Equus_caballus Locus Q6V8J6_HORSE
snOPY snoRNA Orthological Gene Database
Equus_caballus Q6V8J6_HORSE
Equus_caballus
Q6V8J6_HORSE
14
SNORD63
6743..6817
12859
ATTTGTGTACAGTTTTTGTGTGCACATTTGTTTTCATTTCTCTTGGACCTAGTAGTGTG
ATTGCTGGGTGTTACAGTAACCGTGTAATTGCTTTCCCAATAAGCAGCATCATTCTTTTG
TTGGGGGGAAAAAAGAATGTTCAGGTTCCATCACGATGTTTTTACATGTTAATGATTGCT
TTCTAAAGGTTTTCTTGAATCCTGAAGTTCTCATTTGTTGGCTCTGGATCTCGGGGTAGG
GGTTGGACTTTATGGTGTATGGGAACTTTGTCATGGTAGGTTGCACTGGCATGTTTTCTC
AAACATAAATTTTGTCTTTCAGTAAGAATGTTCCCTTTAAAATTGTGCGTGCCTCTAATG
GTGATGCCTGGGTTGAAGCTCATGGAAAACTCTATTCTCCAAGTCAGATTGGAGCATTTG
TGTTGATGAAGATGAAAGAGACTGCAGGTGAGTTCACATCAGGGGAAGTTGGGAGAACTG
GCTGATTCCTCTGAAATCACTAGCTGCCATGCCCATATCCTTGTAGGAGTCTGGTAGGTT
TTCTATAGAAAACCGAGGAATGGCAACACATTGTTAATTTCACACTTTCCCTGCAGATTG
TGAATTTGTCTTCTACGTTTTCCTAATGGTGCCTTGCTTGTGGTCATCCCTCCCCCCAGG
AAGGGAGAAGTATTCTGTGTTGAAAGCCAAAAGACTACACATTAAGCTTTCGTCTCTGTT
AGATAAAACTTAGAACTTCCCATTTGAAAAAACTAGTAGCTGTTTCAAGTCTAAAAAGTA
GGTTATTATAGCTGGTGAACCTTCACTAAAGTGTTAAGGTGATATCTTGGGTTTTCAATG
TGTGTCTTTAATTGGAGTGTTTTCCTACAAGGTCTCTACGTATTGTCACATGCTAAAAAA
CTGGTGGGTGCTGTCTGTGACTTCAAGGCTATATTAGTAATCTATTACGTATTTATCTGA
CAGAATCTCATGATTGAATTTCGTTCTTTGATTCTTTTCCAGAAAATTACTTGGGGCATA
CAGCAAAAAATGCTGTGATCACAGTCCCGGCTTATTTCAATGACTCTCAGAGACAGGTGT
GTTCAGTTAGCTTTCTTATTCAGGAAATTAATTGTACTTGGGACACAGGAGTAGAAAATG
CTTTTTTTCTTTAGGCCACTAAGGATGCTGGTCAGATATCTGGACTAAATGTACTTCGAG
TAATTAATGAACCCACAGCTGCTGCACTGGCTTATGGTCTAGACAAATCAGAAGACAAAA
TGTAAGTTTGTGCAGTAAGTTCTACCTGGATTTGTGAGACTAAGTTTATGGAACTATGAG
ACTTATCCTAAATTATCATCTTAATTTCTTAGTGATCGAGCCTTGTACTCCAACTGAAAA
TGTGATGCCTTAACCTTCAAGGCTGTATGATCTGTGTTTTTCATTCATTTGAAGACCATT
CCTTTATTTATTTGTTTGTTTTTAAGTACTGGGCTATGGTCTTTTTTTCCTGCTTGGTAT
GCATGTTGGCAAGTATTCATCCAAAAGAGTGGTTGAATACTGTCAATTTTGCTTTCAAAA
ATTGAATTTATTTCATTTCAGCTGTGTGTCTTACATGTAGCTATTGGGACCACATGTTAA
CACACATCACTTAGGCAGTTATCAGATTTCATAATTTGGGGCTGGCCTGGTGGCGTAGTG
GTTAAGTTTGTGTGCTCTGCTTCGGTGGCCTGGGGTTCCTAGGTTTCAATCCTGGGTGCA
GACCTATACACCGCTAATCAAGCCTTGATGCAGCAGAGTTCCACGTACAAAATAGAGGAA
GGTTGGCACAAATGTTAGCTCAGGGACAATCTTCCTCAAGCAAAAAAAGAAGAGAGAAAG
AAATCCATAATTATTACACCTTGGGGGACATAGCCAAGTTTATGTTTGTTTGGTTATTGA
AATTTATATCCTTGTGATAGTTTTTGTTCCTTAAGGGCTTCTTTTTTTTTTCCCTAGCAT
TGCTGTATATGATTTAGGTGGTGGAACTTTTGATATTTCGATCCTGGAAATCCAGAAAGG
AGTGTTTGAGGTGAAATCCACCAATGGAGACACTTTCTTAGGTGGTGAAGACTTCGACCA
GGCCTTGTTACGACACATTGTGAAGGAGTTCAAAAGGGAGGTTAGTTACCAGTGTGGTTA
ATGTGTAGACATTGGGATATTGAGAGTTTCTTGTTCAGATTGCTATTTGCATTGTATATA
ATAGTTTGCCCCTAATAGAACATAGAATAGACCACTGAAATGATTGCATTTCAGTTGCAT
GGGTGGACTGTACTGTTTTGGTTCCTGTAGCTTCAGATTGGGAACAAACAGATTAAAAGG
ATACAGCACTCAGTGTACAATATTGGAAAAGGAATCTTGGGGACTCCTTTTTTGAGCTAG
AATTCTACAGCTGGCAAGAACCGAGATCAGTTCAGCCCTCTGACTCCAGGCACAGATAGC
CTTTTTTTTGGTGAGGAAGATTGGCCCTGCGCTGACATCTGTTGTCAGTTTTCTTTTACT
TTTTTGTATGTGGGATGCCGCCACAGCATGGCTTGATGAGTGGTGTGTAGGTCCACACCA
GGGATCTGAACCCATGAACCGTGGGCCACTGAAGTGGAGTGCGTGACCTTAACCACTACA
CCACTGGGCTGGCCCCCTAGATAGCTTTTTCAGAATAGGTTTTCTGTTCTCTACAAGTTT
TTAAGGGTAATAAGTAATTTCTGCTTGTTTATAAAGGTATGGCTCTATTTTGTGTTGTTA
CAGCTTACCACTGCAATTTAAGTAATATTCATTACCTCACTAATACTAGTGTTGTGTGTC
TTCTCTTTGTAGACGGGGGTTGATTTGACCAAAGACAACATGGCGCTTCAGAGAGTTCGA
GAAGCTGCTGAAAAGGCCAAGTGTGAACTGTCCTCATCTGTGCAGGTGAGATGTGAACAA
ATTCCAGCAGTCTTGATGCATCTTTTCAGCCTGAGTTTATTTAAATAGCATGTTCTCATT
GGCCTAATGTCAGTCTAATCTTTTTACAGTTTTCTGGTTGGTGGTAAATGGCTTTCCATG
AGCAAAGCAGCAGTATGTTTATGGATGAGCTGAAATTTGTTAACTACCAAAATCAGAGGT
TGTATATACTGGAGCCAAATAATAATTAAGACTTGAATGACACTGAATATGCTTATTTGC
TTTAAATTAAAGATACTGATTTTAAAATTTAGACTAATAGTATGCAAAATTAGAATTACT
AGCCTGGAAATACTAGGAGACTCTCAGAACTGCTACTGTCTTAAGACATCTCTTTGTGTG
AGTCTCTAGTTGTCTCTCATTTAATTATTTGAATCACCAATCTAGAAAATGAGCTGTGAA
ACGTGGCTGAAGGCTGGTGTATGTACACATGTGCAAGTTTTCCTCTGGGTATCAGATTTG
CTGAGCATCTGCAGAAGGTGTCAGTCTGTGTTGCTCTAGTTCTGAGAGGTGAGAGCTTTA
CTTTGTCTTAGCCACTTAGAACAGGATAATAGGAAGCATGTTAGATTTGGATCAGAAACC
CAACAAGAGGGAAAGCAAGAGATCTGTTTCCGGGTTCTCAGGTGGCAGCAGGAAAGCAGA
CCCTGTGACTACTTTAGTTGTTAGTTTGATCACTCCCACTAAGAAGAGATACTTATAGCA
GTTGACATTGTGTTGGTAAAGTGATTGGCCTCCAGTCAAACCCGGGTTTTTTTTAAGTGA
GGAGTGACAAAGTTGTACAGTCATCCATGATGTTGATGGTGTTGCCTTGTCCCTGCTATC
AGAGTGGCAGAACTTTGCAATATGATGGTTAGGGCTGGGTTGAAATATGTGGCACTGCTA
GAGGATAGCTTAGAATTCTTTCCAGGGGCTTGACACTGTTTGGAGGCGGGGTGTTGGTTT
TAGTGAGGCTGTATCCTACTGATTGTTTCCAGCATTTTGTTATTTATAGCAAGGTATATG
GAGCATTCTTGTGCTTATAATGTTTGTGCATGTGTGATTGTAAATCTGTAGGATAAATTT
CTAGAAGCATTTTTTTTACCCTTATGGAGTTTAAAGTGTGGTTTGAGGAGACAGACTTTA
ATTAAAACATTATATTAATGTCAAATCAGAAGTAATGTAACATAGAGGTTAAGAGGGCTC
TGTAGGCACACTGCTGGGGTTTAAGTCCTTATTTCATCACTTATTAGCTGTGTGACCTGG
ATGAATTAACAATTCTGTTTGTTTTCTTATCTATAAAATGAGAATAATAGTGCTGCTTTC
CCCCTTAGAGTTATGAAGATTACTAAATTAATACATATAACATGCTTAGGACAATGTGTA
GTAAATAGTAAGTACTCTAAATATAAGCTGCTTTTAATGTGGTAAAAAGGCAAAGTTAGA
TTTACACTTAATAACAGAGGAGCCTGACAGAGGTTGGACATAATAAGGAGAGCTTCTGAA
AGATGAGTTGATCAGGAAAAGAGAGAGTCAAGTAAGTATGAGGCTCTGGGGTGAAGACCT
GAGCAAGAGCCAGTGTGACTGAAGTGCACACAGGCAGGGGGGCATGGAAGATGAGGCTAC
AGGCTTTATAGATTTGGGATTTGGTGTCTATGCTGAGATAAGTGAGTACAGACCCCGCAA
AACTTTTAAGCTGGGGGCAGTAACACGGTCAGATTTGGTTTTGGGAAAAGTCTGAGGTGG
AGTAGGGTATTGTTCCTGGGAGTCCTGTGGCAGAGGGCATCCTGAGTGGATGGAAAATGT
CGGGATGCTGTTGCAGCACACCAGGTGGTGAGAGAGAATGTGGTTAGATTTGAGAGAGGG
ACAAAACTTTATGATGAACTGGCTTTAGGGTGTTGAGAGTCCCAGGTTTTTCAGATTGTC
GTTAACTTACAGTGTATAAAACTGCACTGATATGGTAGTAGCCACATGTGAGTATTTAAA
ATTAAATGAAATTAAAAATTCGATTCCTCGATTGCACTAGCCATAAAGTTTCGGGTGCTC
AGCCATATGTGGCTAGTGGCTGCTGAATTGAACAGCACAGATAGAGAGCATTTCTGTTGC
CACACAAAGTTCTATTGGATGGTATTCGTTTTGATAATTAAATTCTATTTTCTGGTTTCA
TTTATTAATATTTTGCAAAGAAAGAACAAAATTGTCAGTGGAGTTCTTTAGAGCTATATG
CAGTGTCACTGTTTCTACAGAAGGTGTGTCAGCTCTCACTATTAAGCATTTAAATGTCCA
GGGTACTTTATCTGAAGAAAGGTGGTTAAGGACTTGCTCCCCTCAGTCTTATTCCCTGTT
GGCCTTGCTTTGATGTGAAGTTTGAGGGGAGACTTAAGGTACTTCTGTTCCTGAGAGTTC
ACCCTTGGGACACCTGTTTCAGCATGTTCGGTGATGTTTTGTTAGTCTTAATATTCTCAA
TTCATGCCTTATTAGGATTTGGGGTTTATTAAATACTGGATGTTACATGGTGTGACTGTA
GAAGTGTTAGCTGCTCTCCGTGGGTGTGATGGCAGTAAAGTCAGTCCTTGTAGTTTTCTT
TAGGATTTCTGTGGTAGCTTTCTTACTATCTGCCTGAAACTTATAAAGCTCTTACTTGAT
GGCTGGTTATTTGGTTCAGAGCATATCTTTGACATTTCTCTTCATGTGCATGGAATACTT
TAAAACTTCTAAAAGAAAACAGTAGTGTGATTTTTAATGTATGTTTAGTGGCAAGACAGT
TCATCTCCTGAACGGGGATTTTTCCTGCTTCTCTGTTCTTCATTGTGTTTTTTGTTTTTT
TGGTTGTTTTTAAGATTGGCACCTGAGCTAACAATTGTTGCCAATCTTCTTCTTTTTTTT
TTTTCCCTGCTTTTTCTCTCCAAATCCCCCCAGTACATAGTTGGATATTTTTGTTGTGGG
TCCTTCTAGTTGTGGCATGTGGGACGCCGTCTCAGCGTGGCCTCATCAAGTGGTGCCATG
TCTGCCCCCAGGATCCGATTGTATAAAGTTTACCCTCTGGGAAGAAAAGAGGTTGAATCT
TAAATAGTCACTGTCTTGTTGGCTGTCCATTTAAAGTAGGTTTGATCCTCGTGGTTTTCA
AAGTGTTCCTGACCGAAGGTATGGTCTTATTTTAAGTAATAAAGAGACTTCACCACTACT
GGTCTCCCCGCTTCCTTTGTAGACGGACATCAACTTGCCATATCTTACTATGGATGCTTC
TGGACCCAAGCATTTGAATATGAAGCTGACCCGGGCTCAGTTTGAGGGGATTGTTGCTGA
TCTAATAAGGAGAACCATCGCCCCGTGCCAAAAAGCCATGCAAGATGCGGAAGTCAGCAA
GAGTGACATAGGAGAAGTGATTCTTGTTGGTGGTATGACTAGGATGCCTAAGGTATGGAC
CCATGGAATTCCTGGCATGGGGAGGAGAGAGGGCCAACAGATAATGTTCTCTTGGAACAA
ACGGCTTATGTTGTTCAGGGACACGAATATGTGGCCTTTTTGCCCTGGTGACCTGAAAGG
GGGATGAATTTGTGCCCTCACCAGAGAGTTCTTTTCTTAAAAGAGTATAAGAAAAAGGAT
TAGAAAGGACAGACTGTCTTTGGGGTGGTAGCAGGGGAGGATCCTGAACTTCAGTCCTGC
AGAATTTTTAGGAATGAAACAAAGTTTGAGGTTAGAGATTGCTTAAAACCTTCATACTAA
GTCGTCTGTAGGGGCAATTTTGGACATGTGTCATTGCAGCATAGTATTTGGGCTTTGTAA
TTGCATCTCTTCAGCAAAGATTTGTGCGATGATGCATTTTACTCATCAACACATCATTCT
GAAAGGACAGGTGTGTGGAAAACTAATGACTGAGCACAGAACCTGTTGAAGGTGCAATTC
TTGCTTTATAATTTGAATGGAATTATCCTGGGCCATGGTAATTTCTTAATTTTTACTTTG
GAGTAAATGGGCTTAGGAAAACATGCACACAATAAACCTGGAGGAAAAAAGAGAGGCTTT
GAACCAGGTGGATATTTTTATTTAACAAATTATCTCATGCTATTCAAATAGAACTGTTTC
TTAGCATTAGTAAAATAAGCAGTGGGGAGAAACATGCCCCACATCAGCACCAGTGTTGAA
TTAACACTGCTGCTTTTAAGTTGGTTTTTACTTGATATGTGGACGAGAACTTGAAATATA
AAATTTCTATGTCCCTTTGCCTTGTACCTTCTATTTCTTTTTTTTTTTTTTGAAGACTTT
ATTTTTTTTGTTTTTCCTCCTTCTCCCCAAAGCCCCCCAGTACTTAGTTATGAGTCCTTC
TAGTTGTGGCGTGTGGGACCCTGCCTCAGCATGGCTTGGCAAGTGGAGCTGTGTCCGCGC
CCAGGATCTGAACCGGTGAAACCCTGGGCTGCGGAAGCGGAGCGCATGAACTTAACCACG
GGTTCAGCCCCCTTTTTTTGTTTGTTTTTTGAGAAAGATTAGTCTGAGCTAACGTCTGCC
GCCAATCCTCCTCTTTTTGCTGAGGAAGCCTGGCCCTGAGCTGACATCCCTGCCCGTCTG
CCTCTACTCTATATGTGAGACACCTGCCACAGCATGGCTGACAAGCAGTGCGTGTGTCCA
CACCTGGGATCCAAACTGGTGAACCTTGGGCCGCCAAGGCAGAATGTGCGAACTTAACGG
CTACGCCACTGGGCCAGCCCCGTACCTTCTATTTCTAAGTTAATGTATGGGAAACCAGAA
AACAAAACTTAGGCCAATTCTTCCCAAATTTAAAAGGGTTGTAAATGAGATAGTCATATG
AGTGAAGTATGTGTGTTACCTGCATGATTAGCTCATTAACAAGAATTCAGTTACAAAATA
GTAATTTGAGTAAACCTTCTTGCATGTGAGGCAACCTATCCTGCGATCTGGTGGGGTCTT
GGGACACACATCTGCTCTTCCTCGACCTTCTCAGGCAGTTGTTCTGAGGTTCTTTTTTCT
TCATGTTCAGGTTCAGCAGACCGTGCAGGATCTCTTTGGCCGAGCCCCAAGTAAAGCTGT
CAATCCTGATGAGGCTGTGGCCATTGGCGCCGCCATTCAGGGGGGTGTCTTGGCTGGTGA
TGTTACAGATGTGCTACTCCTGGATGTCACTCCACTGTCTCTGGGTATTGAGACTCTAGG
AGGTGTCTTTACCAAACTAATTAATAGGAACACCACTATTCCAACCAAGAAGAGCCAGGT
AAGAGCCACCCTTCCCTACCTCATAGAGATAATAGGTTCTGTGAGGTATGTGGTTGTAGC
TACTTTTGTGAGCTTTTCCTAGAAAACTTCTCTTTTTGTTTTGCAGTCCATACTAGTTGA
ATGCGGGTGGTAAGAATCTTGTCTTTTGTTCTCTTCTTTTTTTATTCCTGGGAAAGTTCT
TTACCTGTCAGCCAGTGGTGATGATTTTAGGAATGGCATTTTTCCTTTAGTCTCTCCTTC
ACAGGATTAAAATAACTTGCCAAAAGGAGCCTCACTATTTGGGACTGAATTCCCTGTACT
CTTCTGTTCTCAAAGGCAGTAAAAATGGGTTGGCCAAGGCTAGGGGAGTGTGCTTGTCTT
CCAGGTGAATGATGGGGGTCTTCAGATACCAAGCAGGGCTGTCTGGACAATTGCTTGGTC
TTGGATTAAGAATTATTTCCTGACTTTCCCAATTTTGATATTTTTCTGAAAACCTATGAC
TTGCTGTATTTGTGCAGTGCCAACACATCATTCTGAAGAAGAGTGTGCAGTGACTTCCTG
TGACTGAGCACAAAATATATGTCCTGTCTCTGACCCATTTCCCCAGATGAGCATGTTTCA
ACACCTCACTTTTTAGCTCCTTCTCTTGGGGCCCTCTGTGCTAATGCTACATCTTTGTAC
AATGCATTTGCTCAGCTGAAACAGTAGCTGTTGTATGCTTTTTTGCTGTGCTAAGCTTCC
TCCTGTTCCCTGCAAAAATATGTGTCTTTGTTCTGAACGTAGTGTACATTAGGACTCTTA
CAGTGTTGGGATGTGAATTTCTTCCTTTGGCTTGCACTTTGTATAAGGGGAGTAGTTTCA
TCAGACTCCCAACCCAGCAAGTTTCCTTCTCCCTAGGTGTTTTCTACAGCCGCTGATGGA
CAGACTCAAGTGGAGATTAAAGTGTGTCAAGGTGAGAGAGAGATGGCTGGAGACAACAAA
CTTCTTGGACAGTTTACTTTGGTAGGTATTGGGAATCCTGAATATTATGCTCCTCATTCT
ATTTACTGTAAAGTTAGATTATGTTCTAACCCGTAATAATAATACTATAAACTGGTGACA
GACACAGACATAGTCTGTTATTTTAACATCATATGCAGACAAATTCTGCAACTGGATACC
CATGGCTTCAGTTTTTACCTAGAAGCCTTGCTTGTTCCTTGTGCCTTAGGAACTTCATCA
AAAAGTTTATAAATATAAGAGTCAGGGAAATGTTCATAAGCAATATTAATTAGGAGAAAT
TCTTGATTAGTACTGTAAAAGACATTTGATGTTCTGGCTTTTAGTTAGCGTTGCTTATTG
GTTCTTGATGAGGTGAGCACTAATGGAGAGGTTTGTTCTTACTCTGTGCCCAGGTACATA
CAGCGATTAATGGTTTTTTGCTATAGCCAGTCTTCACTGGTATAAGCCCTCTTTATTTTA
TGCAGCAATGAAACTACTCCCCTCACTTATAAACGTTGTGGTTTTGTACATTTAAGTATC
ACTTGTTTCTCCTAGGAACCAAGTGACTTGTTTTCCAGAAGATGGTATAGGTTTTGAAAT
AGAGCACTGGACCCCTTTGCGAGAGGAGCTTACTCTGGATATTTATTTATTTTAGATTGG
AATTCCCCCAGCCCCTCGTGGAGTCCCTCAAATTGAAGTTACATTTGACATTGATGCCAA
TGGGATCGTACATGTTTCTGCCAAAGATAAGGGTACAGGACGTGAGCAGCAGAGTAAGTG
CTCTTATTTATCAGACTGTAAGAGTCAGATGAGGGACCTTGGAGTTCCTCTATGTTAGGA
GCTAGAACCTCTAAGTTGTGCATATCTTTCCCCCCAGCCTCAGGAGGATGATGAGTCCTT
CCTTGCCCCTTTTTTCCTCACTTATCAAATTCACAAACAGGTGTGTTTATCTCCATAACA
GGCAAGCACTGAGCCTCCGGATTGCTGAAGTTTTGGTAGGCAGGCAGGACAGTTGGTCTT
TGTATATTTCAGACCCATGGTTTCCTTCTTATAAGACAACAGGGTATTTGTTTTTTTCAT
AATTCACATCAAGATTAGCTACTCTGTGCAGGAGTTTTCTTTTTCTTAATAGAATATATG
AAGAGGCATGTAGTTTTATCTGGGAAGTAACAAGGTGCTTTCTTTTCATTATAGTTGTGA
TCCAGTCTTCTGGTGGGTTAAGCAAAGATGATATTGAAAATATGGTTAAAAATGCAGAGA
AGTATGCTGAGGAAGACCGCCGAAAGAAGGTGATTACTTTCTGCCTTTTCAGCTGGGAGG
CGAAAGTAGTTGGGACATGTGTCATTCATCTTATATCTTCTGTTACGCTCAATATATCCC
TTCTCCGCCTTTGCTTGTAACTTGTGTGTGGAATGCCTTTCTTATTTATTCTGTCTTCCC
ATGTCAAAATTCTTATCTTATATAATCCAGCTGAAATCTCTTACAAACATCCCAGGCTAT
GCGAGATCACAGTGATTGCTATCTCTTGATATTTTTATTCTGTAACTGTATGCAGCAGTT
ACCATGTTGTTTTGCTCAGTGCAGACGTTCAGTCACCTGGTTGACTGGGAAATCTTCATT
GGTACTACATTTCTAATTTCTCTTAGGAACGAGTCGAAGCAGTTAATATGGCTGAAGGAA
TCATTCACGACACAGAAACCAAGATGGAAGAATTCAAGGACCAATTGCCTGCTGATGAGG
TGAGCCCACTTTTAAAATAGCTCAAGAAGTTTAGAGGCGTTGTCACCAATGTCATTTAAG
TTTGTTTTTCTGTGTGGGAATTTAGTTTTTAAGAAATGCTTCTGAATATTACTGCTACCT
GTAATAGGTTAAGAAACCCAGAAAAACTGAGGGTTTGGTTTGGTTTGGTTTTTAAGTGCA
ACAAGCTGAAAGAAGAGATTTCCAAGATGAGAGAGCTCCTGGCTCGAAAAGATAGCGAAA
CCGGAGAAAACATAAGGCAGGCAGCATCTTCCCTTCAGCAGGCATCATTGAAGCTCTTCG
AAATGGCGTACAAAAAGGTACACAAGGGCTGATGGGTGTTTTGCTCCTAACTTGATCCCC
ATGTAACTTCTCTTGATTACTGTCACTGATTGCTCTCTTCATAGCCATTTTATAGAACTG
GGAGTATTGGAATTGAAAATACCTTTCCTGCCTTCTCAACTCTAATTTGGGAGGGAGCGT
AAGGTCAAATGGAAGGAATCACACAAACCACCAATAGTAGACAAGCAGGGAGGGAGGTTG
GAACAGACAGGATATGCTCCCTTTGTTATTTAGTTCTTCAGAAAGCAAACTGTCAGCCTT
AACATTAAATGAATGGCTCTCAAATGTTTTTTTAACAGATGGCATCTGAGCGAGAAGGCT
CTGGAAGTTCCAGCACTGGGGAACAAAAGGAAGATCAGAAGGAGGAGAAACAGTAATAGC
AGTAAACTTGGAAGCTGAAAGGACAACATACTATGACGCTTGGGAGTGAAGGGACTTCCT
GAGCAGAAAGGGGCAAACTTCATCTTTTACTGTGTTTTTGCAGTATTCTATATATTAATT
CCTTAATGTGTACATTTAGTGACAGTTAGCTAATGATCATTTAGTGATTGATAATTCCAG
CAGTACAAAGTTCACATGTTCTGTTCCTAGCCTGTCGTTTTTCAGCTGCATGTAAAAGGG
ACGGGAGATGACTTATTGATTATTATAAAGACTTAATGTTGTTTTGTGCTGAAGTAGCCA
TATTTTCAAGAGGTAAAACCGTCTCACACACAACAATGAAGGTAGTCAGCCCATAGACGT
GAAAGGAGACCATATGAGGATGAGATCCTTCTAGTTAGCTGAGTACTGCTGTACCGGCCT
GTGTGTACTTGGGATTCTTCAACTGAGGCCTTGCAAGGCAAGCCAGCTGTGCCATTTTGG
GAGGTAGGGCAGGGGAAGCTAGATGGATGAAAAATAAAGTTAGCTATTTATGCTAGGTAC
AGCTTTTAAAACAAGGTAATAAGGCTCCAATTTCCTAAGGCATACTTTTCTAGCTACCTT
GTGGCCTGTGTCTGGCACTTGTATCCTTGAGATTGTTCTTTTTGATCCATTCTGGATTTT
TTTTTAAAAATAAATATGAAAATCATCTTGATCTCTTGTTCGTGAGGGGTGAGGCCCTGA
GATTTAGCTTCAGGAATATGACATAAATCATACTTCAAAATTCCTTGATCTAGTGTCACT
CAGGTGAAATACAGGATTTTCTAACGCTGGCTGAAAATACAAATTGAAGATTTGGAAGGG
GCGGTATAATGAAATAATGAGTGTTATCACCAAGGACAAGTCTGGTCAGGAGTTTTTTTT
CCCTCCTTCTCTTAAAGCCCCATTTTGGTTTGGAATGTTGAAAGTTCTAGATCTCTATCT
AGCATGAAAAGCAGGTCTAGTATTTTCAGGCTGCTTTCAGTTCTAAGGAGCAAAAATCCA
ATCAGAATTGGCTTACAGTAAAGAAACATGTCTAGTAATAAGTCCTAAGATATGATTTCA
GTGGCTCAGTAATACCAGGAACCCCAATTCTTTCTATATTTCTGCTCTTTCATCCTCAGT
GTGTTTTCCCAAATTCTCTAATCTAATTATCACATGCTGACAGTTTCAGAACCAGAAAGG
TGACTGCATCTTTCTTGTATCTCATTGAAGTGTTAAGAATTATTTCCCAAGACTTCTAAC
AGACTTCCCCTCGTGTTGAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1075, 1154..1260, 1977..2139, 2832..2924, 6142..6351, 7930..8157, 9036..9140, 9775..9892, 10314..10408, 10766..10858, 11036..11176, 11498..11859
1001..1075, 1154..1260, 1977..2139, 2832..2924, 6142..6351, 7930..8157, 9036..9140, 9775..9892, 10314..10408, 10766..10858, 11036..11176, 11498..11572
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved