGTTAAGAGTTGGGGTTTAGAGATA
GACTGCCAGGGTTTGTCATGCTTTCCCATTTTTGAGCTGTATGATCTTGGGATATAACTT
AACCTATCCAGGCTTTGGTTTTCTTTAGATATAAAATGGGCATAATGATAATATCTGAAA
GAGTTGCAAGGGTTAAGTAAAATGATCCAAGCAGTCATAAGTATTAGCTGTTGGTAATAA
GAGTTTTCCTTTTAGAAGTGCTTGTCTTCTCTAATATATATTGTCTTTTGGTCACCCCTT
ATTCCTTTTTGGAACAACCTCATGAAACATTAGACAGCCTTGCTTTTGACTTAACAGCTT
ATCCATGGAAGTGGTAGATGAAGTTGCCTTTGCCACAAACATTAGCAGGATTTGTGATCC
CCGAAAGAGCTAATCACATTGATTTAAGGGCTTTAAATAAGAGAATGTTCTTGCTTGATA
ACTTCTGAACTAAGTAAGTGGCTGGAGTTTTTATTGTTTGTTAATGGTCGTGTTTGCTCC
TAAGAGCCCAAATGCACAACCGGTTTTTCCTGAGAGTTCAAAGCACTGTAGAGATTGTCA
ATTTCATGTTTCCCTCCCATGAGGGTGGGAAGGCTAGGCGATACTGTTACCAAATTATGT
ATAGAGGAAACTAAGGACTGGAGGATGAAAGATTCGTCTGATACATACTGATCATTAGAG
TATATTGTAATCATTGTTTACTTATTCATTAGTTGGACGTCCTCACACCTTTTTCCCTTT
GGTTTGTTTTGGTCCCAGAGTCCGATGAGTGGGCCTTTTATTCCTGCTGCTCCTGTCAAA
ACTGCCTTGCCTGCTGGCCCCCAGCCCCAGCCCCCGCCCCAGCCCCAGCCCCCACTCCCA
ACTCAACCCCAGGCACAGAAGAGGCGATTCACAGAGGAGCTACCAGATGAACAAGAATCT
GGACTTCTTGGATACCAGGTTAAATAAAATACCCTGTCTTACTTTCCTCATCTTATCCTA
CTATATTCTCCCTTTAAAGAAAGATAAATTCACATCTATATCAACTGTCCTCCCAGTGCT
AGGATTTCTGCCTTCTGGAATCCATTTAGATTAGGTTTTTATCCTTGGGGGATTAATTGG
AAACGAGAGTGATTCCCTTTGGGTGGGTTTTGTCTTTGGGGTCAGAGTGATAAGAAAATA
CAAAGCTTTCACCTAGAGAGAATCTCCTATGACCAGCATCTGGAAGGAGTTCTGTAGAGT
TCTGCACTTCCTCTTATTCATACAACAGACTCTTGAAAGCCTCTGATAGTTCTTACTTCC
CTACACATCTCACCAAAAGCTAATATTCTACCAATATATGGTTTGTATTGAAAACCTTGG
CTTTCAATTTACTGTTCTCTTTTCCCCTCCAAAAAAAGGCGGCCAGAAATGGAGTGATTC
TGTGCTTAGACATAGTAATAAACACAGTCATTCACTAGAGTTTTTTAAAGATTATTAAAG
CGTGTAGTTTTGATGCAGTTTTATTTCACTGGGAAAGCATCTTTACTTTTTGCTAGAATC
CTTGAAGCATTCTTTGAAATAAACTTTGAAACATTTTTGTAGTTTATAGTAGGTTTATTC
CAACCGATTATGGATAGTTGAAAATAGACATAGCATAATGAATCATAACATCCCTGACCA
AGTCCTCCAGAGAAAAATCATCTCTACTTCAGCTATAGTTATACTCCAGATCCCAAAGAG
CTATGTAGTGCAGCTTACTGCAGTGTATCAGAAAGATGAGGCACTTGTCAGTTACATTAA
GGAGCTAAAGTCAATACAGCAGTTGTAGATTTGCTAATGCCACTGTATTTTTCTGCTCAT
AGCATGGACCCATTCATATGACTAATTTAGGTACAGGCTTCTCCAGTCAGAATGAGATTG
AAGGTGCAGGATCGAAGCCGGCAAGTTCCTCAGGCAAAGAGCGAGAGAGGGACAGGTGAG
TTGATTGAAACATAATTATATGAGTATATTCAAATATTTGCACCATTAGTGGGAATAATG
ATCATTGATATGAGCTTCCATGTTCTAAAACTAAAGTGAAATCATTTGGATCAAACAAGC
CCCTGTTTGTTATAATTGATGCAGTAATGGAAAATGTAACGATCTGCCTTTCACAGTCTT
AGGAGGAGTTACATTCAGCTTTGGATAATTCACAACATGCTTAGTCAGGCATCTTCCTTT
ACTCTCATTGTTTGCCTCTTGGCCATTTTCCTAAGGGTAGGCAGTAACAGAAGTGTTACA
CAATCAAGCCATTTTTGCTACTTAGAATCATAGAATATCATGGATGGGGGTACTTGAATG
GGAGTTCAGCCTGCCATCCAATGAATTCTCCTTTCCTATATTATAATATTAGACTTCATA
AGAGGGAGCTGACTTCCCACTACGGTTCATTCTATTTTTGGCATGGCCTGGCTCTGTGGA
CAGGACTTGTGATCTTATAACTTGATAATAGCTTGAAGGGTAGGGGGTCTGGTGCAAAGA
GTTGAAATTAATGGTTAAAAAACTCGAAAGATTATCTGTAGACTGTATTGTTTATCCTAC
TTCTTATCTACTGGAGAAATTAAAGATTGATTGAATTTGTCTGAAAGACTACTTCATTTT
TTTTATTCTAACAGGCAGTTGATGCCTCCACCAGCCTTTCCAGTGACTGGAATAAAAACA
GAGTCTGATGAAAGGAATGGATCTGGGACCTTAACGGGGAGCCATGGTGAGTAAGGTGTA
GCTGGGGGAACAAGGGAGTGGCTAAGACTGGTCTTAAGCTATTAGTTTTCTAATCTGATG
TTCATTCAGGTCTGACTCATTCACGTGTTTAATCCAACCTCTATAACGTACTGGCTAATG
AGAATACCTTTTTTTTATTTATATGGACAGCATATAGTTACACAGCCTTATATTTTCAAC
CGACGTGTGTCTAGAAAAGAGTCAGTCGACTTATATTTTATACGTAGCATCAGTGACATT
AAAAACCTAGGAAATACTAATGATTGGTAGGTCATTTCAAAATTTTGTTGTCTTTGTTGT
CTGAATACCTGGAGGTAATCTGATACAGACTTAATAAATACGGATTTTTCTTTGTGTTGG
GAGCTGAGCCCTGTCTCCCTTCATAGCTCTATTCGTCGGGAATGGTCAGCCTGTGGCTGT
TATAAAAAATGTTGCTTACTCGTATCCCAGAACTCTAATTCCTGTAGAGGTACATGGGAT
TGTTTTTGTTCTTTGCCCGTAGTCGTCATAAAAACGAACAGAAGAAAATAAGTTTTTTTC
TTTTCTTAACTTCTTTTCTTTTAACTCTTTAAAAGGTGAAATAGCCTCCAGAGACTCACT
TGCTAACTTTCCTTTTTTTTCTTTTTTCTTTTTTTTTTTGTGTTTCTTTTTTCTTTCTCT
GTTTTCTTACATGGTTCTGGTGGATTCACATTTGCTGATGCTGGTGCTGTTTTTCCTGTG
ATCTTCAACGTTTTTGGGTGACCATGACCCTGTGACCTCAAAATGGTGTCCAACTAACCA
CTTACAATTAACATCTTTTTTTTATTAACGAATTTATGGTATTATCTTTTTTTTTTTCCT
TGGTGGGGAATGGGGTTGGGGTTGTTTTTCTCTATTCTAGATTATCCGGTCAAGAAGATG
AAAACTACAGAAAAGGGATTTGGCTTGGTGGCTTATGCTGCAGATTCATCTGATGAAGAG
GAGGAACACGGAGGTCATAAAAATGCAAGTAGTTTTCCACAGGGCTGGAGTTTGGGATAT
CAATACCCTTCATCACAACCACGAGCTAAACAACAGATGCCATTCTGGATGGCCCCGTAG
GAAGGAGTGGAACAGAGTTTTGACCCTCGGTGACTCTTCTTTAGCAATAATGCATGCATT
TGATTTAAGAAGACTCTGGGGCCAGTACTGGGAACATCTTGGACCTTTGCAGAAGTTAGG
GATGCCGTGTCCTCTTTCTTAAAGGAGTTCCATTCTTTTTAAAACATCCTTATTTCTGCA
GTGGCATAGCATCTGTTAAAATTTACTTAGAATCACAAATTTGTCTCAGAAGCTTTTTAA
CAGTTGGTGAAATGTGCTTGTTCAACAAAGCATCCCAACAGGGTCATTCCAATATACATT
TGACCTGGTCCAGCCTTTTCCAAATGAATAGCCCCTATTCTGACATAAAGTTTTATTTGT
ATTTTATTACTGTTTGGTGAATTTTGATAATAACTGGTTATAAACAAAGCCTTACTATTT
ATTAGTGGGGAAAAGATTTTAAGACCCTTTTCCTTTCAGTGCTAAGTATAAGAACTCATC
CCTATTTCATTTTTGGATTCTTTCTGTTTTGGAAAATGCAGTTTTACTAATTTAAAACTA
TCGGATATAGCTGGATCCTGGGTAGGAAAATGAAGTTATTTTTTTTATTGTGTCTTTTTA
TTGGGATGATCCAAAGCTGGCACTTCCAGGCACACTTGTCTCAGATAGCCATTGCTGTTT
TTATTGCTCTTCTAAGCTCCTTGTCTTCAACTGGGTCAGAGAAAACTACCTGCTCAAAGG
CTGGTCAGAACTCATCACAGAAACGAAACACAGTGGTCTGTCTCTCTCAGAACTGGTTGC
AGCTAAAATAGAGAGATTTGACTGCTCGCAATAGGATGGTGGACTTAGTGACTGAAATTG
CAACTTGTCCTTTTTCTTGGCATTACAGGTTTTGCCAAAAGAACTTTTTTGTATCAAATA
TTGATGTGTGAAAGTGAAGGAGCTAGTCTGCTGAACCAGGAGTAGTTTGAGATACTGAAC
TGTCATTTTTGCACATTTGAATACTTTGCAGGCTGGCTTTGTACAAACTTATCCTCTGGT
TTCCTATATGTTGTAAATATTTAGACCATAATTTCATTATAAATAAATGTATAAATATTC
TGCCTGTGGTTTCTGTTTTTCCTTCCACAACCCACCCTACACTAAAATTCATAAACTTTT
TTACTCATAGTATAATGAAATTATAACCCCATCAGAAAAATGCACATGTGGACCTAAAAG
TTTTCAGGCAGTTCCGAGAGATTTATGACTTTCCAAAGTCAACCCTTAAAAGTCCAGATG
AAAACAAAGGATTATTATGCTGGATGTTTTCCAATTTCGTATTCTAGCTCTCCTTTATTG
AACATGGTTAAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1062, 1483..1699, 4533..4661, 5014..5093, 6974..7026, 7283..7446, 8223..8434, 9235..9295, 10791..10848, 11071..11324, 13038..13217, 14102..14214, 14894..14985, 15880..16411
1025..1062, 1483..1699, 4533..4661, 5014..5093, 6974..7026, 7283..7446, 8223..8434, 9235..9295, 10791..10848, 11071..11324, 13038..13217, 14102..14214, 14894..14985, 15880..16076
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved