Equus_caballus Locus KIF18A
snOPY snoRNA Orthological Gene Database
Equus_caballus KIF18A
Equus_caballus
KIF18A
7
SNORD57
36465..36532
85156
CCAGGCTGGTCTCTACCTGTATCTCACAGACCCATAGGGTTAAAAATGGTTCCAAGGAT
GCATCAACTAGCCAGCACGGGTATGAGAGTTATAGAGATTGTATATACCCCATGGTGTAT
TCGGACATCCTAATCTCTGAATATAGATCCTAGTCTCCACTGCATAATGATGCAAGTTTA
GCGTACATCAGTGATAGCAGGTTTAAAAATTATCATCTGTTATATGACTACCTGACATAA
AAACAAGAAAAATAAAGATAAGCTAACAAACATCAATTATTTGGGAACCTCAACGATCCG
GAAAATAGACTCTAAGGTAAGACCAAGAAAAAACAAATCAGTATTCACTAATTTATTTAT
TCATCTAGTATTTGTAGAGTATCTACCATGTGGCAGGCACTGTTTTAGGCTCTTGGAACA
CATCAGTAAGCAAAACCTGCCCTTAAAGAACTTGTAGCTTAACTGGAAGAGAGGAAATAA
ACAACAAACATAATAAGTAAGAAATATATATTAGGGGGTGGGAATTGCTTTGGGAAAAAA
ATAAAGCAGTATAAGGGTGATCAGGAATTGGATAGGCTGATATAAGAGTGGACAGGAGGG
CAACACTGGAGCAAGGACTTAAAGGAAATAATCATGCAGACACTGAGAGAAGCACTTTGC
AGTACAGAGACTAGCTAGTGGACAGACGCTGCAGGGGTGCTTGGTGTGTGAGCTGGAATG
GAGTTTAGCAAAGGAGAGAGCAATAGGATGTGAAGTAAAAAATGTTGTCCATTAAAAGAA
CTTTGACTTGTGCTCTGAGCAAGATAAAGAACCATTGGAAGGTTTTGAACCAAGGAGGGA
AATATGTATGTGTATATATACATATACACATTACCAGTAACATTTACCAGGTGAGTGGAA
CAGAATTAATGCCTTTTCTTAATGAATACTAATACCAATCATTTTGCATACAAGTAGAAT
TAGTATTAATACTTTATTTTCCTTTTTAACTTCAGAGAAATATTCAAGCATTATCATAAA
CAGGGGAATCAACATCATCATCAATGTCTGTCACAGAGGAAAACCTGTGTCACCACATGA
AAGTGGTTGTTCGAGTGCGTCCTGAAAACACAAAAGAAAAGGCAGCTGGATTGCATAAAG
TGGTCCATGTTGTGGATAAGCATATCCTAGTTTTTGATCCTAAACAAGAAGAAATCCATT
TTTTCCATGGAAAGAAAATTACAAATCGAGATATTACAAAGAGACAAAATAAGGATCTTA
AATTTGTATTTGATGCTGTTTTTGATGAAACTTCAACTCAACTGGAAGTTTTTGAACACA
CGACTAAGCCAATTCTTCAGAGTTTTTTGAATGGATATAATTGCACAGGTACTTGTTTCA
CTTTGGATTTAATTTTTTCATCTGATTTCCATTTTCCATTAGGGTCCTCTCCTTGGCCTT
TTCTTCTAAATGTAGTCAACTTTAAGGTGCTTGTTTGCTAAAAATTCTTAAGTTCAGTAG
ACTTTCACTGTAAATGTGGTCTTTCTTTGAAATTTAATCACAGATAACATATATCATTTG
TGAAACTTTCTCTTCCAGGGTCTTGCTGTAGTCTTTAGAGGCGGTCATCCTTTCACTTTC
CTATGTTATTAAACTACATGCTTCCTGCAATTGATGTCAGGTTTCTCACAATGTGTATTC
ATAAGTATTCCTACTGCTTACCTATACATCTATCCCTGGGGAATAGTTGGACATTTCTGA
ACACTTGGCAATTTTTTTACAGCACCATTTTTCTTTACCTTGAAATAAAAATCTGAAAAG
CCCTTGTTAATTGAGCATCATGTGCTATTTTAGTATATCTTTAACCCAAAAAACGTCACT
AGTGCACTGGATATATCTAATCATTTGCCTTTCAGAATTTCCTAGAAAGAGATCCAAAAG
GCCAGTTAATTCAACGTTTACAAGGCACTTAACACCATTATTAATATCTTTTTTTTGTAA
TTACCACGGTTTATGACATTTTCTTTAAGGTGCGCCAAAACTGTAACACGTTTCACTTTC
ACTGACTCAGTCAGTTTTATTACAAAAGACTCACCCTCTTCATCAAGCAAGAATGGAATG
TGGTTTATTGATTAGGACTGCTGTGATTCTCGTTTTTAAGCAGATACTCTTTTCCTCATT
CATGAAACTCCATATTGTCCCTAAAGATTTTTTAAATTTTTCTTGACTCCAAATGAAAAA
AATCTCTACCAAACTAATACTGAATCCTTGATTTCTTCTTGGCTTTACTTTATATTCTTA
TCCAGCTGTCTTAAGACTTCTTGATGTACTGCTGATTTACATAAAATAGAACAAAATGAA
ACATACATCAGTTTAATTCATTCTACTGAAAAGTATTTTTGTAGTTTGCTAACATTTAGC
TTATCAGAGAGCTTTAACTTGTAATAATACTTAACAATAATAAGATGAGGGCTTATTGCC
TTAACTGAATATTATGTTGGGTGTTTGCCATATGTAATTCAGAGTGGATTTTTTTCTTTT
TTTTCCTGCATTTGAAAAAAGACATCACTTTTATGTTGTATTGATAGAATCTTGAAAACA
AAGTAATTTGCCTACAACAAGAATTTAAAAGGAATTTTATAAATGGCTTCTATCTGGCAT
TCATTCATTGAGCAAACTTGGATTGAGTACTTGCTTTGTGCCAGATGACTTACTGAGTGT
GAAGGCTACATGGGCCTCTGCCTTGGTGGAACTCACAGTTAGAAATACAATGTGATATGT
GCTAGAATAAAAGGATGTGCACATATACTGAGGGCTTGAATGAGGGAGTAGACGTTTCTG
CCTAAAACGGGTCAGGGAATGCACAGGAGGTGATGTCGTGCTGATATTAGAACAGGTTGA
AGTTTTCAGCTGGAATACATAGACTCTCAAGGCAAAGCAGTGGAGTAGAAAAGAACAGCA
CATGCAGAGAACATCAAATACTCTAGTATATGTAGACCATAGCAAGGAAGAATAGGCTGG
AGAGACAACCAGGCACCCTCTCTCGAGTGCCTGATAATATTCCAAGGTGAGGGATTTGAA
TTTCTCACATAGAAGTGTGGAACAATTAAGAAGATTTAGCATACTGAGATTTTGTTTTCA
TAAAAATAACTTCAAATTCTAGGAGATGGATTAAAGAAGATAGAGAATAATTTTACATAG
GGAGACTGATAATTGATTAAATAAAATTTGTAAGATTGCTGGAAGAGGGGGAGCAGGTTA
GGGGGGATGGGTACATGAGGGTGCCATTAAGCAGAATAGAGAATATAGGCGTAAGAGATT
TGTGCTCAAATTCCCAAGTTTTAAGAATAAGGCTGTAAATTAATTATGAATCTGTTGAGT
TTAAAGTTACTGTTCCGGATATCCAGATGGAACTACCCACTAGACAGTGGATATAATAAT
GTTACATGTCATAACAAAGTGCTTTTATCCCTTTTCATAAAAACTCAGTACTTGCATATG
GTGCCACTGGAGCTGGGAAGACCTACACAATGCTAGGATCAGCAGCTGAACCTGGAGTGA
TGTATCTGACGATGTTACACCTTTATAAATCCATGGATGAGATTAAAGGAGAGAAAGTAT
GTAGTATTGCAGTTTCTTATCTGGAGGTAAGCTAGTAATATCATTCTTTGGATTAATCAC
TAGTACTGAGAAATTTTTTTTTCTCTCTTTTTGTTTTTTTGAGGACGATTAGCTCTGATC
TAACATGTGCCACCAATCTTCCTCTTTTTGCTGAGGAAGAGTGGCCCTGAGCTAACATCC
ATGCCCATCTTCCTCTTTTTTATCTGGGACACCTGCCACAGCATGGCATGACAAGCAGTG
CGTAGGTCCACACCCGGCATCCGAACCAGTGAACCCCATAGGCCGCCAAAGTGGAACATG
CAAACTTAACTGCTGTGCCACCAGGCCAGCCCCCTGAGAAGTCTTTATTTAAATTGTTCC
ATGGGGGGCCAGCCTGGTGGCATAGTGGTTAAGTTTATGTGCTCCACTTCAGTGTCCTGG
GCTTTGTGGGTTTGCATCTTGGGCATGGATCTACACACTGCTCATCAAGCCATGCTGTGG
CGATGTCCCACATACAAAGTGGAGGAAGTTTGGCACAGGTGTTAGCTCACTGACAATCTT
CCTCACAAAAAAAAAAAGTTCCATGGTCCTTTTAATTTATTCTATCACACAGGAATTTTC
TCATGAATGTATAAAATCGTTAAAATTCCTGGTCTTAAGAATTTGTTATGCATCTTACAC
TTTTTCTAAGTATTTTATTTTGGCATAATTTTTCACTTATGAAAAGTAGCAAGGTTAGTA
CAAAGAACTTCCAGATACCCTTCACCAAGATTCTCCTTATGTTGACATTTTACTATCTTT
GCTTTCTCTCTGTATGTGTAGGTGTGTATTTCTTTTTTCTGAACTGTTTAAGTTACACAC
TTGTAAAAACAGGAAATTTTCTTAAATAACCACTGAATCATCAAAATCAGGAAATTAACA
GATACAACACTAATATCTTACTATAGACCTAATTAGATTTTGCTAGTTATTATAATAATA
CCCTTTATTGGAAAAAAAAATCTAAGATCATGAATTACATTCAACTGGCATATCTCTTTA
GTCTCTTTAGTCTGGAATTTTTTTTTCTTTCTTTGTATTTTATTTCATTGTCATAAAACC
CTTAGTTTGGGTTTGTCATGATTAGATTCAGGTTATGCCCTGGCAGGAACAGCAGAGAAG
TGATGTTGAGTTTTTCTTATGGCATCGTATCAAGAGGCTTTTGTGGTTAGGTAGTCCCAT
TACTAGCTGTGTTAACTCTGATCAATTTCATTATGCTGGTGTTTGCAAAGTTCTCCACTA
TAAAGATACTACTTTACCCTTATAATTAATAAGTGCCTTGTAAGGAGACAGTGTAAATAG
CCCTTTATTCCTCAAACTTTCATCTGTGAGTATTAGCGTCCACTGATGATTCATGCTTGA
AATGATTATGATGATGGTAGATAATAGTGATGTTTAAATTCTGTCATTTCTTTTACGTTT
ATTCGTTGACTTTCTACTGTGAGGAAGAGCTTTCCCTTTCCTTTATTGTATCAGTATGGA
CTTATGGATTCTTAACATTATTCAGTAGATCCCTTTCTGTAATTATTTGTATGCTCAAAT
TGTGCCAGATTTGATTAGTCGAGGCTCCTTCATGCTGTCTCTTGTGTCCTTTTGACATAC
CCCATCATTCTTTGAGGCCTCCTACCCTCTCAGTAATAGCTGACATTCAACAAATCATAA
CTAAGCAGCAGCCACTCTAAGTTTGTGTTCATATAATGTTTCAGAAACCAGTGCAGAAAC
ATAGATCTCTGTTTTTACTGCCTGTTCATTTGTGGCGTCAGAAAATTTTTGGTTGGGGCC
GGCCCAGTGGCGCAGCGGTTAAAGTGTGCACGTTCTGCTTCTCGGAGGCTTGGGGTTCGC
CACTTCAGCTCCTGGGTGCAGACATGGCACTGCTTGGCACGCCATGCTGTGGTAGGCGTC
CCACATATAAAGTAGAGGAAGATGGGCACAATGTTAGCTCAGGGCCAGGCTTCCTCAGCA
AAAAGAGGAGGACTGGCAGTAGTTAGCTCAGGGCTAATCTTACTCAAAAAAATAAATAAA
TAAATAAATAAAAAAGGAAAAAAAGGAAAATTTTTGGTAGTCACAGCTCTCTTATTGACA
TCATATAGTTTGGTCCTACTGAGAGAGTGTCTTCACATTTCAAAAATTGATTAGGGGCTG
GCCCTGTGGTGTAGTGAAATTTGACACGCTCCACTTTGATGGCCCCAGGCCCAGGTTTGT
GGGTTCGGTTGCTGGGTGTAGACCTACACCACTTATCAGCCATGCTGTGGTGGTAACCCA
CATATAAAACAGAGGAAGATTGGCAGGGACATTAGCTCAGGACTAGTCTTCCTCAAGCAA
GAAAAGAGGAAGATTGGGGCTGGCCCGGTGGTGTAGTGGTTAAGTTCCTGCACTCCGCAT
CGGCAGCATGGGGATTGCATAATCAGATCCTGGGCGCTGGCCTAGCACCACTTGTCAAGC
CACACTGTGGCAACATCCCACATAAAACAGAGGAAGATTGGCACAGATGTTAGCCCAGTA
ACAGTCTTCCTCAAGCAAAGAGAAGAAGATTGGCAACGGATGTTAGCTCAGGGCCAATCT
TCCTCAGAAAAAAAAAATTGATTAAAATTATGTATGTTGCTAAAAATTGTCAGTCTACCA
AACTCGGAGATAAAAGAGAAGTAAAAGTCATTTTCTCTAGTTAAGTTTTGAAAAGAATTG
TTTTGAACCTAATTAGGAAAAGAGCATTGCAATATTCATTATTCCTCCCTTAGTTCCCTT
TATAACTTGGAAAATTTTGAAATTTGGTTATTTTTGTAATGTTTTTAATTGTTTTTCCTT
TCTTTTAATTTGCTTTCCTTTGATTAATGGTAAAGCAGTGTCTAATCTAATGGTTTTTCA
CTCAGGCTGTGCAGCAGTATTGGCTATGGAGCTTTTTAAAAATAGACATGCCTAGTCCTC
ACTCCTGGACATTTTAATATAATAGGTCTGGATTGTGGCTGAGGCATCTATGTTTTTTAA
AAAGCTCCCAGGTGATTCTGATGCGTAGACCAGCTTGAGGGTGATTGTTCTAATTGTATA
TTGTGTATGATTCAAGTGGGTGAGGGGAAGCATAAGAAAAGTGACTGGTGCTTATCAGAA
AAATAAGAACCAAAAAATTATCTCTTCATATTATCACTTTACTACTTTTAAGAGTTTATT
ACATTTAAAAATGGTTATATCATTCATTGTAGGAAATTTTACCAGCAATGAATTATCACT
ATGGGCTATTCGTTGGAAGATGGAAATAATTTACACAAAATAAATTCTTAAAGACTTAAT
TTTGTATTTTTTTTAAATCTTAGTAATAGGTGTAATTGTCATTTCGTTGGCAAGTAGAAA
ACTTAGTACATTCAATAAATTCATAAAATCAGGTCAGTAGTGCTATTTCTGTGCATTACT
TACAGAAATGAGTAAGAAAAACTTGCCAGAGATATAGAATACAGGGGTGTCCTCAGTGCC
ACGCAGTAGCGTGAGGAGATCTAGGCTCCAGTCCTACTCTGCTGTCGCCCTCGTGACCAT
GGACGGACCACTTAGCCTCTGATGGCAAAGTCAGTGGGGGCAGGGTATTCCGTGGGGAAA
TTTATCACTAAGAATTGGATGTTAAACTTAAGGTAATTGAAGGATAAGTAAAATAAATAT
CATCCATCCTTGAATATGGGTTTTCTTTAATTTTTAATTTTAATTTCTTTTAATTTTTAA
ATTTTAAAATTTAAAATGGACAATTTAGGTATCATGAAATAATAAATATGAAGATTTATT
TGTTATAAGATTATAAGCAAGCACCACGCCACCTCTCTATAACTTATATTTCAGATCCTT
TAGAATTTCCCAAGACCATGTGTCATGTGTAGTTCCAGGAAATAGGAAAAGGCGACTCCA
GCTATCTTATTTCTGTTTCATTATAGTCATCAAGTTAGGAATTATGGGGTCAGGGTATAA
TGACTCCACTTTTAAATTTCGGTTTCAAACCTAGGTAGTCGAATTCTTCGTTTTCTCAGA
TGGTAGAAGATTAATGGCAATGTGAGATAGAAGGGGTGAGATGACTGAAAATGAGCCGCT
GCTTGTCTCTATGATAAAATTCTAACATAACCTTAAATCAGCAATGTGTGCATGGGTGCG
ATGTTACCACTGTTGTTTCAACATCAGTGCTAAAGCACTCTTTTTTATTTCAAGGTATAT
AATGAACAGATTCGTGACCTCTTAGTAAATTCAGGGCCACTTGCTGTCCGGGAAGATGCC
CAAAAAGGGGTAGTCGTTCAGGGGTTGACTTTACATCAGGTATGTTTATAACTCCTTTTT
CCCTTGCCTGAATAGCACGTGTGGTTATTTAGCCATTGACTTATTTTCCATTGTATCTGA
GAAAGAATAAAAATTATAAACTGCAGAGTTAAAATAATCAGGGTATATCTTCAGTCTTAT
TTTGTTTTCCTTTGAAATAATTGAATGAGCTTTTCTTTTAAAAAATCTACTGGAACATTT
AATATTGTGTATTATTCTGCTTATGCATCTATATTTTACTTCCTCAGAGAGACAAGATTT
TATCTTTTATTCCTCATAAAACACCAAAGTACTAAGCAAATGATACACAGTCCATGTTAA
ATGGGATTTAATTTAGAGAAAGCATTTTCTTACCCTTCATTTTACCTTTAAAAGTCTTCT
TTCTTGTTGAAAGTTTATTAAAAAATTTAAGGATAGATGGCTAATTTGTATATTTTTCTT
CTACTTAAACTTTTCCAGCCCAAATCCTCAGAGGAAATTTTACAGTTATTGGATAATGGA
AATAAAAACAGGACACAACATCCCACTGATATGAATGCTTCATCTTCTCGTTCTCATGCT
GTTTTCCAGGTAACAGGCCCCTAGACTATTGCTGTTAAAATTGAATTTAAAATAAATGAA
GACAAATTCATGGATGGTAATTTTCATAGATACCCCCAAAAAAATCTCTTCGTCTGCCAA
CTTCTCTGCTTCTCACCACTTCATTTACCTGCAGCTTTGAGAAGATTCTATCAAGAATAC
TTAGAATTGAGATGATGTAAATCAGAAATGTAAATTTTTACCTCTGTGAAGATATAGGAT
AGTAAAGTGGTAGTGTTAGAGGGTTTTTCTCTTTTTTTTTTTTTTACTCTTTTTTTAAGC
TGGTGAAAATATTTAACCTTTGCAAAGATAACCTTTCTTTGTGGGGGAGTGAGAGACTGG
CCCTGACCTAACATCTGTTGCCAATATTCCTCTTATTTCTTGAGGGAGATTATCACTGAG
CTAATATCTGTGGCGTTCTTCCTCTGGTTTGTATGTCGGATGCCACAACAGCATGGCTTG
ATGAGCGAGACGTAGGTCCACACCCGGGATCTGAACCTGTGAACCTCGGGCCGCCAAAGC
AGAGTGGGCAAACTTAACCACTACACCACTGGGCCAGCCCCCCCCAAAGATAATCATATA
TCAGAGCAAACTTGATAGATCTGTATTTATAGAACCAATAAATTGGGGAGATATCGATTC
ACTTTTAAAAGAAAGAACTAAAGCATAGGTTAGTAGCTGTTATTTCTTTTAGTTTTTAGT
CCTGTTAAAATCCAAATGATTATATACTTCATTCTAGATTATGCTATGTGGTACTCATTT
TATGGAAAAGACTTGTTATAGTGGAAAGAATTTGTATCTGAGGCCATCAAGTCATTCAGA
AAGTCTCTAGTCCAGAAAATGTTATTCATGTCATCTGTTCTTACCACTGACTTCATTCAT
CAGTAGTCTTGAGAGAAATGTTTATCTGAGACACTGAGATTTCTACAAAATGTCTTAGAC
CCTGCTTGATAAGAAAATTTAACAAAATGGTTTTATAGTGGAATAATAGCTGACCTTCCC
CATCTCTTTATGTTTGCCACCTAATTTATTTCTTAACTGAAGTTAAACTACAAAGTAGCT
TAAAATAGTTTAATAAATTATGCTTTGCTCTAGTGGGCCATTGGACATGACAAGTATACT
TTACTATCTTTTTTATGTGTGATATCTTCTTAATTATAATGACATAGAACAATTTTGGGA
ATTGGAACAAATGTACTCTTCAATTTGGATCAACATTCAAATTCAGCTTTCCTTTGGAAA
CAGATCCTGGAGATGTGCAAAACATTCTGTCCACTGCCTTTGGTTTTCTCTTAGGAACAT
TATTTCTGGAGGACCTGTGCCACCACCACCACCTCAAATAATTCTCTGTTCTGGTTCAAG
GGTTACCAGAATGCAAATGGCAGTTGTTTTGACCTTCTATCAGGCTAAGAGTTATTTGCC
CTCTGTACACATATAGAACATCTTTTCATTTTCAACTTTGGCTTATTACTTCTAGTACTC
TTGGGTATCAGCCAGTCAGATTGTACCTTGTTTGGTTTGTTTTTAAAATGAAAATAATTT
TGATTTCATGCTCTTAAAAATAAAGTATATGTTGCCTTTTTAATTTTGTTCAATCTTATC
CTCATTTTCTCTATTCTCCTATGATTTCAAAAAGATTTATTTGCGACAACAAGACAAAAC
AGCAAGTATCAGTCAAAATGTCCGAATTGCCAAGATGTCACTCATTGATCTGGCAGGGTC
TGAGAGAGCCAGTACTACAAGTGCTCAAGGGATCCGGTTTATAGAAGGCACAAATATTAA
TCGATCACTTTTAGCTCTTGGGAATGTCATCAATGCTTTAGCAGATACAAAGGTAGGTAC
TATATGTTTATTTGTTTAAACATTTTGAACTATGTATAATTCCTAGAAAGATACTACTTA
ATATGTAATTTTGTTTTAAAGGTCTATTATAAATCAGACTTTAAAAGTATGTTAATAATG
TTTATATACAGAACAAAGACCTCAGAGAGGCTAGCATATCAAATAAAGCTATGGTTTTGT
ATTTTTTTTAATTTCTAGTTTAATAATCAGAATTTGTTTAATGAAAATTATTGAATATAA
GATTGATAGTTAATATTTTATGGTACTTTCTCATCACTTAATTTGAACTTGATTTTTAAA
ATGACCATTTAATGATCACTGCACAGCAAGCATGATAATTAAATTGGCATGAAGACAAAA
ATCACCTTATAGAAAAACTAACCTCTGTTCTGGTTAGTATCTTATATACTGTAAAATGTT
GTTAGATGATTAAAGAATGTTGATTTTTCTTAGGAAGAAGGGCTTGAGATATAAAATATA
ATTAAATCACCTAATAGGATGATGTTTGCTTATGCCTTTGGGGCATTTAAAGATATTTTA
CATCTGTATTCCAGAAGTGCTTCCTAGAGTATGACTTCCTTTTTTAAAAGTTAAAATATG
ATCATTTAATTTAAGTTCAAACCAGGCTCAAAAGCTTTAGGGAAATTACTATTAAACTCT
TCCAAATGTTGCATTTTGATTTAGTATGAAGTATGCTGAAATGATTTAAGGAGCCTTTTT
TTTTAAAAAGGCAAGTTACTAAAATCACATGAAGATTGCAAAACCAAGATGTCTTTCATA
TTCTAAGTTAAAATCTCAAATATGTAAGTAGACAGCATGGTATAGAGACTGATTTTCTAA
ATTTAAGCCATTCATAGCATTTTTTGCGTGCCAACTTAATTTTTAACAGCTGACTTCTAT
TGAGTCATTTATGAGTCAGTGGTTAATGCATGTCTTATACATGTAAAGTCATTTCAAGTA
GCACCAGCAGTGCACATTCCACTCTGTTTGGGAAAGACTGCTATGGTGGAAATCACAGTA
CTACTGGGAGTTGAAACCTAGTGCCCATTTCTGGCTCTGTGAATTCCCAGCCATGTGACC
TGAGGCAAGTCATTTCACTTGTTGATTAGCTTCATTTTCCTCTTCTGTAATATGATTTAC
ACTGGATAGCATAAAGTTGCTTTCCGGTTAACATTATAAAGCTCTGTTTTATGTATAAGT
TGTACTTTTTGGAAAATTTGTTACTTTAAAATCAGAACTGTATCTTTTAAGTAAAAGAAA
ACCTAGAAAAATTAAGTTCTCCTAGAACTGTAGTGTGCTTTCAGGTGAAGTATCTGTAAG
ATTGTAATTATAATTTATTTTGTATCCATGTTAGAGGATTATTTAACAAGAGAAGTAGCT
CTGTGTCATACAGAATTCTTATTATTCTGCTAGTATGTTTGTATAGGGCATGTATTACAT
TTGTATTTTAATTTATTTTAAATAATGAATGGAGATTTTTTAAATAGACGTTTTGTTTTT
GAATAGTTTTAGATACAGAAAAGTTGCTAAGATAATACAGAAAGATTTTGTTAAATATAC
TTTCCACTCAGTTTCCCCTCTTGTTAACATGACACATTAATATGGTACGCTTATCACAAC
TAGTGAACCAATAGTGATTTTTTTATTAGCTAAAATTAATACTAATTCAAATGGAGATAT
AATCTTTAAATAGGATATTTGTTTGGTATATTCACTGAATAGTCCTGTAAAATTCATTAT
CATCATTTCGATCACCAGTTTTATCATAAATCTGGGCAAAGTTGGGCAATGCTCAAATTC
TTATAGTGAAGTGGTAGCAGGTTTGCATGTAAATGTGGAAAATGACATAAGAATTCTCTT
TTTGTTCTTTCAGAGAAAGAATCAGCATATTCCTTACAGAAATAGTAAGCTGACTCGCTT
GTTAAAGGACTCTTTTGGAGGAAACTGTCAAACTATAATGATAGCTGCTGTTAGTCCCTC
CTCTGTGTTCCACGATGACACATATAACACTCTTAAGTATGCTAATCGTGCAAAGAACAT
TAAATCTTCTGTAAGTGTGTTTACTCTGCTTTTGTTGTAAGGGCAGTGAGTGCATATTAT
TTTTATAAATCTAATAAAATATTAGAGTTGTGTTTCTACTAATGAGTTAGGAAACAGGGT
TAGAAATATCTTTTCTAACCTGGTTAATTGAACATTAACTTAGACAAATTATTAACCATC
CTGATTACACATATAATAGATACTATTATTTAGTCTTTTGGGAGCTAGGATGCTTTAGTG
CCTTTCTTTCTGCCCTTTTTCACATCATGGCACGTGATGTTTTGATGGCACCCTGGAGTC
ATTGATTAAGGCTTTAACTCCTTTGTTGCAGCCAAGGATGATGCTCTACTTTAGCCCAGC
ACCAGCACTTTCTACCTGAAAACCATGGGCATGTTAGCTAATGTTTCCAAGCCTCCATTA
CTTCATCTGTAAAATATGTAATATTTGCCTCAGTTTATAAAGTCAGTAAACTTTTTAAAT
AATTTATTTCCACATTCATGATACTGATCTGTGTAGCTTCAACAATATAATAATGATTGG
TTAGATATGTATTTTTACCAGTATTTTGGGGTAATTTAAAAAGATGTAAGTCATACATGA
TGTATGTTTATAATCACAGGATCTCAGGGTTAGAAGAGCCCTAAAGTTCAACTGGCATGA
TTCCATCTCCTCCTGCTTACCTTCTGCTACTCCTTTTGTATGAAGATGAGCGGGTTATCG
TCTTCCTTAGAGAAATGTTCATGTACTATTTATGACTAATTGGGAACGTTTGTACTATAT
GAATATACAGAGGTTTTTCACATACATGTTTTAGGTAATCCTTACACCAGCGCTTTGAGG
AAGGCATTTTTAGCTCTACTTCACAGTTGAGGAATCCCGTGCTCATAGTTTTAGGTACCA
AATTCTAAGTCAGTTAAGTGAGAAGTGGGCAGGGCCTTGAAATCGAGTGTTTGGGCTTAC
ATCTCTGAACTTCTTAGAAGCCAGAGGAAAAAGAAAGTGGGCAATTTTTATTATATTGTG
AATGAATGCTTTGCAAGTTCTTAAAAGTACCTTTGCTCAGATGGTAAAGCAATTTCTTTA
TAATTTCATTTGCATTATTATGTTCAGCATGTTCTCTTGTCATAGATTTTAAACATGGGC
ATAATTGATCGTAACTTTCATGTGATCGTAGTTGTCATAAATTTTGAGTTCATGGAACTG
AATTAATGAGGATATAATGCCATTTTGCTTGTGTATAACGGCTTATTACCTCTCTCTATA
TATGCAATCGTAATTTCTATCTTTTAACAGTTGAAGAGCAATGTTCTTAACCTCGACAAT
CATATAACTCAGTACGTAAAGATCTGTAATGAGCAGAAGCAAGAGGTATGTCGACTCTTT
ACGTTGTTCTGCTGATCTCCCTCAGTTCCTGATTTGTGGGATTCTGCAATCCTAATCATC
TAGAAATTTGACATGTTTTCCTATTACCATTGAATTCTGATTTGTTCAGTTATTTTTCAC
AGATAAAATTTTGCTGTGGTCATGTATAATGGAGACAAATAATTTGTTTTGTATTTTAAC
TAGTGTTTCTCTCTACTAGATTTTAATGTTAAAAGAAAAACTAAAAGCCTATGAAGAACA
GAAAGCCTTTACTCATGAAAATAACAAAGCAAAGTTAATGATTTCAAACCCTCAGGAAAA
AGAAATTAAAAGGTAAAAATGACATTAAGATCGCATTTTGAGGATTTCATAGTTTTAAAA
TTTAGTCATATAGTTTATGTTATCATCATCATTTGTTGTATAAGTATGTCTTTATATATA
TACTCAACTGAGTTCGAAAAGTCACTGATTACTCTTTCTATTGCCCATTTTGGAGATCAA
ATGATTTTAGTTGTGATTATACAGATAGTAAGCAGAACCAGGAGTTAGGTGTAAGAGGAC
AAGATAAAGCCAATTATGTCACTTATGAAATTAGGTTTTAGCGGTTTTCATATTTTTTCC
TCTGGCGTCTTAGTCCATTCAGTCTGCTATAACAAAATATCACAGACCAGGGAGCTTATA
AACAAAAAACCTTTCTTTCTCACAATTCTGGCAGCTGGAATTCCAAGCAGGATGCCAGCA
TGGTTGGGTGAGGGTCTTCTTCTGGGTTGTAGACTTCTTGAATCCTCGCGTGGTGAAAGG
AGAGGAAGATGTTTCTGGAGCCTGTTTGAAAACGGCACTATTCCCATCCATGGGGTCTCT
GCCCTTAAGACCTGATGACCTTCCAAGGGCCCCACCTCCTTACAACATCACCTTGGGTGT
TATATTTCAACATATGAATTTGGGGTTACACAAACATTCAGGTGCTAGCATCTGGCATTA
TCATTATTTGTATAGTTCATGTAAATCTTACCTACCCTTTCTTGACTCTACGCAACTCTA
ATAAGCCTCTTATTGAGTTAAGCGGTTAATTATTTGAATGAATGTCTCTCAGTGATATAA
ATTGATACAGAATTTTGATAGGTTCCCACTAAGCTTCTTAGCAGGTAAATTTGAAAAAAA
AAAAAAAAGGCTATTAATAGTACAGTACTCACAAGTACTTTTTCCCTAAGCAATTAGGGC
AATTTTTCAAGTTGTCCCCATGGGACACTAGTTCAAAAGCTGTGAATCTTGAGTAGTTGT
AAGAAGACAGCAAGGAATTCCTGGATCAAAGTTCAGAAATTACTCTTTACTTAAGGAATC
CAAGAGATTTCCAAAGTACATCAGAATGTTCAAACCTCTGAGAGGCCCTGTAATAAAGGA
ATCTGGTCAACTTTGATAAAACTGAGTAAAGTTAAACTTACTTCACATTCTCCAGAGCCG
ATTTTCTGTTATCATTAGTACAAGAAACTAACCACAACTTACAATGGTGGTTATTCACAC
TGCTTTGGTACTCAAGAGTTTGTAGAAGATATCACGGTGTACATAAGGAAGACTAGTTAA
GTGACTTTCAACCATAGTTTTGTAGTTTTTCATTATTTTTAGGCCCATTTTAGTTTCCTC
TGATCATTACAACCTTTTGAAGTTTGAAGTGGGGTATTGTTTTCTTACTTACACGTAAGA
TCAAGAACTATAAATCATCTCTTTCAAATCTTAATCCTTTTGCTCTCATACTATGCTCTT
TTACAGATAATAAGTAATTAAATGGTTATTTTTCTCATAATGACAATGAACCAGTTTTTC
ATATAGCATAAAGTTGACCTATATATTGGTATCATACAAGAGCTCTGTTTATACTGGAGA
TTTTCTGAAGTGTTTATTTTGTTAATCCCCCTAGCAACCTGTTGTCAAGATAAATTTGTT
GTATTTTGTTAGTCTTATGATGCTTTTTGTTATATCCCACCAACTTCATAGTGTCTTTTA
AAAAATAAGTAGAAGTGGTTCGTCATTATTCATTTAGTCTTATCAAAGGAAGCGTTTAAC
TCTGATATACTATTAGTAGTAGTTGTTTCATTTTGTTAGTTGTGGGATTGGGCCTCATGA
AACCAGATATCTCTTTGATGATGCAAGTTTCTTGAAAATTAAAGAAGTCAGCAATTGCTC
AAATTTGGAGTCATCGCTTGCGTGGAATTGCTCAGCACTACTTAACTAGATCTGGTTACC
AATTAAAGCCTTAGAAATTAGTAGACTTCTCTGTGGTTGATGGTTTTAAATCATTGAATC
TTTCCTTCTAGTAAAATGATTTAGGAGGGAGAGGGCCTGACCTATGAAATAAGCATTTAT
GTGGGTATTTTTCACATTTCAACATGTCTTAACCAACAGTGGTAACTTTAAGTTTTAATT
TGTGCAACATGTTAAATAATTTACTAGTATTTATAAAGAAGGTAATGGTAAAATTATATA
CCCCATGGCCTTTGTCATTTTTCCTCAAAAGTAGCTGTCTCCTGAAAGAAATGCCTTTTG
TCATTCAATCATACTGTTACATAGAATTTTTAATGCCATAAATTTTCAAAATGTCTTTAA
AAAAATTTTTATGAAATTTAAACAGATAAAGGGAAGAATATACAGTATTTGCTGTCTATC
AAAGCTATTTGGAAAGATGATTTTCAAAAAAGTCATAAGAGGAAAGTACAAATGTTCTGT
ATACAGAGGAATTATAAAACTTCACTTGTGGCTATACCAAGAAAATTGCATGGAGCTTAA
TATTCATCATGTAGCACCTAAAATTATTGGCAAAGATTTTTGTTTTCTACTTACTTGAAT
GTTTTAAATGACTAGAAAGTCGTTATTAGTCCCTTAGAACTCTGTTTTAAAATGATAGTT
TTTTATAAAAGGAGCTCTCTAGAAACCTTGATACTAATTACCTTTCATTCTGAACACTAA
ACACCACCAACCAGTTAAGTCTAGACCACAAAATTAAGAAATTGTCAAATATTGAACCAT
GTTCTTGGGTAAAATATCACAGAAAAACTAAGAAATTATCTTTGGGTATAACCTAAAGAT
AACTTATCAATTCATTTACTGGCATTAGCATTGTTGTAATATAATACAGTGAAATTGCAA
TGTCCGTACATACTTCCTATGAAATATTTATCAGTTTGACAAAACTGCAGTAAAGTCGAT
GTATTGTGGTTTATATTCACTCCCAATAGAGTTTCATTAAGAACTACTGACGTAAATTGG
CAGTGTTTTTACCACAGATCCTTACAAATATAGCTAAAATTCTGGCCAAAGAACATTTAT
TTTTAAATGTATATACTTTCTTACAGTTTTATTTTAAAGGCTTCACAGTTCATTTTTCTT
TGAGAGCTTTGCCGTATGTGACTGTTTATACTGTTACTGTAAACTCCGACCTGAGCTATG
ACTTAGAATCGTAAGAATATTTTTATAAAATTAGTATATTACTGTGGCTGATGTTCTGCT
CACCCTGGAGGATGCAGGATTGCAGGTCCTTTTAGGGCTTTCATAGGTATTATTCAACTT
GTGGTCTTTGTGATTGGGAGGAGATGAGAGTCAGACTCCCCAACTCTCATTCTCTAAATC
TATAATGCCCTTTGGAGGAAACACACTGGAGTGGCTTTTCGAGGTTTACCATGCTGTAAA
CTTGGATGTTTTGGGTTCTAGCAGTGTCAGGCGACTCTTAGCCAGGCTGTAGGAGGTACC
TAACCATATGCTATGTTTCAGTATAACAAATTCTGAAGCAAAGAACTGGCTATCTCACCT
TCCCAGGGGCCATGGAGGCACCATGTGATCATGCCACCCACTGCTTATTTCTTCACAGTG
AGGCAGCACCAAAACAACACATAATACAGTGCTGCTTCTGGGGCCTTGTGAATTGGCATA
GTATAGGTCCAGATTCTCATCCTTTTCCTACAAACAAAACGTTTTTTCATTTTTTGCTAA
ATAGCTAGATTACATAGACAAAATACAGTCTGTGACTAATACCAGAGGCCTTATAATACC
TGTATCTCTTAACAACATGATCTTTCTTGGAGGAGAGAGAAAGAGAAGGGGAACCCAGTG
TAGTGAAAGTAAAGTTAACAACCCTTTCCAAACATTTTTGTAATTTAATAGGAAAAACAG
TCACTCTAACCTATTTGCTGTTTATCCTTGAGTCTAATGCTATAAATGGTATATATCCTT
TTGTTCATGCGTTTCTTTAAGTAAACTTTGTATCGTCTATCAAAAAATTAGTGAGATTCT
ATAATGTGTTTTATTTTTGGTAGATTTCAAGAAATTCTGAACTGCTTGTTCCAGAATCGA
GAAGAAATCAGACAAGAATATCTGAAGTTGGAAATGTTACTCAAGGAAAATGAACTTAAG
TCATTCTATCAACAACAGTACCATAAGCAAATAGAAATGATGTGTTCTGAAGACAAAGTA
GAAAAGGTATTTAACAACTTTATAATTAAATTTTAGAGAATGTAAAAACATGGGGACTTC
TAATTCTAGAAATTGGATAGGCATTGTTACTAAATCACCTGTTCTCTACAAACACCTGGA
AATGCTGGAGGAAATGTAGCAAACATTGTTTTAAATGCATACATAAGTCTTCACGAAAGA
AAATTAAATTCCTAGGTTTCAGAAACGAAAAGAAAACCAAAGAAACAAAATCTAAGTTGC
AAGATTCTGTTGCTTTTCTGAGGGTTGATGAAATGCTTAACATGAAGTTAACACATTCAG
CAAATGTTGGGTACCAAAGGTGGGGCAGTGGGAGCAGTCCACCCCAGATGCACACACATC
TTAGACCAATAGATTTTTTTTTTTTTTCCAGGGGAGAATATTTTATCACTGACATTACCA
GAATTTCCATTGCATGGTGCTAAAACAAAGCAGAGCAACTTTTAGTCAATCTTATTATTT
AATGCAGTAGTGCCCTGCCCTTCCCCCTCCACACACACAGACCACTCACACTAGCCTGCC
TTTGATGTACACCAGCAGTGTATGAGACTTCCATTTTCTCCGCATCCTCTCCAACACTTG
CTATTTCTTGTCTTGTTAATTACAACCATTGTGACAAGCATGAGGTGATATCTCGTAGTT
TTGATTTTCGTTTCCCTAATAATTAGTGATGTTGAACATCTTTTCATGTGCCTGTTGACT
ATCTGTATGTCTTCCTTGGAAAAATATCTGTTCAGACCCTTTGCCCAATTTTCGATTGGG
TTGTTTGTTTTTTTGTTGTTGACTTGTATGAGTTCTTTATGTATTTTGGATATTAACCCC
TTATCAGATATATGATTTGCAAATACCTTCTCCCGATTGTTAGGTTGTCTTTTCATTTTG
TTGATGGTTTCCTTTGCTGTGCAGAAGCTTTTTAGTCTGATGTAGTGCCATGTGTTTATT
TTCTCTTTTGTTTCCCTTGCCTGGAGAGATAATGGCTTTCAAAGTGATACTGCTAGGGGC
CAGCCAAGGTGGCCTAGTGGTTAAGCTCAGCATGCTCCACTTTGGCAGCCTGGGTTCAGT
TCCTGGGTATAGACCTACACCAGTCATCTATTAGCGGCCATGCTGTGGTGGCAGCTCACA
TACAAAAGAGGAAGATAGGCAGCGGATGTTAGCTCAGGCACATCTTCCTCAGCAAAAACA
GAAGAAAAAATACTGTTAAGACTAATGTCAAAGAGCATACTGCCTATGTTTTCTTCTAGG
AGTTTTATGGCTTCGGGTCTTATACTCAAGTCTTCAATCCATTTTGAGTTAATTTTTGTG
TATGATATAAGAGAGTGGTCTACTTTTAATTCTTTTGCACATGGCTGGCCAGCTCTCCCA
AAACCATTTATCAAAGAGACTTTCTTTTCTCCATTGTGTGTTCTTGGCTCCTTTATCAAA
ACTTAGCTATCCATATATGGGTGGCTTTATTTCTGGGCTCTTGATTCAGGTCCATTGATC
TCTGTGTCTGTTTCTGTGCCAGCACCATGCTGTTTTGGTTACTATAGCTTTGTAGTATAT
TTTGAAGTCAGGGAGTGTGATGCCTCCAGCTTTGTTTGTTTTTCTCAAGATTGCTTTGGC
TATTTGGGGTCTTTTGTTGTTCCGTATAAATTTTAGGATTCTTTGTTTTATTTCCATGAA
AAATGTTGTTGAGACTTTGATAGGGATTGCATTGAATTTGGAGATTGCTTTAGGGAGAAT
GGACATTTTAACTATGTTAATTCTTCCAGTCCATGAGCATGGAATATCTTTCCACTTGTT
TGAGTCTTCTTCGATTTCTTTCAACAATATTTTATTGTTTGCAGTGTATAGGGCTTTCAC
GTCTTTTGTTAAATTTATTCCTAGGTATTCTTTTAGTTCCAATTGTACAGGTTATTGTAT
TCTTAATTTCTCTTTCTGGTATTTCATTGTTAGTGTACAGAAACACAACTGATTTTGGTT
TGTTGATTTTGTACCCTGCAACTTTACTGTATTCACTTATCATTTCTAATAGTTTTTTGG
TGGATTCTTTAGAGTTTTCTTATATAAAATCATGTCACCTGCAAATAATGACAGTTTTGC
TCCTTCCTTACAAGGGAGATTCCCTTTATTTCTTTTTCTTGCCTGATTGTTCTGAGTAGG
ACTTCTAGTACTATGTTAAATAAGAGTGGTGACAGTGGGCATCTTTGTCTGGTTCCTGTT
CTTAGAGGGATAGCTTTCGGTTTCTCACCTTTAAGTATGATGGTAGCTGTGGATTTGTCA
TATATGGGCTTTATGATGTTGAGGTACTTTCCCTCTGTACCCATTTTATTCAGATTTTTT
GTCATAAGTGGATGCTGTATCTTGCCAAATGCTTTCTCTCCATCTATTGAGATGATCATG
TGACTTATATTCTTCATTTTGTTAATTTGGTATTACATGTTAATTTGTGGGTGTTGAACC
ATCCCTATATCCTGGAATAAATCCCACTTGATCATAGTGTATGATCTTTTTAATGTATTG
TTATATTCAATTTACTATTTTTTTACTTGCTCTTTTGCTATTTTTGAAGGATTTGCTAGT
ATTTTGTTGAGGATTTTTGCATCAATGTTCATCAGTGATGTTGGCCTGTAATTTTCTTTT
TTTGTGTTGTCCTTGTCTGGTTTTGGTATCGGGGTAATGTTGACCCCAAGAATGTCAGGA
AGCCTCCCCTCCTCTTCATGTTTTTGTAAGAGTTTGAGAAGGAAAGATGTTAAGTTTTCT
TCGAATGTTTGGTAGAATTTAATGGGGGAGCCGTTTGGTCCTGGAGTTTTGTTTTTTGGG
AGGTTTTTTGATTACCATTTTGATCTCCTTACTAGTCATTGGTCTATTCAGATTTTCTGT
TTCTTCTTGATCCATGATGCTTCATACTATCTTTATAGATGGTTGATCCACTACCTTTAC
TGTATATTTGCCTTTACCAGGGATGATTTTCTTCTTTGATTATTTTCTTATTCCTGTTTG
TGGTCTTTTCTTTTCCAGTTAAATAAGTCCCTTTAACATTTCTCATAAGGCTGGTTTAGT
GGTAATAAACTTCTGTAGTTTTTGCTTGTCTGGAAAACTCTTTCTCTCTCCTTCCATTCT
AAATGATAAAAATTCTGAGGAGAGTATTCTTGGCTGTAGGTTTTTTCCTTTTAGCACAGT
GAATATATCGTGCCATTCCCTTCTAGCCTGTCAGGTTTCTGCTGAGAGGTCAATTGATAG
TGTTATGGGATTTCCTTTGTATGTAACTTGTTGCCTTTTGCCTGCAATTTAGGATTCTCT
CTTTATCTTCAATTCTTGACATTTTACTTATAATGTGTCTTTGGATTTATCTTGTTTGGT
GCTCTCTGTGCTTCCTAGATGTGTGTTTCCCTCCTCAGGTTAGGGAAGTTTTCAGTTATT
ATTTCTTCAAATAGGTTCTCTGCCCCTTTGTCTCTCTCTTCTCCTTCTGGGACACCTATA
ATACAGATGTTAGTCTGCTTGATGTTGTCCCAGAAGTCCCTTAAACTGTCCTTGTTCTCT
TTAATTCTTTTTTCTGTTCAGCTTGGGTGATTTCCTCTACTCTTTCATCCAGATCACTCA
TCTGTTCTCTGTCATCTACAATGCTATTGATTCTCTCTAGCGAATTTTTCATTTCCATTA
TTGTGTTCTTCATTTCTGATTGGTTCTTTTTTTTATTTTCCAATTCTTCGTTCAAGTTCT
CACTGTTCATTTGTTCTTCTTCCGAGATCAGTGAGCACCCTTATGACTATTAGTTTGTGC
TCTTTATCAGGTAGATTGTTTATCTCTGTTTCATTTAGTTTTTTTCTGAGGATTTGTCCC
ATTCCCTTATTTGGAATATAATTCCTTTGTCTCCTCATTTTGCCTACTTCTCTGTGCTTA
TATCTATGTATTAGGTAGATCATCTAGTCTCCGATCTTGGAAATGTGGCCTTATATAAGT
GATGCCTTATGGGGCCCAGAAATGTGCTTCTGTCTTGTCACCAATGCCAGATGTTCCAGG
AATGTCCCCTGTATGGGCTACATGTGCCCTTCTGTTGTGGCAAGGTTGCTCTTGCTGTTG
GTGCACAGACAGGTTAGACTAGACTGGCCCCCCAGGCTGGCCGGTTGTAAGGCTCAGTTG
TGGTGGCTGCTACGATTGCTTTATTGGGTGGGGCAAGCCCCAGGATGGCTAGCTGTGAAG
TCTAATAGTTCACAACTACTGCTGTTTTGCTGTTAAGTGAGTCAGGCCACCAGTGTATCT
GGTTGCTATGCTTAAAGGCCCACAGTTGCCATAGGTCTCCGGCGAGGCTCTCTGCAATGT
GCAGCTGTCGTTGACCCTCTAGAATGCAGATGGGTAGAGCCACTCAACCCACACTGCAGA
GATCCCACAACCCTGCCTGTGGTGGCCCACAAGTTTGCCACGGGCTTGCTGGTGGGCAGG
GCCAGTCCCTCTAGCAGGCTGCCTGCCCTGGCTGAGCTGGACTGAATTGGTGCTTTAGTG
GGCAGGGCAGACCCCTATGTGACAGGCCAGAGGAAGGTCTCAAATGGCTCTGTCAGCAGC
CCTGTCAGTGTGGCTGAGCTAGGTCATGGTAATGGCTCCTGCTTGTGTCTCAGTCTTTGC
AGGGGTGGGCTCAGCCACCTACTGCTCTCTGAGATGTGCTCAGAGCTTAGCAAGTGAGTC
TGTTTTACCAATGGACCATGCACCTTTGTTTCTGGTGTGTTTTTATGTTGGTTTCCAGAA
GGAATGAATCTGTGCAGGGGTAATAGGCTTTTCTTTCTCTGAAGCTTGATAGTTTTTCTG
GGCATATTCCTGGTTGATTTTCAAAGCCAGCCAAGCCAGGTATTATGGGATCTTGTCTTG
ATTGTGCTGAATCTAAAGGCTGGAATGCTTGTTGTGGCATACATCCCCTGCTCAGATTCC
ACCTGCTCCTCGGGGAAAAGCTTCATTCCTTTAAGATTGCCCTGGCTGTGAAACACCCCA
GCTAGGATGTGGTGTTTTCCTCAGCAGAGGTGTATTTCTGCCTCCTTCACCCCTGTCAGT
GCTGTCCCTTGTTGTGGAGGTTCTTTTTACCCAGTTTCCAGATCTCTCTCAGAGGAAATT
GTTCCACAGGTCCTTGTAGGTTTGTTGTGTCTGCAGGAGGAGGTGAGTTCAGAGTCCTCC
TATGCCTCCATCTTCCCAGAATCACCTCCCTGTGCTTTTTTGCATGTTAGATATAGCTGA
AGAGTGAATTAAGAACTGAGAGATCTGAGGAAGTCACACAAAATATGGGAAAAGAAGATA
GCAAATGTGAACAAGAAGTTGTTACATGAAGGATAGACTAAAAAGTCATGCATTCATCTA
AGAGATACTCTGAAGGAGATATATTAGTGCGAAGGGGGAAAGATAATATGCAAAATTTAA
GGCTTAGAATATTTTTGGCTTAATAACGTGTCAATTAAAGAAGCATGAGTTCTAACCAGG
ATGAAAAACGTATACCTGTGTATGTGCAACTCTAGATCACAAAAGATAAGAAAAATAAAC
ATTTTGAAAATACTGGATAATTATTCCCATTCATTGATGATAAGTTTTTTATTTTTATGT
TTTATATAATTTAACTAAATAGGTAATATAGGAGATACAGTCATGTATCACTTATTAAAA
ACTTCCTCTTGTAAGTAACTTCCCAGTCGTCTTAGACCACTCCCTCCAAACTTATCTTCT
CCTTTTCCTAGCTTCCCGGAAGTAATGATGATATGAAAAAGTTTTACATTTTTTAATGTC
TGAAAGATATCAAGTTTAAATAATGCTTTAAAAAACTAGCATTCCAGTTTTTTCTCAGTC
TGTGAAATGGGAAAGATGTGATACGTTAAGAAATTAATCATAAAGTCTTCATTAATGTAT
CATTGATACTGTTGATCAGCAGTTGTTAAATTATGTTATCAAAATTAATAATTTATTTTG
AGTATACATTTGTTGTGCTTTATCTCATTGAAAATGCATTTTTTAAACCACTTTATTGAG
ATATGATTGACATACAAAAGTAAACTGTAAATATTTAATGTATACAACTTGATGGTTTTG
GAGATATATATACACTAGTGAAACCATGATCACAGTCTTTGCCATAAGGCTATACATCAC
CTCCTAAAGTTTCCTTCCACCCTCTTTATTATTAGTAATAGTATTTTAATAATAACTCAA
CATAAGATCTACTCTCTTAGCAATTTTTAGGTATGCAACAGTAGGATACCAATCAGCTTT
AAAAAAAAAAGAAGAAAATATTGCTATTTGCAACAACGTAAATGAACCCAGAGGACATTA
TGCTAAGAGAAATAACCCAGACACAGACAAGTTCTCCATGATGCCGTTTATATGAAAAAT
CTAAAGTAGTCGAACTCAGAAGTAGAGAGTAGAATGGTGATTTCCAGGGGCTGTGGGGAA
GCTAAAACCAGAAAATATTAGTCAAAGGTACAAAGTTTCCATTATGCAAGACAAATAAGC
CCTACAGATCTACTGCTGTACAGCATAGTGCCTGGACTTAATAATAATGTATTGAGGACT
GAAAATTTCTTTTTAAGTTTGTTTTTCAAGATGCATTTAAAATGTTTCTCCCATCCTTTT
AAGGCATAAGAAAAACTGGATTTACGTCTTTGTTTGAGATTTGTTGCTATATTTGTACTT
TAACTTTTTGAACCGCAAAATTGTTGCCAGTACTTTTGATAACCATAATGACTTCCAAAT
AACAGAATATCTGATAGGATTGTATATCAATTTGTGAACTCCTTTCATATGTTAGCTAAA
TGGAATTCTAAAATAGTGCTATATTATACATTCTAAGAATTGCATATTTTTTTAATCTCA
TTTGTTTGTGCTTATTGTATTAGGAAGTAATTTTTAGGGGGGATAGTAATTCTTTTCAAT
TTTGTGTAGGTATCCATTAAATAAATGTCAATTATCTGATTTATTTCTTGAAAAAAGGCA
AGAAATTCAGTCATGGGAAGCTGATATTGACTTAGTATCTCAACTTTTAACAGCAGCTTT
TAGTGAACACCTTTGCTTTATATGCAAAGCATTGTGCTAGATACAGTAGAGGTAAAGAAA
TGGATGAGACTTTCTGTGCCCTTCAATTATTTATAAACTAGTTGGAGCAATAAAATAGTA
TAAAAATGACAAGGCAGTGTCTGATTGTCATGTAAGTAGTTAGTACAATAATAACAACAG
GTAATATTACTGAGTACTATGTGCCAATTTTCAAAGTCCTTTGCGTGGTTTAATTGATTT
AGTATTTATAATGAGCGTGTGTGGTAGATGCTATATTATCAACATTCGCAAGCAACAGAG
GTACTAAGAACTTGAGTAAGTTGTTTGAAGTGATATACCTAAGTAATGTGATTGAACCAA
TATTAGACCCTGGTTGTCTGGCTGGAGAGTCGGCACTCTTAAGCATTCTGCTATACTGTA
AGTACTGTAAATGCTATAGCTATTCAAAGGAGAAAACAGTGGTTTCCAATTGTGACGGTT
AATAAAGGCTTCCTGGTGGAGAGAGATTTATGCTGGGCCTTGCATGAGACTATCAATGTT
AGAAAAACAAATAGGAATGATATGTTCTAGATAGGATATGAGTATGACCAGAGTATGTAG
AGCATATTTGTAGGACAGTTTGTATGGAAGTACATAAGTACACTCAACACTTCCTGCCAA
TTTGCGCTCCCTTACCCATAGCAGATATCACTGGTTGATTGCCAGACTCTTTATCTCTGA
ATCTGATGTTGCCAGAGCTAACCACTGCGAATGGATTAGAGATGACACATGATGTAAGAC
ATATTTACCATACTGGGAATTATTGACAGTCAATTGGAAAGATAAAATAATTGGCCAGAT
TGTGGAAACTAGTTTCCAGGAATTTTACAATCTATCTTTGTAGTCAAAAGAGAGTCTTTG
AAGCAAAAGAGTAGTGCATTATCAGAGCTTAGAATCAGTGTTATTTTTTTAAACATTTGA
ATATTATTTAGTACTGTTAATAAGCTTGGCCTGTTTAATCCCAAACTAATCTAAATAATG
GTTTCCTTACTCTCTTTTACTTCCCCTGTTGAATTTCGAGTATGAGTACTTAGAAGGAAG
ACAGAGAGTAGGGGAATGGGTATGGCTGGTTCCTTTAATTTTTTTCTGTTTTTATCTTTG
TTCTTCTGCTTAGTAGCCTTTTTTCAACCCACTTGCCTTTTATGATTTCTTACTTTTGGT
CATTTCAATCCAGATGTTCCAATCCTTATAGCTATTCTTATAAGACTAGGTAAGCAATGG
AAATAAAACCTCTTAAGTTTATTGGTTGTAGTGAAACTATTGCAAAACATGGGAAGACAT
CTACAGGCTGAGACTTTCTTTCTTTTTTTTTTTTTTACACATCAGTGTCAAGCTATAATC
TTACTAAACTGCTTGCTAAGGCAAAGAATTTTGTATCTGTCTTGGATCCTCTCCAAAAGA
TGTTTATTATCGAGAGCACTAAAAAAAAATTCATAACATTGATTCAACTATAAATTGTTC
TAGAGTAGGGGCTCTGAGATTAATCTTAAACTAAAGTTTCTGAGTAATTTTATCACCATA
TAAAGATAATCTGCAAATTATTTTTAGTGGAATAATGAGTTTACTGTCTTAGCAATCCTT
TTGCACAAAGCAATAGTAACACCTATGTTTTATAATTATGTGTTTGTTCTCACTCAACAC
CTTTTGTATTCTGAGGTATTCTCGGTATTCTGGGGATTTTGTTAATGAAATGTATAAAGC
TCTTTTGAAACCTTAATGGGAAACATTTTACTTTAATGTCAGCATTTAACATGCATATTT
TAGAATTTATTCCCAAACACTTACGTGCTATTTATTTCAGAACAGTGATTCAACAAGGCT
TCCTTGATGGAAAATGTTCCCTTAGAGAAGCATCGTAGAGGGTACATTTGATGGACATTA
GAAATAAAAACTCAAAAGCATACTTTTTGTGATTTTCAATTAGTGTCTTTTTGGTATTAA
ACATTGGCTGTCATCAGTCCCACAGATCATTTCCTGCCCTGGTTTCAAAGAGTACCTACA
ACGTTTATAAATGTTAAAGCAAACTAAAGAATATTTAATTTAGCTGCCATCCTTCAGGCA
GGTACAATATTTTTATGTCCATTTTTCAGATGAGGTGACTGAAGACCCACTGAGATTGGC
TTGCCTAGGTTTTCCTGCCTGCTGAATAGCAGAAGAAAGTCAAGAAGCCACATGTCCTCC
TTCCATTAGAGCAGTGGCTCTAAACTTTTCAGGTTTCAGGACCCCTTTCTGCTGTAAAAA
ATATTTAGGACCTCAAAGAGCTTTAGTTTATGTGGATTCCATCTACCAGTGTTCCCATAT
TGGAGATTTAAACTAAGCTTTACAAAAATACATTTGTGTATTTATTTATTTTAAAATGGC
CAAGTGGTTAAGTTCGTGCGCTCTGCTGCGGCGGCCCAGGGTTCGGATCCTGGGCGCGGA
CATGGCACCGCTCATCAGGCCACGTTGAGGCGGCGTCCCATATCCCACAACTAGAAGGAC
GTGCAACTATTATATACAGCTATGTACCAGGGGGATGTGGGGAGATAAAGCAGGAAAAAA
AAAACAGCAAACTTTGGCCACAGTTGTTAGCTCAGGTGCCAATCTACGAAAAAAAAATAA
AATAATTAGTTAACCCATTGCATGATAACATAAGTAACACTTTAATGAAAAGTAACTAAT
TATGTTTTCTAAAACATAAAGAGGTAGTGAGAAAAGTGACATTGTTTCACATTTTTGCAA
ATATCTTTAATGCCTGGCTTTTCCCTGAAATGTTAATACATCTTTTATAAAAAAGATAAT
AAGGAAGAACTTTTCTCCAAAAGAGAATACGGTCTTTGACCAAGTTCAGATGTAATCCCT
GTTCCTTTTTTCATTCCTTTAATTCCCTGCCTCCAAAACCAGCTGCAGGTGCTTGTTCTA
ATCTGTGGGATCTGTTGTCGCAGGTCCGGCCCTCATGTCTGATGATTACGGGGTTCATTG
TCTCTTGGCAAATAACACAGAGCAGTCAAGCTATTCTGGCCCACAGTTCCATGGTAGTGT
GCAAGACCCTTGGGGTAAAAACCCAAAAGGCCAGTTCTAATCTCAACTCATACTTAGGTA
AACACCAAAAATACAGAGTATCTGTTATGGTTCCTAAACCAGCCAGCAGGCAAGATCAGA
AATTTATAAGCACTCTGATATAACCTCTGTTTTTTATCATTTGTACCACACAATCTAAAG
GCCTTGTAGACAAAACCAGACTAATAGAACGCTACATTCTTCAAATCTTTCAAATTGGAA
AAAAGATAAGAGGAGGAAATGTATCTGCTTTGATTTTGAGTGAGGAAATCATGGGACTTA
TCTATCAGACTTTGTATGAATTTTTCAAATGCATCATTTAAAAGAATATGTTTTAGCGCA
CACACACAAAAGTTAAAGTCTTCAATCTGGCCATTATATTTCTTAGAACCATAACTCTCA
ACATGTAATTTTATAGAAATAACTCACAACTCAATTTCCAATTTTCCTGCAAGCATTAGT
ATTGTGAGATTTCAAAGGGGAAGTAGCTTTAAATACAAGACTATAGCCTAATTTATACAA
TATCACACTTCTAAGAAAATATACTACATTAGTAATATCGCATACATCAAATATCTTAAA
AATTAAGTTGACTATTAAATGCATTGTTTTTCAGGCCACTTGCAAACGAGATCATAGACT
CGCAATGTTGAAAACTCGTCGCTGCTACCTAGAGAAGAAAAGGCAGGAGGAATTGAAGCG
ACTTGATGAGAATACTAATTGGCTCAATTATGTTGAAACTGAAATGGGTCTCTTAGGTCA
AAATGGTCACATTCCAAAGGTACAGATATGTTTGTATATTCAGATTTATTTTGTAAGAAC
TGAGCTCTTTAAATCCATTGTCTTTATTGTTGAGTAAATATCTTTCATAAGACAGCTATT
GCTTCATTTCACCAAGATTCAATTGACTCATTTTATGGTTTTTAACTGATTATACCTTCT
GGCTCACTAATTACCTACTACATTTGACTTTTTTCTACTTTCAGAAGAGTAAAGGTACTT
TTAAATTTTGCTGTTCTTAAGCAATTGCATCCTTTTATGAGGTAGCTCCTAAGTTAGAAT
AAAAGTGATTCTATTTCAACCTGTATTTGAGATTTCATCATATAGATAATTTGGGGTTTT
TTTGGAGGAAGATTACCCTGAGCTAACATCTGCTGCCAGTCCTCTTCTTTTTGCTGAGGA
AGACTGGCCCTGAGCTAACATCCGTGCCCATCTTCCTCTACTTTATATGTGAGACTCCTA
CCACAGCATGGCTTGTCAAGCGGTGCCATGTCCACACCCGGGATCCGAACTGGCAAACCC
TGGGCCACCGAAATGGAACGTGCAAACTTAACTGCCGCACCACTGGGCCGGCCCCAGTAA
TTTGTTTTAATACTTGATATTTTGTTCAAAACTGATCTTAAGTGTGATCATCATTACTTA
TGTTATGGCTAAAGAAAGTTGTATTTGTGTGTGTATGTACTGAACTGAAAATATTCCACC
TAGAATGGCAAAAAGTTATATTTATAAAGAGTAGTGATTGGTAATGATGGTTAAAGGCTG
AATCAGATCAGAATTGTGTTCAGCTACAAGGTTATGGAAATCTGACTTAGTGCCTTAACC
AGTTAGGGCTATATTTTGCTCCCTTAACAATAATAAGTTTTGGAAATATTCAATTTATTC
CTAAAAATGTCATCAATGTCTTCATTATACTTGTCATTTCGTAGTTGTGATGTCACTATT
CCATCTTTAGTCTCAAGTTTACACTTAGGCTAGAAGAAGAGGAAAGAAAGAAAGTGGGGA
GGGCTATCTGTAGTGGGAGATCAAAGACTTCCAGAAATTCCTAACAGACATATCTTTTGC
TAGAATTGTCATGTGGCTATCCCTAGATGCAGGGGAATCTGGAAAGCTGAGTGATTTTTC
TGGACGCCTTATCACCCTGAACAAAATTAAAGTTCTCTTAATAAGAAAGAAGGGGGAAAT
GAATATGGAATAAGTAGCTAGCAGACAACTGCCACAAAGTAATTTTGATCCAATACCTAA
TACTTTAAAAGAACGACTTCTTTATACTCTTTTTAAAAGGAGGAGCATCTAAAGTCTTTA
TTTTGAGGATATTCTTCTGAAATTCTATACTAGGTATCCCCTAATTGGTATCTAGTCCTC
TGGAATCTTCAAATTTCTAGAAAAGCACTGGACTGAAAATAAATACTCATGAAATAAAGT
ACAAAATATCAGTAACAAATGAATGCAGCTAGTGATCATTAATATTCAAAGATAGCAATT
TTTGTAATTCAAAGATATTAACCAATGATTCATGACTAGGGAAATGGATTCTCTGGCTAG
CAATAGCTATGAATGACCATCTTTTTAGCATTAAACCTCAGACTGGAGAGAGAGAGGAGA
CTAGCAGGAGTAGTCAGTGATGACAGTTCAAGGTAGTAAAAGGAGCAGCAGGCACCAAGC
AGCAGACACTCTGCTTCTTAAGAAAAAAGCCAAAGACAAATGGAGCCTGAGTAGTTCTTT
AGTGTGGAGATTCATTGAGCACCAGGCAACAACTTAACCTACACCTCAGGAACTCTAGAA
GTCATCAAAGTATCTTGCTAAAAGCATGCCAGCCAGTTTGTTCAGCAGATTAGGAATGTA
GTACAGAATGTACTTTAATAATATAACTTAATTGATAAGCACTTTAGACTATTCCCTACA
GAGAGAGTGTCAGTGTTGGAAAGAGGATAAACTTTGGAGTTGGAGTGGTTGGTAATTCTG
TAATTTGATAGTTGTGTTGAATACTAACTCTAATGCCGATTGTATGACTGGACAAGTTTT
TAACGTCATCGTCTTAATTTCTCATCTTTAAAATATACTTAAGGCATTATGAGCCTAAAT
GCTGTATGCAAAGGCCTAGCACCTCTTAACCCATAATAGATAGTTGACAAATAATACTTT
AATATTCTAAGCAACGGTAACATAGACATCAGTAGCCAATGAAAGCTGTACGCAAAAAGA
GCACAACAGAGTTAGCTGCATTACAAAATACGTTTTCCGTTTTTCCTCCAGAGTAGTAAT
TCTGACCTTTTTGGGTTATAGATGCCTTTGAAAATCTGATCAAAGAACTATATAGATCTT
CTCCCAGGTGAAAGATTGGGGAGGTCACATTCATACAGTTTTCCTTTTTTTAAGTCTTTT
TTCTGTTGATACAACATTAAGAATACCTAAAATAAAACTAAAGCACTTTTATTTAAAATG
CTGTATTCGTCTTAAGATGGTATAATGGACATATTTACATGACTTAAAAGGAGTAAGCAA
CAAAAGACGATGATTAATCAATACACTAGAATAGAGATTATCTGGATTTAGGAAAGATAA
CTTCGGAAATCCCATGCCAGATCTGAGGCGCCTACAGCTGTAGCGGCTCACCACAGAATG
CAGCACCTCCAGCAGAGCAGCTGTCAGGGCGCTCGGCCGTGTTCTGATGACAAGTTTTCA
GAGAAAACACTGATAGCCCAGGCCAAATGGGTGCTTCTCGTTCAGTGCACAAGAGCTTAT
TCTCTTGAAAAGGTGGCAGATGTGCAACATTTATAGCAGTTTTGGGTTTGTTTCACTTGT
TACTTGCTAGAGACCATGTATGTCTAAAGTAGTCTTGTTCTCAGATCATTGTCTAAATGA
CATAAAATGACAAGTATTTTGGTTAAATTTTTGACCTTATTTTAAAATAACTGCTAAACA
TTCTTTCATTTTCTTTGTTACTGTTACTTATGGCCATGATGTTCTAGTAGAATATTTAGC
CCATCTAGTGAGCAAAAGCTTTCTCTTGAAGGGTCTAAAAAATTTTTCTGTGTGTGGTAA
GATATAACATAAAATTTACCATTTTAACCATTTTTAGGTTACAGTTCAAGTGGCATTAGC
ACATTCATTAAAAAAAATTTTAATACATGTATATGTAGTTTTAAAATGTTATTTCTAGAG
TACCTTCACCTCTCAATAGCCTTACTTAATTTACATTATACTTATATTATAATCTAGTGT
GTTTGTCTTTGTAGTCAATATTCTAATTTATAGCCTAACCTCAGCTAGAGAAATATTTAA
GAACTTATTTTGTATTAAAGAGGTAAAAAACTCAATTGTAGAAGTTTACTAGTTTGCCTT
TGCTTTCTCATATTTATCATAAATTCTCAATTTTAAAAATGTTATGGTATTCTTTTAAGT
AGTAGCATTATTATTATTGCTAATTTGCTTTATAAAGTTAATGGTTGTTTGGGTTATTTT
TAGTAAATTTAAATGTTTTCAACATGATCGAATCTAATTTTTCTAGTAATTGGTCTTCTG
TAACTCTCATAAGCAGTTTTCCACGCCTGAATGTCAACCTAGAATTGATTTTTAAGTCAT
TGTTTTTTAGTGCATTTTATTGTAAATAATTTGAAAAATTAAAATGAAACCTGTGTTTCC
ATTCCCACCACCCTAATCTCATTCATCATTCTTTTTTCTGTGCATATTTTCATGACTGAA
ATAATTATTTATTTGTAAGCCATTATTTCCTACATTGGCAAAGTGACACATAACTTTGTA
AAAGGGCTTATCCACAGTCATACAACTCTTGGCACAGACCCAGTAATGTGATTTGCAAAT
TGGTGCTCTTTTTTCTGTACCCTCCTGCATTATCTCCCTCGTAACATCTCAAATCTACCC
ACTTCTCTCTTTCTCTCACTGCCATCACCCTAATTCTGATTTCCATCCCCCCATTGTTGG
ACTGCTATATTTGATCTTTCTTCCATTCATCTTCCACCACAGTCATTCTCTCCACTGCAA
CCAATATGAACTTTCTGAAAGGTAACCGATCGTATTACTCTTTAGTGCGTTCTCCCTAAT
ATAAACTCTGTATTATGATTTCCCAGGCCTAGCGTGGCACCTGAATACTTCCCAAGTTTT
ATGTATCACCTCTCATTTATTCTTCACTTCAACCATTGCTAACCTACTTATGGTTCTCAG
AATAGGCCATGCTCTTCTAATCAGATTTAGTCAATAATGTATCAAAACGAGAAGACTCAA
ATTGTAAACTTGGTTTTCCAAATATAACAAGCTTAGGCAAGGTCCATTACTGGCTAATAT
AATTAGACAATTAAGGTTTGTCTTTTTAAAATAAGAGTGATTTAAGAAAATAAAGGAATT
AGAACAGGGTTATCAGAGGAAGTATATAATGAAGGAATTTTTTTTTGAGAGAGGAAAGAT
GAACTATTTGGCAAGTATGTTCATACTGTTAGGATTGTTGGATTTCCTAACTGGAAAAGA
CTAAAGAGATCATCTAGTCAAGCACTTAAATTTTAGTCAAGTAAATTGATCTCCATAAAA
ACCATATTTTTAGCTTGCAGTGGCATTTGTGTCATGGCTGAGACCATCTCTAAAATCACC
TGACTCACAGACCACTGCTCTAACCATACCATCCTGACTTGCTAAAGAGAGTTTTCTCTA
GAATACATGCTAGATTCCTTGAAATGGCATCATGAATCATGTAAATCAATAACCCCGAGT
GTTAAAATACCTCAGAACATAGAATGACATTGTTTCCCTTTCATAATTCCTACCATTGGC
ATAGGAAGTATTTTTTTAAAAAAAAAGAAAAAGAGACAAGCTTAACCTTTTGGAGAATCA
GTGGTCTGCAGGTTTGGAAGGAATATGGAAAAGCAAAAGTAGATTATGAGAATTGTCCCC
AGGAGGACATTTCCAGGCACAGCTTCCCTACTTATGGGATTGTCTTAGCCCCTCACAATG
TTCAAAAAAATTTCACTCCCTTTCGTTGTACTGACTTAAATTTTCCCAATTAAGGATTCT
GAGAATGCTGTTGGATTACTACCATTCATAGTGTAGTGTAACCACTTAGCAGACGTTTTC
CATACTTAAGGTTAGGACATTTAAGGAAAAATAAGTAATTTTAGGTGGTAGATTAGAGAA
CACTTGGACCTGTGCATATGAGACTTAGGGAAATGGGAGCCATAGAAGACTTTTTTACAC
TTTTGCTCTAGGGTAAAGCTTATACCAAGATTAGATGAAGGCAAGAAATTTTTATTTCTT
TGGAACTCCAGACACTGAACACTTGGGCTATACTACTGAACTGGCGTGATACGGTACCTG
TCCTGGTGGTGAACCTAACCTTCTAGTACAGACAGAAAGACTGTAAATAAATGAGTAAAT
AAATGAAGTTGTTTCTGATCAATGCTAGGATGGAAATGATTGGGGGTAGAGAATATCCAT
CTTTAAATATAATGCTGAGGGAATGCCTCCCTGAAGAAGTGACATTTAAGCAAAAACTGG
CCATATTCATGTGTTTTCACAGCCTTAGGAACAAGTTGGATAGACCAAGAAACTGTCATC
ATAATAAAATTTGTCTGAGTTTCTGACATTCAGCTTCTGAGGAAACTTGAATCTTATCTT
GCTTATAAGTTATAAACCACCTATACCAGAATGTTATTTTTCAAATTATTCCTAAACATA
TCATTCACATGTAAAAACATTAAACCTATTGGCACCAATGTAAAATGTTTTATTAAAATT
GATTTGATTTTAACATTCTTAAAAGAATCTGAAGTATAGTTTGCATTGTGTTCCCCAGGA
ACTCAATGAAGATCTTCAAAGTCACCATTTGCACCTCCAGAACAAAGATTTGAAAGCACA
AATTAAACATATGATGGAACTAGCTTGTCTTCAAGAACAGCAGCACAGGCAGAATGAAGC
GTAAGTACATGGATTACACGTTCTACAAATTTTAACACTGTAGACCTAAGGATCCTGAAG
CATAGAAATTCAGTTTTCCACTGCCCGAAAATTGAGTTTTATCTGGTACAGGATACGTTA
TTTTTAAAGTGTCTGCCAGCATCTGAAATGCAGTTAGAAAACATTGAGAAAGTATAAAAG
ATGTGGTTCTTCTTCTCCAACTAATTTTTTAATACTACTTTTGTAGTTTTGAAAACATTT
TTCTTCAAGAATTTATTATTTTTACGTCATATGTGCCATGTACTACAAAATTCCAAAGAT
ACCTATACAGTGAAAAAGAGTCTGTCTTCAGGGGCCAGCTCTGTAGCGTGGAGGTTAAGT
TCGGCACACTCCACTTCAGTATCCCACTTTTGGATCCCAGGCGTGGAAGTACACCACTCA
TCAACCAAGCTGTGGCGGTGGCCCACATATAAAGTGGAGGAAGATTGGCACAGATGTTAG
CTCAGGGCTAATCTTCTTCAGCAAAAAATAAAAAAGGAGTCTGTTTCTCCTTTTAGCCAT
CTGTTTCTCCTCTTAGAAGTAAATACTATGAATACTAACTGAATTGTAAGTAGGCTGTAT
GAATTGTAACCATTCATAATTCCAGAATGATTTTTTTGCTATCATTGAAAGGAAGTTACC
AAAAATGTGTATTTTTTAACATCAAGTGTCCCAATTTTCATGTAATGCTATGGTAGCTCT
TTCATGCTCTCTCACTAGCTCAGCAGTAACATCTTTTGATTTTTGAAAGATAATCGTAAA
AAGTATAACCTAATCTATATTTTTGTTACCTTGTATGTGTCAGTCAGTTCCTTAGGTGTC
ACTTTCATGCTCTGTAAAAATGAGACATTTATTTCTCTAAGTGGTTTCTGCTAGTCTGAA
ATTCTGCTGGAGTTCTACTAGTGTTCTCAAATAACTAGTAATTAATTTTCCATAATTTTG
GTTTAAGTGAAATCATATTAGTGTAGTTATTTTTAAAAAGAAGAAGAAAAAGGAAAGAAA
GAACATTAGGGAGATACTCTCCTGCAGGTAGAAGTTCAGCCTACTCTCCCTGTACTTTCT
ATGTCTATACCTAGAGCAGACGTTGAGTATTCACTTACTAGCACTCAAACCACATGCAAG
AGCTAGAGTTATCAAAGAAACATTATTGTAACCATTCTGTATTTGCTGTATTGTACAAGT
AGAGCAATACATTTAACTTAAACTTTTGCCTCAAAATGGGCAAAAAGATTTCTGACTAAC
TCCTGTTTATTTAGAAAATTGGTGAACCAAAGCATTACAGAGGCAACATGGCATAGTTAG
ATAGAGTACGAGTTTTGGAATTTTTCTTCAATTCTAGTTTATGTTAGCAATATAACCTTG
CATAAATTATTTAACCTCACTAAGCCTTAGTTTTCTTAAATTTAAAATACATAACAATAC
TTTCCTTATAAAGATTTTGAAAAGATCAAATGACATAAAAAATAATGAGAGTGATGAACT
GTCTTACTCTGATCTTGTAGAATGGAGGCAGAAAACTGACTTAATATATATTCAAAGTGC
TAAATGAAAAAAATTCCAACCAAAAATACTTTACCCAGCAAAGTTAACATTCAGAATTGA
AAGAGAGAGAAAGAATTTCCCAGACAAGCGAAATCTAAAGGAGTTCATCACCAGACCTTA
CAAGAAACGTTAAAGGGACTTCTTTAAGCTGAAAAGAAGGGCCATAATTAGCAACAAGAA
AACATTAGACTATAAATCTCACTTCACTGGTAAAGGTATTTAGTAGAGTATCAGATCAAT
TACTTGTAAAGCTTTTATGAAGATTAAAAGAAAAAAGTAGTAAAAGTAACTGTTACTACA
ATAATTAGTTAAGGGATACACAAGATAAAAAGATGTAAAATGTGACATCAACAACGTAAA
GCGTCGGGGGGTAGTAAAAATGTAGACCTTCAGAATGCATTCAAACGTAAGTTGTCAACT
TAAAACAGACTTTGCCTCATGGCAATCACCAAGCAATAACCTATAGGAGACACACAAAAG
ATACTGAGAAAGGAATCAAAGCAATACCAATAAATAAAGCCATCAAAACCACAAAGGAGG
AGAGCAATAGAAGAAGAAAGGAACAGAGGAACTACAAAACAGCCAGAATACAATTGACAA
AATGATAATAAGTACATACCTATCAATAATTACTTTAAATGTAAGTGAACTAAATTCTCC
AGTCAAAAGATAGAGTAGCAGAATGGATAAAAAAGCAAAACCCATCTATATGCTGGCTAC
TAGAGACTCACTTCAGATGTAAGGACATACACAAGCTGAAAGTGATGGATGGAAAAAAAT
ATTCCTTGCAAATGAAAACCAAAAGAAAGCTGAGGTAGCTATACTTAGACAAAATAGACT
TTAGAACATAGACTATAATAAGAGGCAAAGAAGGGCATTACATAATGATAAAGGGATCAA
TCCAACAAGAGGATATAACAGTTGTAAATATTTATGCACTCAACAAAGGAGCACCTAAAT
ATATAAAGCACATGTTAATACATCTGAAGGGAGAAATAGACAGCAATATAGTAATAGTAG
GGGACTCTAATACCCCACATAAATCAATGGATAGATCATCCAGACAGAGCAACAGTAAGA
AAACATCAACCTTAAATGATACAATAGGCCAGATGAATTTAACAGATATTTGCAGAACAT
TCCATTCAAAAGCAACAGAACACACATTCTTCTCGAGCGCACATGGAACATTTTCCAGGG
TAGGTCATATGTGAGGTCACAACATAAGTCTTAACAAATTTAAGAAGATTTGAATCATAT
CAAGCATCTTTTCTGACCACAGTGATATGAAACAAGAAATCAATTAGAAAGAAGAAAACT
GGAAAATTCACACAGATTTGGAGATTAAAGAACATGCTACCAAACAACCAAAGGTCAATG
AAAAAAATCAAAAGAGAAATCAAAAAACAGCTTGAGACAAATGAAAATGGAGATGCAACG
TACTAAAATTTATGAGATCCAGCAAAAGCAGATCTAAAAGGGAAGTCCATAGCAATAAAT
GCGTACCTCAAGAAACAAGAAAAATCTCAAACAACGTAACTTTACAACTCAAGGAACTAG
AAAGAAAGAAAAAACAGAGCCCAGAGTTAATAGAAGGAAGGAAATTACAAAGATCAGAGC
AGAAGTAAATGAAATAGAGACTAAAAAGACAATAGAAAAGATCAAAAACCAAGAGCTGGT
TCTTTCAAAAGATAAACAGAATTCACAAAGCTTTAGCTAGACTCACCAAGAAAAAAAAGA
GAGAAACTCAAGTAAAATCAGAAATGAAAGAGAAGACATTACAACTGACGACATGGAAAT
ACAAAGGATCATAAGAGACTGCTACAGACTATTGTATGCCAACAGATTGAACAACCTGAA
GAAATAAATTCCAGGAAACATGCAACCTACCAGGACTGAGTCATGAAGAAATAGAAAATC
TAAACAGACGAATTACTAGTGAGGAGATTGAGTTAGTAATTAAAAACCTCCCTACAAACA
AAAGTCCAGGATCAGATGACTTTACTGGAGAATTCTAGCAAGCATTCAAAGAAGAATTAA
TACCAGTCCTCAAACTCTTCCAAAAGATAGAAGAGAAGGTAATGCTTCCAAACTCAGTTT
GTGAGGCCAGAATTACCTTTGTCGACACAAATTATCGATAATCAATCTATAAATCAAAAT
CGCAGTGAGTTTATGAGCCAATTTTGAGAACTATAGCCCGGAAGAGAACTTTCACCAAGG
ACGGAAGCACTCCAAAGAAGCAGGGTGTACAGTGTGGTTTTATACCATCTTGAAAAAAGG
GACATACATCAAATATGACAGGAATATCTCTTGTACTACAGTCAAAATATTTTTCTAATG
CAGAAGGTCAGTGGTCACAAGATGAGCACAGTAGATCAGTAATTAATCCTTAGTTTCTGG
GAAGAAATGCTTATCTTTAAAGAAATACAGATAAGAGGGGAGGCGTAAGTCCCTATTTTT
AAGGCCACTATTCTTCACTTGGGATGTTGTAAATGTTTGAAGCAGATGTACAGTGCATGC
TCAGCAGGCCACGTCAGGCCTTTCTGGGAAAACAAGGTGAGGCCAAATTAGTTTCAAAAC
CAAATAGCTTCTTCATATATCTCACTATTTTAACTTTTCTCATTACTTTCCATTTATTCA
TCACCCTGATACCAAAACCAAATAAGGACACCACCAGAAATTAAAATTATAAGCCTATAT
CCCTTATGAACATAGATGCAGAAATCCTCAACAAAATATTAGCAAACAGAATTCAGCAGT
ACATTAAAAGGGTCACACACCACGATCAAGTGGGATTTGTTCCAAGGATGCAAGGAAAGT
TCAACATCCACAAATCAATCAGTGTGATAACACTACCTTAAATTGAAGGATAAAAATGAT
AGAATCATCTCAATAGATGCAGAAAAAGCATTTGACAAAATTCGACACCCATTTCTGATA
AAAACTCTCAGCAAAGTGGGTATCGAGATTTTTTGGAGATACTGCAGGATCAGTTCCAGA
CCACCACAGCTGGTGAATCACATGAATTTTTTGGTTTCCCCCTCCATATAAAAATTTTTA
CACTATACTTAGTCTATTAAGTGTGCAATAGCATTATGTCTAAAAAAGACAATGTACACA
CCTTAAAAATTACTTTATTGCTAAAAAATGCTAACCGTCATCTGCACCTTCAACAAGTCA
TAATCCTTCTACTGATGGAGGGTCTTGCTTCCATGTTGTTGGTTGCTGGGTGATCAGGAT
GATGATTACTGAAAGTTGCGGGGCTACGGCAATTTCTTGGAATAAGCCAATGAAGTTTGC
CACATCAACTGACTCTTCCTTTCAGAAATGATTTCTCTGTAGCATGTGATGCTGTTTTAT
AGCATTCTACGCACAGTAGAACTTCTTTCAAAATTGAAGTCAGTTCTCTGAAACCCCTGC
CACTGCTTTATCAACTAAGTTTGTGTCATATTTTAAATTTTTTGCTGTCATTTCAACAAT
CTTCACAGTGTCCTCACCAGGAGTAGATTCATCTCGATAAAACAGTTTCTTTGCTTATTC
ATAAGAATCAACTCCTTATCAAGTTTTATCACAAGATTGCAGCAATTCAGTCACTTCTTC
AAGCTCTACTTCTAATTCTAGTTCTCTTGCTATTTCCAACATCTCTGCAGTTACTTCTTC
CACCGAAGTCTTGAACTCCTCATTAGGGTTGGAATCAACTTCTTCCAAACTCCTGTTAGT
GTTCATATTTTGACCTCTTCCCATGAATCCTCAATGTTCGTAATGACATCTAGAATGGTG
AATCCTTTCCATAAGGTTTTTGATTGACTTTGTGCAGATCCATCAGAGGAATCGCCAGCT
GTGGCAGCTACAGCCTTATGAAATGTTTATTTCTTCAGTAATAAGACTTGAAAGTCTAAA
TTACTCCTTGATCCATGGGCTGCAGAATGGATGCTGTGTTAGCAGGCATGAAAACAACAT
CAATCTCACTGTACATCTCCATCAGAGCTCTTGGGCAACCAGGTGCATTGTCAATTAACA
GTAATATTTTGAAAGGAATCTTTTTTTGTGAGCAGTAGATCTCAACAGTGGGCTTAAAAT
GTTGTAAACAGATGTGCTGTCATCCAGGCTTTGTTGTTCCGTTTGTAGGGCACAGGCAAG
AGTAGATTTAGCATAATTGTTAAGGGCCCTAGGCTGTTCGAAATGGCAAGTGAGCATTAG
CTTCAACTTAACGTCACCAGCTGCGTTAGCCTCTAACAAGATAGACAGCCTGTTCTTTGA
AGCTTTGAAGCCAGGCATTGACTTCTCCTCTCTAGCTATGGATGTCCTAGCTGGCGTCTT
CTTCCAATGTAAGGCTATTTTGCCTATGTTGAGAATCTGTTGTTTAGTGTAGCCGCCTTC
ATTAATTATCTTAGCTAGATCTTGTGGGTAACAGGCTGCGGTTTCTATGTCAGCACTTGC
TGCTTCACCCTGCATATTTATGTTATGAAGGCGGCTTCTTTCCTTAACCTCACAAACCAA
CCTCTGCTAGCTTCAAACTTTTCTTCTGCAGCTTCCTCACCTCTCTCAGCCTTCCCAGAA
TTGAAGAGAGGTAGGCCTTGCTCTAGATTAGGCATTAGGATAAGGAAATTTTGTGACTGG
TTTGATCTTCTGATCAAACCACTGAAGCTTTCTGCATATCAGCAGTAAGGCTAATTCACT
TTCTTATCATTCATGTGTTCTCTAGATTAGCCCTTTTAATTTCCTTCGAGAACTTTCCCT
TTGCGATCATGACTTAGCTAACTTTTTGATCGAAGGGGCCTAACTTTTGTCCTATCTGAG
CTTTTGACATGCCTTCCTCACTAAGCTTTTGATTTAAAGTGAGAGATGTGAGACTCTTCC
TTTCACTTGAACATCTAGAGGCCGTTATAGGGTTATTAATTGGCCTAATTTCCATATTGT
TGTGCCTCAGAGATTAGGCAGGCCCCAGGAGAGGGAGAGAGATGGAGGAACAGCCAGTCA
GTCGATCAGTCAGAACACACACATTTATCAATTAAGTTTACTGTCTTATATGAGTGTGGT
TTGTGGCACCCTAAAACAATTACAATAGTGACATCAAAGATCACTGATCACAGATCATCT
TAACAAATATGATAATAATGAAAAAGTTTGAAATTTTGTGAGAATTACCAAAATGTAACA
CAGAGACACAAAGTGAGCAAATGCTGTTGGAAAAATGGTGCCAAAAGACTTGCTCAACGC
AGGGTTGCCACAAACCTTAAATCTGTAAAAAATGCAATATCTGGTAAGCACGATAAAGCA
AAGCGCAATAAAATGAGGTGTGCCTTTATAGAGGGAGGGTACCTCAACATAATAAAGGTC
ATATATGACAAGCCCATGTCTAACATCATACTCAGTGGTGAAAAGCTGAAAGTTTTTCCT
CTAAGAACAGGTGCAAAACAAGGATACTCACCTGTGCCACTTTTATTCAACATAATATTG
AAGTTTTAGCCAGAGCAGTTAGGGAAGAAAAAGAAATAAAAGGCATACAAATTGAAAAGG
AAGAAATAAAACTGTCACTATTTGCATATGACATGATACTATATATAGAAAACCCAAAAA
ATGGTTAGAAGTGATAAATGAATTCAGAAAAATTGCAAGATACATAATAAATATTTAGAA
ATCTGTTACTTTTCTATACACTAATAATGAACTATCAGAAAGAAAACTTAAGAATATAGT
CTCGTCATTCTTCACAGAAATAGAACAAAGAATCCTAAAATTCATATGGCGCAACAAGAG
ACCCTGAATAGCTAAAACAATCCTGAGGAAAAAGAACCAAGCTGGAGGCATTGCAATCCC
TGATTTCAAAATATGCTACAAAGCCATAGGAATCAAAAGAGCATGGTACTGGTACAAAAA
CAGACACACAGACCAATGGAACAGAATTGAAAGCCCAAATGTAAACCCACACATCTATGG
ACAGCTAATCTTCAACAAAGGAGCCAAGAACATACAATGGAGAAAGGAAAGCTTCTTCAA
TAAATGATGTTGGGAAAACTGGACAGCCACATGCAAAAGAAGGACAATTATCTTTTACCA
TATACAACAATTAACTCAAAATGGATCAAAGACTTCAAAGTAAGACCTGAAACCTTAAAA
CTCCTAGACGAAAATATAGACAGTACACTCTTTGACATCGATCTTAGAAGGATCTTTTTG
AATACCATGTCTACTTGGACAAGGGAAAGAAAAAAAAATAAACACATGGGACTTCATCAG
GCTAGAGAGCTTCTGCAAGGCAAAGGACACCAGGAACAAAATGAAAAGACAGCCCACCAA
CTGGGAGAAAATATTTGCAAATCATATATATCCCACAAGGGGTTAATGTCAAAAATATAG
AAAGAACTCACACTGAACAACAAAAGACAAACAACCCAGTGAAAAAATGGGCATAGGATA
TGAACAGACATTTTTCCAAAGACGGCCATAGATTCCGTTTTTCCATAGATGGCCAATGGG
CACATGAAAAGATGTTCGATATCACTAATCATCAGGGAATTGCAAATCAAAACTACACTA
AGATATCACCTTACACCCATTAGAATGGCTATAACCACCAGGACAAAAAATAACAAATGT
TGGAGAGGATGTGGAGAAAAGGGAACCTTCATCCACTGCTCGTGGAAATGCAAACTGGAG
CAGCCACTATGGAAAACAGTATGGAGATTTCTCAAAAACTTAAAAATAGAAATACTGTAC
AACCCACCTAGTCCACTACTGGGTATTTATCCAAAGAACTTGAAATCAACAATTCAGAGA
GGTTTATGCACCCCTGTGTTCACTGCAGCATTATTCACAATAGCCAAGAAGTGGAAGCAA
CCCAGGTAACCATCGACTGAGGAGTGGATAAAGAAGATGTGGTATATATATTCAATAGAA
TACCGCTCAGCCGTAAAAAAAGACAAAATCCTCCCATTTGCAACAACATGGATGGACCTT
GAGGGTATTGTGTTAATCGAAATAAGCCAGACAGAGAAAGACCAATACCCTATGATTTCA
CTCATATGTGGAAGATAAACTAACACATGGACAAAGAGAACAGTTTAGTGGTTACCAAAG
GGGAAGGGGATTGGGGGGGTAGGCAAAAGGCGTAAAGGAGCACATTTATGTGGTGACTGA
CAAGAATGCACAATGAAATTTCACAATTATTATGACCTCAGTGAAAATAAAGACTACAAT
CTCATTTACAATTGCATCAAAAAGAATAAAATACCTAAGAATAAATTTAATCAAGGAGAC
AGAAAAACTTGTATACTGAGAACTGTAAGACATTAATGAAAGAAATTGCAGAAAATATAA
GTAAATGGAAAGATATTCCATCCTTCTGGCTTGGAAGAATTATTACTGTTAAAATGTTCA
TCCCATCCAAAGCAATCAATAAGCAATATCCAATGTGATATTACTAAACTCAGAATGAGA
TGAGATATGCTCCACCAGCTCTCCAAGTGCAAGCTGGCTCCAGCACATCACTGCCAGAGC
CCAGATCAATAGACTTCACATAACTGATGATCAAGAAATATCAATTAAGAGCATTCAACA
TAATCCCTGTCAAAATTCCAATGGCATTTTTCACCAAACTATAACGAAAAATCCTAAAAT
TTGTATGGAACCACAAAAGACCCCAAATAGCCAAAGCAATCTTGAGGAGGGACAAAGCTG
GAGGTGTCATGCTTCCTGATTTCACACTGTATTACAAAGCTGTAGTAATCAAAACTATGG
TATTGGTGTAAAAACAGACACAGATCAATGTAACAGAATAGAGAGCCTAGAAAAATGTTC
ACGCATATATGGTCAATTAATTTATGACAAAGGAACCAAGAATATACAATGGGGAAAGGA
CAGTCTCTTCAATAAATGGTGTTGGGAAAACTGGGCAGCCACATATATAAGAGTGAAAGT
AGACTACTATCTTAGACCATACACAAAAATCAACTCAAAATGGATTAAAAACCTAATATA
AGGCCTGAAACCATAAAACCCCTAGAAGAAAACATAGGCATTAAGCTCTTTGCCGTTGGA
CTTGGCATTGATATTTTGGATTTGACACCAAAAGCAAAGGCAGCAAAAGCGAAAATAAGT
GAGAATACATCCAACTAAAAGGCTTCACAGCAAAAGAACCATCAATAAAATGAAAAGACA
GCCTTTCAAATGGGAGAAAATATTTGCAAATCATATATCTGATAAGGAGTTAATACCCAA
AATATATAAAGAACTCATACAATAGCAAGAAAACAATCCAATTAAAAAATGGGCAGAAGA
TCTAAATAGATGTTTTCCCAAAGAAGACATGCAGATGACCATTAGCTACATGAAAAGGTG
CTTAATATACTAATCATCAGGGAAGTGCAAATCGGAACTCCGAGCTATTGCCTTACACCT
GTTAGAATGACTATTATCAAAATGACAAGAAATAACAAGTGTTAGTGAGGATATGGAGAA
AGGGGAATTCTTGTGCTCTCTTGGTGTGAATGTAAATTGGTACAGCCACAGTGAAAACAG
TATGGAGGTTCCTCAAAAAGTTTAAAGTAGTAAGGCCAGCCTGGTCATGTAGTGGTTAAG
TTCATAAGCTCCACTTCATTGGCCCAGGGTTTGCGGGTTCTGATCCCGGGCATGGACCTC
CACACTGCTCATCAAGCCATGCTGAGGCAGCATCCTACATACAGTACAGAAGAAGATTGG
CACAGATGTTATCTGAGCAACAATATTCCTCAAGCAAAAAGGAAGATTAGCAACAGGTGT
TAGTTCAGGACCAGTCTTTCTCACACACAAAAAAAAATTGAAAGTGGAACTACCATATGA
TCCAACAATTCCACTTCTTGAGTTTTTATCTGAATAAAATGAAAAAACTAATTCACAGAG
ATATATGCACTCCTGTGTTTATTGCAGCATTATTTACAGTAGCCAAGATAGGGAAACAAC
CTAAGTGTCCATCGATGGATGAATGGATAAAGAAAATGTGGTTTGTATATATATACACAC
ACACACATATACATACGTACATATATACAATGGAATATTATTTAGCCATAGAAAAGAATG
AAATCTTGCTATTTGTGACGCCATTGATGGACCTTGAGGGTATTATACTAAACAAAATAA
GTCAGAAAGAGAAAGACAAGTACCATAATGACCTCACTTAGATGTGAAATCTTAAAAAAG
AACGAAAAAACTCATAGATACAGCGAGCAGATTGGTGGTTGCCAGAGGCAGAGGAGGGGA
GGTGGGTGAGGTGGGTGAACGGAATTAAAAGGCACAAGCCTCCAGTTCAGTCAGTCATGG
GCATGTGCTGTACAACATGGCAACCAGAGTTAGTAATACTGTATTGTGCGGGGGGTTTTT
TTCTTTTTTTTTTTTTTTTTTTTTAAGATTGGCACCTGGGCTAACGACTGTCGCCAATCT
TTTTTTTTCTGCTTTATCTCCCCAAACCCCCTCTGTACACAGGTGTATATCTTAGTTGCA
GGTCCTTCTAGTTGTGGGATGTGGGACGCCGCCTCAACGTGGCCTGATGAGCGGTGCCAT
GTCCGCACCCAGGATCCGAACCCTGGGCTGCCGCAGCCGAGCAGGCGAACTTAACCACTC
GGGCACGGAACCAGCCCCTGTATTGTGTGTTTTGAAGTTGCTAAGAGAGTAGATTTTAAA
AGTTCTCATCACAGGAAAAATAAATTCTGTAACTGTGGTGATGGATGTTAACTAGACTTA
TTGTGGTGATCGTTTCACAATATATACAAATATCAAATCAAAAACGTAAAAATGAATGTG
TGAGTAAATACCTACATACAAACTTACATATGTACATAAATAGCATATGTTGCGGGTCCC
TAATACCACTTCCAGGTTTGGCAGTTTACTGGAATGACTCATGGGACTCGTCCAATAGTT
GTACTCATAGTTATGATTTATTACAACAAAAGCATGCGAGACAAAATCAGCAAAAGGAAA
AGGCAAATGGGGCAAAATCCAAAGGAAAGCAGATACAAGCATTCATGTGTCCTCTTCCAG
TGGACCCACACAGGATATGCTTAAGACCTCCTGCAAAAGTTGTAGCAGCACACGTGAAAT
GTTGTCTACTTTGGAATCTCATTAGGCAGACACTTAGTGCCCTGGGTTTTTGTTGGGAGC
TCATCCCATAGCCACCCTCTGCCTGGCACTTACAAAATTCCCAACTTTCCAGAAAGAAAG
TAGTTATTTCATATCAACCGCATTGTTTGATCAAACAGTTTAAGCACAGTGGAGCCCTCT
TATCAGTTCTGAAAGTGATGAGAACCCTCTCAAAATCTTTAAGTTTCAAGATGCCAGCCA
GGGGCCAGCCTTGCAAGCAAGCCTTTGTACGAATAGCAGCCTCCAGCCCACTATGTTGAC
TCTTCTCTGCACAGCACCTGATAGTATAGGTGCACAACGAATCATTGTTTTTATTGACTT
TCTGATTAATGACTTTTCCTTATGTGATTTACAAACCAAAGATATTATTGTTACTAAATA
CCATGGATTTGAAATGAAAAGTTGATAGACTCTGTCAAACAATGAGGCTCATTTTAGGTA
TATAATGTTTGAAATATGACAAAAGAACAAAACTCAGCTTTACAAGTTAGTTCTTCATAA
GCTAAAGCAGTGGCTTTCAAAGCCATTCAAAGAAGTTCCAAGGAGACATCTAACGTATAA
CATTTTAACGTATAATGACTTTTCCCTCATTACCTGCTTGGCTCACCAGAAAGAAAAATG
CCTCAGACCATTTATTTTTACTGCTATCTAAATATTTAAGACTTCTAGGTCATAAAGCAG
TTATTTCCTTGTGTTTTAAAATTAATGCCTATTCTTTTCCCACTGCCCTATCCATACTTC
AGATGATTCTATTCTCGTGGATGTTATGAGTCAGCTGGAACAGCAGGACTGAATCATTTC
AAGATCATTCATGTCGTTTGCCATCTTCCTTGATGTAAAAGTTAGGAACCATTGATTGAG
AGTATAAACTGTGTAGCTGTGGCCTTTCTTCAGTGGACACTTACATGGGGGTCTAATACA
TAAAAAAGATAACCTTCAGTACTGCTCTCATTGATAGCTATAGGGAAGATACTGAATCAG
AGCTGAGAATCCAGTGCCCCATCAATTCCCCATACCCACGATCTTTGCCCACAACCTTTC
CGCTTGGAACCTCTCTGAATGACTTAGAAAGCCGTTGCTTTATAAAGCTCATGAAAAGCT
AACTTGGAAAGTTGAGTTTTGTTCTTTTGTTGTTATATTTCAAATATTATATATCTAAAA
TGAATCTCATTGTTTGACAGAGTATATTAATTTTTCATTTCAATCCCACGGTATTTAGTA
ACAATAACAACAATATCTTTGGTTTGTAAATCACATTGTGCTTTGCAAAAAGCTTTTATA
TGTATTTAGCTCATTTAGTCCTCAAAACAATCTCCTGTTATAATTAGTGGCTGTCCAGTT
GTACCCCACATTGTAGAGGAGAAACTGTTTGTGCCTTATCCAAGGTCGTAGAGAAGTAAG
TGACTAGCTAAGACTACAGCCTGGTGCTTGTAATTCCCATCCAAGATTCTTTCCCCTCTG
TGCTTAATGTGTTAAGAATATGTCGAGGTATTTGACTGAAATATTCTACAGGAGAATATA
TACAGAGAATCATTTTAATGATCTGCTAATACTTTGGATGTTACATAGAGCTATAATAAT
GTGTTTAAAATTTGATATTTATCTCTCTTCTTGTCACCTTCTGTGTATATAGATTATTGA
ATGCTTTACTTCCAGTCCTAAGAAAACAGTATTGTGCTTTAAAAGAAGCTGGCCTGTCCA
ACACTGCTTTTGAGTCTGACTTCACAGAAATTGAACATTTGGTAGAAAGGAAAAAAGTGG
TGGTTTGGGCTGACCAAACTGCTGAGCATACAAAGCAAAATGATCTACCAGGGATTTCTG
TTCTCATGGCCTTTCCGCAGCTTGGGCCAGTTCAGCCTGCTCCTTACTGTAAGTACAGCT
TTTATTAAGTAAATTATTGTATGATTTCTAAAGAGTAGCCTCGTTTATATATCAGTCTAC
AGAACAGTTTTTTAATAGGTTTGGCTATTTTGTGAGAATTAATGGGGAAATTAGCTTCAG
AATCATTTCAGTTAACTAGTGTCTTTCAAAGGTCTAACACCAAATATGCTTGATGTTCTG
AATAACTCTACCAGTTATTTCATTCATTTTTTGTTGGAATAATTTCACCTCCCTCCTTCT
TTAAAATTTAACCTCTGTTGAGGACTAAAGATTACAATTAAGAATATTATATTGTATAAT
GCATAATCTGTTCTTAAGATCAACTAAGAGCATAGAATTTACTCTTATACTGTTGGCAAA
TCACTTGATATCTCTCCTCATAAAATTGTGCATGGGACATTTGAACATGCAAAACTAATG
TTTAAAAAGGCAATATAGACGTACATACAGAAGTAGAATGCTCCCTTTGACTTTCCCTAG
AACCTCAATCTTGTATCCTATCTCAGAGGTAAATGCAGTTAACCATTTGGTTATCTTTAC
ATTTCAGTGTGTGTGTGTAATATTTGTATTACTCTAACTCTTTAGCTTTTTGTTAGGTTT
CACGTGAATGCTAGCACATTATATGTATTGACCTACAATTTTCTTTTGTTTGTTTATTTA
GTTTATTATTAACATTTTTAGAGTACACACATGAAGAATCTACCTTATTTTTTTTAACAG
TTATGAGAATCCAGAGAATAGATGTACCGTAATTTACTTAACCGTTGTCCTGTTGATGAA
CAGTGCATCAGAGTGTGACTGTATATTCACATCTGTGCGTGTGTTCCAGATTCCTAGAAA
CTGATCGGCTGGGTCAGAATACAAATAATTTTTTAAAATGTAATCTGTCAAACTCTCCAA
AATTTTTCCTATACCAAATGTGTATTAGTATACGTCTCATCTTTACCTTAACTCAAATAA
TAACAATACTAAACTAGTATATATTCTTTTTTAAATTTTCACCTCTCATCTCAGATTACC
AGTGATGTTTTTCATCTTCTCTGAGGTATCCTTTGCTCATTAGAGTTGGTAGAGTTTGTT
TGTTCTTTTTGTTTTGGGTTTTTTTTTTGTTTGGACTGCTTTAGTTTCGCTTCTGGTGAC
AGCTGCCCTCCTGCTCCGCTCCCTCACCTCCAAGCATTTCTGTCTTTTTGGAAGTCTGGA
TCTTCCCAAGGCTCTGCTCTACTTTTCTTTGTTTCTAGTGCTGATGCTAGGAGGTCTCCA
CTTAGTTTAGAGAGTGCTGACTTACAGTACGGCACCACAGTTGCTCTCTTGAGCAGTCAC
TCTGGTAGTTATTGTGGATAATCACCTCGTAGTCTAGTCCCTATTCCTTTCGTCTTGGTT
TGCAGATTGGGGAAAAGCAGTTCTCATAGACATAATAGCAAGGGTCTTGATTTTTCTCTT
CTAGTTTTTCCATTGATCTGATCCACTTGCTTTCCAACTTCCAAAAATTACCCAGTTTTT
GCTGTTGGCGATTATTGCATTTTTCTATCACTGGATGTTATGTCAGTAAATTTTAAGAGG
GAGATGAGACAAATCTCTGTAGACTTGTATTTGATTTTATTTATTAGTATGATCCCTTCA
TGTCAGAACTATCACTCAAATATTTGCTTTGTTTTTTTTTTTCTCTTGGATGTTTGTTTT
TTGTTTCATTATGGATTTCGTTTTCTATTTCATTTTATCTGCTCTTTATTGTTATTTTTA
TTATTTCCTTCTGCTTTCACTAGATTTATGTTGCTGATTTTGTTTCTAACTGATAAAGAT
AAATGTTTGTTCATTAATTTTCACCAGATTTTTCTAACTTATGTCCATAGATTTCCCTCT
AAACGCAGCTTTAGCTTCATCCCACAAGTTTTGATACGTAGTATTTTTCATTATTTTTTA
ATTCAAAATATTTTCTGATTTCTATTGTAATTTCTTCTTTGACTCACGTGGGCATTTCTT
TTTGTTGAAGAAGAAGATTAACATTGAGCTAACATCCACTGCCAATCCTCCTCTTTTTGC
CGAGGAAGACTGGCCCTGAGCTAACATCCGTACCCATCTTCCTCTACTTTATATGTGGGA
CGCCTGCCACAGCATAGCTTGATAAGCGGTGCCTAGGTCCGCGCCCAGGATCCAAACTGG
CAAACCCCAGGCGGCTGAAGCAGAGAGCATGAACTTAACCACTATGCTACTGGGCTGGCC
CCATGTAATGTATCTTAATATCAAAAAGCTATGGCAAATTCCAGTCTATGTTTTGGTTAT
TGATTTCTAACTTAACTGAATTATGTTTAGAGAAAAAGTGCCCAGTATATAGTTAGCCTG
TATAAATGTTTTAAGTATGCTTTTAAGGAATGTATATTTTGCAGTCATTGATTGCAATAT
TCTATGTAAGTCAGGTCAAATTGGTTATGTTCTTCAAATCTTATTCTTACTGACTTATTT
TTTAATTCAAGTTCTATCATATACTGAGGAGACCTATTAAAAATTTCCCCTATTACTATG
GATTTTTCCATTTTGTATCAGTTTTTTGTTGCTGCCCTAACAAATTAACATGAACATATC
AACTTAAAATAACACTGACTTATTGTCTCAGAGTTCTGTGGGTCAGAAGTCCAGCAGGCT
CAACTGGTTGCTCTGTTAGACTTTCACATGGCCAAAATCAAAGTGTCAGCCAGCTGAGTC
TTATCCAGAGGCTCTGAGGGAGAATGTGCTTCTAGGCTCATTCTAGTTGTTAGCAGAATT
CAGTTCTATGAGCTGTCGGGCTAAGGTCCCTGTTTTCTTGTTGGCTGTTGGCCAGGGTCT
CAGCTTCTACAGGTCACCCGTATTCCCAGGCATGTGGCCCTCTTCATCACTTCATCTTCC
AGCCAACAAAGGTAGATCAAATTATTCTCATGCTTCACATCTCTCTGACCTTCCCTTTTG
CCTCCTCTCAGCTGTGTAAAGTTAGAGAAAGTCTTCTGCTTTTAAGGGCTCATATGATTA
GATTGGACCCACTGGATGATCTCTGTCTTTAATTCTGTAACCTCAGTTATATCTGCAAAA
GCCCTTTGCTATGTAATGTAATATGTTCCCAGGCTCCAGAGGCTAGGATGTGGACATTTG
AGGGGGAGAGGGTGTTCTGTCTACTGCTCATTTCTTCTTTTAGTTCTGTCAATTTTTGCT
TTTTATATATTGAGATTATATTATTACATCCATATATTTCAGAATTGTTACATCTTCTTT
TTATTATAAAATGCCCTTCTTGTAATTTTTCTTAACTTTAAATTTACTTTGTTTAATTTT
TTGTCAGGGGGGTGGAGGACGAAGATTGGCCCTGACCTAATATCTGTTGCCAATCTCCCT
GTTTTGGCCTGGGGAAGATTGTCCTTGAGCCAACATTTGCCTGTCTTCCTCTATGTTGTA
TGTGATGCCTCCACAGCGTGGCTTGATGAGCGGGGTGTAGGTCCGCACTCAGAATCCGAA
CCCTCGAACCTGAGGCCACCAAAGCAGAGTGAATGCACTTAACCATTATACCACCAGGCC
AGCCCCTACTTTGTTTAAAATTAATATAGCTACCCCACTTTTCTTTTGCCTGGTGTTTTC
ATGGTTTATCTTTTTTCCAATTCTTTCACTTTAAACCTTTCTATAATCTTATATTTATTT
CAGACATGTCTGTTATAAATAGCACATAATTGGGTTTTGTTTCTTTGTTCTGGTTTGTTG
GTCTTTATCTTTTAATTAAACTGTTCATTCTTTTTGGTAGTTGATGAATTTAATTGTTAT
TTGGGTTTAAATCTACCATCTTATGATTTGCTTTCTAAGTGTATTAATTATTCTAAATTT
CTTTCCTTCTGAAGTTTCCTTTGAAATGATGGAATAATATTTAATATTCCATTTTTTCAC
CTCTGGGAGTTTGGAAGCTATATACTCTTTATATTCTTTTAGTAATTACCCTTGAAGTAA
CATTATGTATCCTTGCTTTATCAATGTCTGTCACATGACTATTTCTTACCTCCACCTTCT
TCTCAGTGCTAGAAATTTAAAATTCTTTAACTCCATTAACTCCTCTCCTGACATATATAC
CATTGTTACTGTGTATTTTATTTTTCTATATATATTAAAGCCATATTATTTTTCTTGTCT
GTACAGTCAATATTCACATTTACTTTTTTGTTGTTCTACATTTTTTCAGCATCTCTGCTT
CTCCATCCAAGATCATTTTTCTTTCATCTAAACAACGTTTTGCATCTCCTCTACAGTGGG
TATGCTGATGACGCATTTTCTTATCTTTTATATGTATAAAGATATATTTATTTTACTTTC
TTTCCTAAAGACTATTTTGCTGGGTATAGAATTCCAGTTTGGTGTTCTTTTCTTTAGCAC
TTTAAAGATAAAACTTTGTCATCTCCTGGCTTTTGTTGCTGCTGTTGAAACCAGCTTCCA
TTCTAAGTGTTGCTCCCTTATAATCTGACTTCTCTACCTTCCTAAAATACTTCACCTTTG
GGTTTTAGTAGTTTTGCTATATTGTGTTGATGTGATTTTATTTCTACTTCTCTTATTTGG
GCTTATAGAACTTACTTTATTTGTGTCTGCATTATCTTTCATTAGCTTCGTAAAATTCAA
ATTATATCTTCAAATATTACTTCTGCCACTTTTGCTCTCTCCTCTACTTCTGAGACTCCA
ATTATATTGCATGGTACGTTCTCACTGTCTTGTCAATGCCTTTTACTTTCTCCTGATTTT
CATTGTTTTTTCCTCTCCCTAGAAATTTCTTTTCCATATTCTGTTTTTCTCTTTTCTGCT
CTGTCAAATGTTTCTTAAATCCATCAAGCTCTTAATTTCAGTTCTAGAATTTCCATTTGA
TTCTTTTTTATAGTTTTCATTTCTTTGCAAAAGTTCTCACTGAACAGGATGGATGTACTT
GTTTTCAAGTCTGTGTCTGAGAATTACCAAGTCTTAGAACCCTCCTGTTACCTCCTTTTG
CTCTTCTTTCACGTGGTCTCAGTTCCTTGAATGCATGCTAATTTTTGTTCATCAGACATA
TATTTGTGAAATCGTTCATAGAAATACTTGGAGGCTTCTGATAATAATGTCTTCCTTCAG
AGAGGATTTATATTTGCTTCTTCCAGGTTCCTGGTGGCATTAGCAATGCAAGATCACTTC
AGCCCAATTTTAGAGATCTTGAAACTGAACTGCAGCTTCTTCCAAGGCCTGCAGACCACT
GATTTACCCTCTAGAGCATAGCTGTGCAGGGTCCCAACTCAAAGTGAAGTGGGTTTTCAA
AGAACTCCCTTTACTGCGCCCTAAATTCCGGTTCCAGCACCCAGTCCTGTAAAGCTCTCC
ACAATGTTGCTAAGCTTTTCTGCCACCTCCTCCAGTGTCAGCAAACAACCTCAAGGGGAA
AATAGCTGTGAATGCAGAGGTTACCTTCCTGAACCTCCACTTCCTCCTGATACTTGCCTG
TAATTCTTCACAATCTCGTTAGCTCTCTTGTGCCTTCAAGCACATGTTTTTTATATTTTG
TTTAGATTTTTTAGTTGCCCTCAGTAGAGAAGTTGGTCTGAATTACCTAGGTCTCTATTA
TTTAAGTGCCTTATATATTTTTACATTAAGATGACAAAGAAGTTGGAGATATACATATAT
CTATATATCTCATCTTATTCTGTTAATAAAGCATTATCGTCATTAGAACTGACCTAGTTG
AGATCTTTGGAAAGAAAACTTGAGTTTTTTTCAGATTCTCTCATACCTTTTGGGCCTCTG
TTCTTTCTTTATAATGTATTCAAGATGTTGGAGAGGAAATAGGGTTTTAACACCAAGATT
GAGAAATACTGACCATCTGCTATATGATGGTCATTATTCCTTATTTAAAAATCCGTATTT
CACTTACAATGTAATTGCACAGGCTATACTTGTCAACAGTAAAACAAAACATTTATTTGG
CTCTTAATTCCTTTTCATAACATTTTCAAAAGGAAAGACTATTGAAGTCATGTTACATTT
TATAACTCTGTATTTTCTTTTGAAAACATATCAGAAAGTGGGTTTTGTTTTTATGTTTTG
TTCTTAGTTTATTTTAACATTTTGTTCACGTGATTTCATAGATTAACTGTTTGCTTAACG
CCTTGTCCATTCTGTGTATTATGTATGCTGTATTCATTATGAATAGAAAGTCAAAGATGA
GTAACAGGCAAGGGGAATAAAGGGAGTCCACTTATAAATATTTATTTTTCTGAGTCTTAG
AATATTGAAGTAGTCCATTAAAAAAGTGTAAATAGTAAAATCTATGTTTGCATTTCTAAA
GACACAAAGCAATACCAAGATAGCATATATTGCTTAAAATTATACGATAAATGGTAGTCT
TACTAAATTTTAGAAGTAAAATTGAAGAGATTTAACTTAAGCAAAAACATGAGTAAATTG
TGTCCCATTCGTCTTAAGCTTACACATATGTCACTGACTTTTCCCTGTACTCTCATAAGC
AGGTAATGTCAAGTGGTTTGTTGTTAAATTCCAAAAATACTAAATGCTGTGGGATTTGAA
TTTTTTTTCCTGGTGCTTTAGGAACCTTTAAAGAGTATATACTACATCAGTTGCATTCTT
TGTATTTAAAATGCACACATACTATGCTTTTAAAAGTCTGGCAAGATTAACCATAATTAA
TTTGTAGTTTATCGTTAGGCATTTAGGTTGTTTAGTAAGTTATCGTTATTATAAATAATA
TTGCAGTAAGCAAATATGCATATTTATCCTGTCTGATAATCATGTCTGATTATCCCTATG
ATAAATTCCTAGAAATGCAATTTCTGGCTCAAGAAATACACACTTTTTTTTAAGTTTATA
ATATATCCTGCCAAGTGCCCCTCTGTCATGTGATTATACCAGTTTAACTCCCACCAGCAG
TGGAAGAAAATGCTTTCCTTTCTCCTTTGAGCCTCACAAGCTTTTGGTGTTAAAATAGTT
TCAATTTTTAATTTTTAGAAAATCATTTTCAAACATGTAGAAATACAAAGAATACTATAA
TGAGCCCCATGTGCCCATCACCTAACTTTACGAATTATCTCATGGCAAGTCTTGAAAACC
CCATCTGCTTTCCTCTACCCCGTCTACATCTATACTGGATTATTTTGAAAGAAATCTAAG
CCTTATTTTCTTCCACTTACATCTTAATGTTTCTAAGACAAAATGCAATGCCCTCTTCGT
ACCTAATATCATCAAACATAAAATCAGTGTTCAGATTTCCCCCATTGTCTCATAAATGAT
TTCTTTTTATAGTTTTTCATATTAGTAACCAAACAAGAACCATACTTTGTCATTGGTTGA
TGCATCTATTAAATCTTTCTAAATCTGGGGTTCTCTCTCCCTCTTTTCTGTTTGCTAATT
ACTTATTGATTCTTTACCAGTTAAGTAATCATAAATATTATCTTCTTTACATTTTTCCTT
TGTTCACTAATATAGTTGAATGGCTTTTTTCTTTCATCTATGTAAGGCTCTGTTTTCTTG
TCTGTGGATGACCTAGCCATCATTTGAACATTTTTCTGGCATAGTCATCTTTTGTAAAAA
TTGTTGCTTATTTACAAGAGCTTAAGATACAGATATTTATTCGTTCATTCAACAGTATTT
ATTGAACTTCTACTGTGCGCTAGGCTCTTACCTGATACTAAGGATGCATCAAAGTACAAA
GCAAACTTTCTCACCCTTGTGGAGCTTACATTCTAGCGCTGGGAGAAAGACAATAAATAT
GTTAAGTAAATTAAAAAGTCTTAGAAGGTGGTACATGCTAAGGGAAAAGAAAGAAAGGGA
GTTCAGGAGTGGGATGGAGGAGAGGTTGCTACTTTATAAATAGCATGGTCAACATAGCCC
TCACCCATCAAACTTGAAGGAGTTCACAGGGTTAGCCATGTGGATATCTGGGAGAAGAGT
CATTTTCAGCTTGAGAGAACAAGCAGTGCAAAAATCTCTTAACACCAGGTGTTTGTTTGC
CCTACTGAAGGAATTTGGTGCAAAGAAAAAGAGAAGGAAAGTAGACAATGATGAGATCAT
AGAGATAATGGGAGGAAGGCAGATCACATAGAACCTTGTGGGTCATTGTAAGGACTTAGA
TTTTTACTCTGAACAAGACAGGGAACCATGGCATGATCTGAGTGGAGAAGTAACATATCT
CAGTAATGTTTTAAACTGGTGCCCCTGGCTGCTGTGTTGAGAATAGATTGTATAGTGTGG
CAAGGGTTGAAACAGTTAGGAGACTACTGCAATAACCCAAGTAAAAGATGTTGGTGGCTC
AGACCAGGTTGGTAGCAGTGGAGTTAGTGAGAAGTGGTCAGATTCTAATATATTTTGAAG
GTAGAGACAGCAGGATTTCCTGACAAATTGGATTTGGGATGTGAGAGAAAGAAAGGTCAA
GGATGACTAAGATTTATGAACTTAGCGACTGAAAGAATCAAGTCACCTTAAAAGAGCTGG
GGAAGACTTCAGGTGGAGCAGGTTTATAGGGTAGAGCTAGGGAAGATTAGCAGATCACTT
TGGGGTGTTTTAAATTTGTCTAAGATACATCCAAGTGGAGACATCATGTAAGCAGTTGGA
TATAAGAATCTGGAGTTTAGGAGAGAAGTCTAAACTGAAATATAAATTTGAGAGTTGTTA
ACATTTAGATGATATTTAAAGCCATAGGACTAGATGAGATCATTAAGGGATATTAACTCT
TTCCTGTAAGATACATGTTGCAAATACATTCAAGTTTATCATTTACTCATAACTTTGTTT
GAAATGTCCTTTTTAATACTGAAATTTTAAAACATATCATAAAATAGCTTTATTTTTTCT
CTTTCTCTCTGCCTCTGGAATCATTCCTCAAAAGGCTTTTTCATCCATAAGGTTTTAAAG
TGTCACTTCCTTTTTGTCCTAATTTATTTTGATGTAAGATAACAGGTAAGAATCTAACTT
ATTTTTTTCCAAAGAGCTTGTTATTCTTGTATAATATATTGACAATCCATCCTTATGATA
CCTTTGTTTTACGTACAGTAAGTAGTCACACATAATTCTGTTTATTGGATTTCTATCCTA
TTTTTTTTGCCTATTTGTCTCTCCTGGAGCTAGAAGCTATTATTTTAATGACTGATATTT
TTATAGTGCTTTTCAATATATAGCAGTGCTAGTCCCTCTTAGTCTTTGTATTTAAAATAT
TTTTGGCTGTTTCTGACTAAAAAATGGATGTTAGAATAATTTTTTCCAATTCCAAGGAAA
TAAAATCTTTTTAAAAATTTATAAATTAATTTTATCTTCACATTTTCTGCCATCAAGTCT
TCTTACTCTAGAGTAGTTTGTCCCTCCATATTCATATCTTCTTGTCTGTTCTTCAGCAAA
GTTTTAGAATTTTGTTCGTGTGCCTTGTACATTTGTTATTAAAGATATCCTTAATATTTT
ATATTTTGGTTATATGGACTATTTTTATTCTTATATTAATAAGTATATTATTTCTTATTC
AAGAATAAACCAACTTTTTAAATTTTGTTAATTTTAATACTTTACCAATGTCAGTACTTG
GTTTTGGGATAGATGTTTATTGGACTTGAAATCTTTGCCTCCAAACTGCGTGTCTATTGA
CTTGGAGTAAAACATGTACCTATTTTGGGTCTGGAAAACAGAAAGTGCACTCACTGAGTG
CCATGCAGGGTGGGGGTGCTGGCAGCAAGGTTTATTTATGGAACTGATAAAATTTCTGAC
ATTAAATGAAAAGTCAAGATTTCCTCGTTATCCATCTGGAAACTCACATTTAGTAATATT
TCTGTCTCTAACCTTTCCTTTTCTTAAATTTTGCACCCATGTCAGTGGTTTTATCTTACA
GATTGTACAATAAAAGATACCAGTAGAACCAGTGTCTTAGAGTACAGATATTCTGATTGA
ATCTAGAGTTCCAGTGTAAGTTTAGGTTTCCCCTTACTTAAATACATGGAAATTTCATCT
AAAAAATAGGAAATCTCTATGTTAGTTCCTCATATAACAAATATGAAGCAACAAAAATGT
TTATAAACTAAATCTTCCATGTGTTTTCCCATTTGGCAACAAAATTTAATCATTGTCAGT
AGACAATGGAAGTCATGCTTGTAGATTTCATTTGGCCCTTAGTCTCCTTTTACACAAGAC
AGTGTCCACTTGTTATCTGTAACTATAAATATTATAAATTATAAGGTTCTTTGCACTGTC
TTTTTTTATTTTTTTTCCCATCTTAAATAAGCATGAATACTAGGAAAATGAGACTGAGAG
GAAAACATGGTATCTGCTGCTCTTTGTAATAATTGTAAATAGCTGATATTATCTGTATAG
GCATTAATACTAGAATAACCAAAATAGTTTTTTATGAATGCATTATAAAATATTTATTCA
TTTGGTTAATTCAGTAGTACCTTAAGGTTACATATCTTTTAAATGGTTAAAATTCATTCA
CCTGTATCATTTGCAACTGTGAATTCCATGAGTCACAAGGCTGTTAAAAAGAATCTAGAT
TTATGATTAGTACAGTAATTGTATCAATCATTTGTAGCCTAGAAGTGTTTATTGAAATGC
ATATATTAATATTTGATTTTACTTTAGAACTTTGCCAACTAATGTTAATTTAGCATAGTT
TCCCAAAATACCTCCTCACGTACATATTAACATGAGCGCTAGCAAAAGAAAAATCCTTGC
CAACATTTTCTACCAAACCTCAATTAGATCTAATCCCATTCATCAATGTCTCCCTGTCAT
GAACCCTACTTTGCAGCCGGTGACTCATGTTTGCTAAATACTGCATTCTGCTTTTTACGC
TAACGTACAGCTCTGTAAATCTTTTAACGTTTGCAGTCTTAAGCTTTTGATGAATTAGTT
CCTCTGAGTAAAATCATTCAGGACACATAATATGGCACATCAAAATATGACCCCAGAAGG
CCTGCCCATTTTTTAAGAGAGGGATTTTTAACTCATTAGTGATAAATTATCTAGTCTCTT
TACTTAAAGGAGAACCAGCTGTGGAATATTTCAAGGAGCTAAAAAATTAATATTGACCCC
CTCCTACCTAAGAAACCACATGAAATTGCCAGTTAGTACTTGTTTTAGAGATTTATTTAA
AACAGAGAGAGAGAATAGAATGATGTTTTTCTTAGTTCAGTTTATTTTAAAACATTTTGA
GAAATTTGATGTAAGAAATGAGTAATTCTAGTGCTATCTAAACTTGTTTCCATTTCTCTT
GTCTCTCCCCTCTGCGATCTACCTTTCACACTAAAATGATCTTCCTGACAAAGCACAGAC
CTCCTGCTGAGGAGAGCCTCAAGAGCTTTCCCAGTCTAGTGTCCAGCTGCAGAGGCCCTT
GGTGTCCAGTCTTCCCTTAAACGTGCTTTCTCTTTCTTGCCTCTGCAGTTTCCAAGCTTT
TCCCTCAATCTTGAATGTTGCTTCCTCTTGCTCCGTTCCACCTCCTAGCCCATTAAAGTT
CTTATTCTCGTTGGGAGTCCAGTTCAGATACCGCCTTCTTTATGAAGCCTTCCTTTAATG
CGTCCTCTCCTCTTTGCCTGCACATGCTGTTTTGTGTTTCTGTTGGGTTTTTTATTCCAC
TGTTATAGCAATTACCTTACCTTTCCTCCTCCTCCAAACTGTAACTTCATTCACAGTTGG
AGCTTTTTCAATAATTCATTTTTAAGTTTATTGCTCCTTTCACTGATGTTTTAACCTTGT
TATTATCTTAGCAATAAATGTTCATTTATTTTAATTAGAAAAAGTCAAGCCAAAAGAAAT
AAGATATTTTCCATTGGCTTCTGTTAATATTTTGTTTTAGTAGCGTAACTGGACATTTTT
TCTGAACATGCATATGTAGTTTGGATTTTGTAAACAGAAAAGTTGAGGTCTGTTTTATAC
ATACAGTTAGATAACCAGCTTGTTTTCACTGAACCACTAGTTACATGTACAGTTTCCTAT
CAAATAGGAATTTGTTGTCTTTAATAACTGTGTATCGTATTTACCTAACTCCCTGCTGCT
GAACATTTTGTTTGTTTTCGCTTTATTGCTGTTGTAGGCAACACTCCACCAAACTTCTGT
GTGTGTGGATACATTTTGCAACTTGTCTAATTTCCTTAGCCCCTAAAAGGTAGAATAACT
ACATCAAAGGGGATGTACATTTTTAAAGTGTTTGATATATATTCCCAAGTTATTCTCCAG
AACTATTATAACTGTACAGTCTACCACTTTAATGGGTAATGAATGAAGATGAATTTTTTG
TGTGTGTTTTTGTCCAATTGTAGTTCATTCTGAATTAATTACCTGTTTATTTCATTTGCC
TCATTTTTCTATCTTTCATTTTTCTTATTTTGTAAGAGTTCTTTCTTGATAGATGACCGA
TCACACATACGCATGTGCATAGACATACATATATACACATACAAGAGCTTTAAACCCTTT
GCCATATGTGGTACATTTTTTTCTTTTATTCATGTGGTTTGTAATTTTTATGTAACTCCA
TTTTTAATTATAAATGTGTCCGTATTTCATTCGCGCTTCTGTGCTCTTTCTAGTGGTAGG
AGTCAGGAGATAGCCTCTCAGTTTGGGAGGGATGAGATGCTGTATTGCCTTCTATTCATA
TTTTTGAGTCTGTGAAGAAAATTTTATATTTTTAAGTCTTCATCGTAATTATATATGTTA
TTACTTTGTGTTACTTGGTTTCTTTACCTGTCTTTCCCCTGCTAAATCAACAAGAGACTT
CAAGTTCTGCCAACAACAAATATGATTGATATTATGACTTCGAGCATGTCACTTTCTTGC
TATGAGCAACAGATTATAAAATAAGAAAATTTAAATGAACATTAAGATCATCTAGTACTA
AATCCTGGTTCTGTGTATGATATGATCCCCACTCTGACTTTCCTGATGGTCTGTAATTAA
TCAGGAATTAGAACCACCATTTTAAAATGGGAATTCAGTAAAAAAATATAGATTGCTAAA
CTGCATGATTTCTATGACATAGGAATGTCATAGTTAAGGTAGATAAGCATCTATATTACT
TGGGCCGTTCATTTCTGCTACTAGGAAACATTTATATGTAAGTTCTAAGTTCCCTTTCCC
CTGTAATAGGCACTTGGTTTAAAATTATTTGGATGTGACTTGTCATTAATAATTCATTGA
TTTAAAGGGATTTCTTAATAATTAAAAGAATCGTTTAAAAGTAAAAATATAACGACATTT
CTTAAAACTATCTTTAGGAAAAAGAGATATAAAACAACTGTTTTTTTCTATTTTCTATTG
AAATCTATGCTGGATAACTTATAATAAACTTCTAATATTTACTTAATATTTCTAAACAGT
GTACTTATACTGCTGTTTCTTGATTCATCTGTGTTTAGGTGTTACCAACCTCTCATTCTG
GGAGATGAAGATTTAGCTCGTTTACACCACCACTTTATTTCACCTTCCCTGACCTGCTAA
TGTGCCAGGATATTCTGTAATATATAATCATCTTAAATTGTATAATATCCTTGTATATTA
GCAGAAATATGTAAGAAGTAGCATATGTTATATATATTAAAATATATATACAAATATTCA
TGTATGTAACATTTAACCCAAGGGCCTGCTTAAGGAAAATTTTTATAATAAATAAAAAAT
AAATATTATAAAAAGTCTTTTAAAAGTAAGAATATACTGACATTTCTTAAAACTACATTT
AGAAACATAGTCATGAAACAACTCTCTTTTTTCCTGCTTTCTGCTGGAAACATTTCAAAG
TCCTCAGCCAAATCTGTGGGATAGGCTTCTTGGAGAAATGAAATATTTGAAAGATAGAAA
TAATGAAGTAGACTAGATTGTGCTCACGGGTGGACTTAAATAGCTTAAAGAACGATGCAG
CCAATAAGTACATTTTTAGATGTTTCTCTTGAGGTATAGGCAGTCAACTTCTCAAATGTC
TTTTTCCTATACTTCTTCATGAGACTGTCCTATATTTCATTAACAAAGTCAAAATATCCT
ATTGATTGCCTATATTACCCTGCCATTAGTTGACTATGTTCTTTAAAATCGCAGAAGTTT
GGGGAAGAGATGGCAGTGGCAGATTAACATCTAAACTTTGGTTAAGTAGTTAGTGAAGTA
AATAATCCTCAAATATTTATTCATAATTTCTTTTAACCACTTAGCAAATGTAATTCAATG
CAGCAAGCAAATGAATTCTTATTTCTTTGTTTTTCAATGTTTTTGTTTTTATTTTAAGCT
GTGGCTTATATTAATAACATTTTATTCTATACAATACTACACAAACTGCACAAATGTTAA
TATACTTATGTTGTAATCCAGGTATCATTGTGTTAGAATCTGGACTATTATTGATAAAAG
CTGTATTTTTTTTCTTCATCTGATTCACACTTTAGTGCTTGCATTTAGAGTTAATTTTAA
AAGTGGTTTTAATACTTAAAAGTTTTTTGAGAGGATTCTAAAACTTGGCAGTCTCAACAA
AATAGTATTTTTTTTATTTTTCTTTTTTAAAGATTGGCACCTAGGCTAACAACTGTTGCC
AATCTTCCTTTTTTGTTTTTTAAGGATTGGCACCTGGGCTAACAACTGGTGCCAACTTTT
TTTTTTTCTGCTTTGTTTCCCAAATTCACCCCTCCCCNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTAGTTGTATATCTTAGTTGCAGGTCCTTCTAGTTGTGGGATGT
GTGATGCCGCCTCAATGTGGCCTGACAAGCGATGCCATGTCCGCGCCCAGGATCCGAACC
CTGGGCCACCGAGGCAGAGCACGCGAACTTAACCACTCGGCCACGGAGCCGGCCCCCTCA
ACAAAATGTTTTTGTCTGACTTCCGTTTTCAGTCACTCTATGGACTTAGAGTAAACAAAC
TTTTTGAAACGGGAATCTCTAGCCATAATGCAAGAACAGATGAATAGAACAGTAACCACT
TTATCCTGAAATGTGCATTTTCAGTTGTATATAAGATGCTTTAAAGCATCATATAAATAT
TTTAAGATGTTTCCTAAACTATTAATGGATAAGTATTACAAAGACTAGGATTAGATTTAT
TAGACAAAACCTATTGTAGGGTTTAAAAGAGATGCTCTATTGTATCCTTCAGTAGCTCTG
TCTTTGATTATTTTTCAACTCCTGGTTTGAATTGTAACACATAATCATTTTGAAATGTTA
TATTATTTAATCGGATAACCTCCGCTGCCTACCCTCTTCCCTAAACTAGGAGTTTATCAG
TGAGTCTCTTGCATTGTTTATGCATTTTTCCTAAATTGTTTTAAGAAAAGCTTCATGACG
CTAAAAACAGTATTCAGGTGCATTGTATTGTGACTTCATTAGTATGTGACTTCAACTATG
TGAAGTATTGGTAAGTCTAAAGAGATCTTCTTGTATTTCAGGATAATTGTATGAGACCTT
TTAAGTAAAGCAATACCAAAGTTACTTTTCGATGAACAGCTTCTCTCCAGGTAGTTCTCA
AACTGTTCTTTAGAATTATATATAGTCTGGTTAATTTGAAAATAGTAATAGAAATTCTCC
TGATCCTTAAAGTGGCATCCTCTCTGTTTAATCATCTGAATATTTCTCAACAAACCTGTA
AAGAAATTAAAATATATCTTGTCTTCATATGGAATCTAAATGCGAAGGCAAAGATAGGTA
TAGGAAATATAGATAGCTAAAGCTGGAGATTTTTGGGACACTTAAAATATCTGAAAGCAA
AACCGATTAAACCCATGTCCTTTTACAAAATGTGTCTTTTATTTCTTAGAGTTTTTGCTA
CCCTAAACTTTATTTTTATTTCTATTATTCTCTATAAGCTTTTCAGCATATCAAAATTAC
ACATGCTCATGTTCAGATTTCACAAGTGGTTTGCCTGTTCCCTGAAGAAATGAAATTTTC
CTTCATTCCTGGGACTCGTGACTTTAAATCTGTTCTGCCCATTTCTTGCCACATAGAATG
ATTTGTTTCTGATCATTGATTGATTCACATTTTTATTAGCCCTCTTTAAATTCCACTAGG
TAGGTAGTTGTCCTGTCTTCCTTTTCATTATATGCTAGGAAAAGCATGAGTAGGGGAGGG
AGGTGGTAAGCCAATGGAGAATGGGGCTAAACAACGAAAAGATCTCTCCCACCTTCCCTA
GGCCTGGAATATTCATTTTGCTCTCCTATTTGATTTCCCATTCCTATTTGATTGCCCATT
CCATTTCATCGTATTTGCTTGCATGTTTCTGTTAGACTTTTGACTATGAATCTTCATAGC
CTTGGCTAGATTGACCCCACTTATTCACAGAGTCCACAGATTTTGAGTAAAGTTGTCTCA
GGAGAAGCAAGAGATATCTTTCGGTCTGCTTTTTTCCTTTATAGCCCCAAAGTTTGATTA
ATTTCTTTTCATTAAAAACCCCTGCATTTGTGTGCGTGTGTCTGTCTGTCTCTCCTTCTC
CCCCTTCCCTCCTACTTTTTTTCCCCATCTCCACCTCCTTTTTAAATTCGGTTTATATTT
TTATAAAAGTGGTACCTGGGGGCCGGCCCCGTGTCCAAGTGGTTAAGTTCGTGTGCTCCG
TTTCAGCGGCCCAGGGTTCGGATCCTGGGCGCGGACATGGCACTACTCATTAGGCCATGT
TGAGGCAGCGTCCCACATGCCCCAACTAGAAGGACCCACAGCTAAAATATACAACCATTT
GCTGGGGGGATTTGGGGAGACAAACAGGAAAAAAAAAAGAAGAAGATTGTCAACAGTTGT
TAGCTCAGGTGCCAATCTTTAAAACAAACAAAAGAAAAAAGTGGTACCTGTACATAGTTT
AGAAAGCTAACACATACTATACTATTTGAGGAAATATTTCTTGCCCTATTACTGCCCATT
CTCAGTTCTTATTCCCCTTTTAGCTGTCTCTTCTGATTTTTCCTCTTAATTTCTAAATTT
CAAGTTTATACTGCTAATTCTTGTTTGTGTACATTTCCAGTTTTAGATATCATCTCATTT
TGGAAGGTAAAGATTTAACTCCTTTACAGTATATATGCATTTCCTCCCCTACTCCATCTT
GCCAAAACAGGTTTTTACCTTTTTTCAAATAAATCTCAAGTGTTTTCAAGAAAATATTGT
TCCCTGTTGAGCCAAGAAGTGTGTAAATTCTTTCTTGTGCAGCTTTGCAGTTTCTGTATG
TAGTATTTGCCTTTTTTCCCATTCTTGTTCTTGTTGTTCTCCCTTATCTTACAGAAATAC
ATCCTCCAACAGATTCCGGAGAATGAGTGCATAGGAAGTGAAATTTTTTTGAGACAATGC
ATGTATGGCAATATCTTTATTTTCTAATAGTTTGACTAGTTATGAAATTCTAGGTTGGAA
ATAATTTTTCTAAGAAACTTGAAGGCATTGCTCCATTGATTTCTAGATTCCACTATCGCT
GTAGACTATCATGCCATTTTTATCCTCCATATTTGTGTATGACTTTGTCTCCCAGGAAGA
TTTTGGGATCTTCCCCTTATCCTTGATATTCTGAAATGTTGCCGTGATGTGCCTTGGTGT
TGATCTTTTTTAAGTCATTATATTAAACAATCTGTGGGCCTTTCTCTCTGAGACCTTTTC
GTATATGTATTTATGCACATAGGCTTCCATAGACACACATGCATGCATACATACATCTAC
TTCCACACATACTTTTCTTCCCTTCTTTCTGTCCTGTCATTGGAACACTTACTAATCTGA
TGTTGGATCTCCTGGATTGATTCTCTAATTCCATTATCTTGTCTTCTGGCGTTTACCTCT
TTTGATTTGTTTGTTCTTTCTAAGAGATGTCCTCAACTCTTTATCTTACATCCTTTATTT
TGATTTTTTTTTCCTCTCATATTTTAAATTTCTAAGAACTATATCTCATAATCCAGGGTA
TCTTTCCATAGCACTTTATTTTTGTTCCATGAATGTAGTAATTTCTCATCGCTCTGAAGA
TATTAATTATGGTTATTCTAACATACTGTTCTGCTTCCACGTTGTCTATTTCCTCTCACT
TTTTTTCCTGCATGTAGTTGTAGTGTCTTGATTATCATGTTCAAAGACATATCCTCAAAT
ACCTGGTGACCCTAGTTGTTGTGTTCTGTATATATAGTTAGGTCTTTCAGCTAATGAGCT
TTGCTTTATGATGATCTCCAGAAAAACAGTTTTGAAAAACCTGAAAATGTCAGAACCCAG
ATCTTTTTTATTGTTATGGTTTATCTACAAAGAACACTTTGAGGGGCTTGCCGGTGTCAT
AATGGTTAAGTTCACGTGCTCCACTTCAGCAGCCTGGGTTCACAGGTTCAGGTCCCAGGC
ATGGACCTACACACTGTTTATCAAGCCACACTGTGGCAATATCCCACATCCAAAATCGAG
AAAGATTGGCACAGATGTTAGCTCAGCAACAATCTTCATTAAGCAAAAAGTGGAAGATTG
GCAACAGATGTTCACTCGAGGCCAATCTTCCTCACCAAAATGAAATCAAAAAAGAAAAAG
AGCTCTTTGATTTCCCATTTAGGGGGTACATAAGCCTGGCTACAGGTATTTTAGAGAAGT
AGGAGGAAAATTTGCTTACTTTCGTTATTGAGAAATTATTTAATCCCCCTAGTGTCAGCT
GTGCATGTTGGCTGCAAGTCTATCCAGAGGGCAAAATCTCATGTCCTTTAACAGGGTGAC
AAAGGACCAGTCACCTGGCAGTATAGGTGATGGCGTATCAAGATTCCAGGAGGCTCAACT
TCCTTATACAGACTTTGAACCAATTCTCTTATTTTTAGCCCTACCTGTGCCTTCAGAGAC
AACCTCATGCCTCCAATTCAAGACTTTCTGAGACTTCACAGAACTGGGTTTTTTATTGGC
TTCCTCCCTCCCACCTTGGATATTGCTCCTTTCTAAAAGAAAATTTTGTTATTTATAATT
TTATAGAAATAGTATATATATTTGTTATTAAAAAAAAACAAATGTTTAAAGAAGCAAATA
AATTCACTCAGAATTTTTCCAGCCATAACCTATGCTAATATTTTAATAGATTATGCCATA
TTTCCTTCTGCTCTGTTTTCTGTGACTTTTACCCCCATTTTTTGCTTGCAGGTCTATACG
TGTATGCTTTGATTTGATTTTGGTGGATTTTTGTTTGGTTTTTCAAAATTGGGATAATGC
TGTATAGAAAATTTGTGTACTACTTCATTTAATGAACATTGTCCCGTACATCAGATAATC
TGTAAAACATGACTTTAAGTAGCAGTGGAATTGTGAATGTCCCATGGTTTGTTAGCCTTT
ATGCTAAGTAGTTTAAGTCTCCCTGTGGAAGAGACTCGGCATAGTGTCGTGGTGAAGAAC
ATGGCACTTGGATTATCAGAAGACCTGAGGTTATGTGCCTGCTCTGTCCTTCCTTTATAG
TATCCTTTTACTGGTCTAGTGAGCTTCTTTTATGCTTATTATAAGTATGCTTTTCCCATT
CTTTTTCATGGATCTAACAGTCCAAGGAGTATAGAAAGGAACGGGAGCCACAGGTCATCT
CAGCTAGAAACTTTGCCTCTTTGCCCAAAAGCTTCTCATCCATGTGTGGTGTGGCCACCA
ATGCTGGGAACAAGGCCCACAGGGTTGGGCACTTTTGTTTTCTCCTAGTTTTATTATGTG
ATCATTTTAAAGGGAATCTAGAAAGAGACCTAGATGCCTCTACTAAGTTGACATCTTGGT
TAAAATTGGTTGTCTTTTGCAAAGTTAACCTTCATATCCCTTCTTGTACTGTGTATGTTT
CTAAAACGAGAATGTAAGGCAAAGCCAACCAAGTGCTGGTTCTTCTACTGAGAAATTCTT
CAGTTATTCTTTAAGTGCCTTTCTATCTTCCTCCCCTATCAAAAAGAAAGGGTTCTAATA
TCACGTATGTCCTATATTATTTCATCAAAACGCGTTCGTTACAGAACCACATTTTGCATT
TTCAAGCTTCACTTGGATTAAAACGTGTTGGCTCCTTTTTAAGGAATTGAATACAATAAT
TAACAAGCTATTGAAAGTGGAGCAGTCAGTCCTTATATCTGAAATCATAGAATGTCTGTG
TCTGGCACTGAAGATAAATCTGTTTCAGTTTTTTGAGGGTGTCTAGAGATGAGTTTGCAG
AGAAAGTAGAGTGCCTGACCTAAAAAGGAGATGCCCTTTCCATATCATTCTATTAACTTA
AGTTTCCCCCTCACATTGCCCTTTGTACAACTTGCTAGGAGGCAGAGTCCATTATCAGTA
ACTTCTGTCTGCCACCGTTGTTCTAGAACCATTTCCTGCTTAGCCTCACTCCCCTTCTTT
CTGTTTCCCCTACCCCAGCATGATAATAACACCCATCATCTCAAATAAGAAATCATATCC
TCAAACCCCAAAGAGGATCTGCTGTCTCAAGTCCATGAGTATCCAAACTAGAGAAGGGAG
GAAGCAGATTCCAAGACCCCTGCGTGGACTTGGATCAGGACTTCTCACTAAAGAACGGGA
CCACATCCTGATGAGTGGGGAGGGGGAGGAGACGTCAGTAACAAGAGAATGCTGAGTTTG
AGGCAGTGACATTTAGGACCTTTTGAACTTTTCTGTAATTGTGCATGTGGAAATGGTTCT
TGGTGTCACAGAAAGTTGTCTATTTCTGTTTATTTAGTTGTGTGAAATTAATATATACTA
CACCTTTATGTAAACTCCTTATCTTTGTTCCTGAGTGTCAGACAGCTAATCACACCTGTG
TATGTCATTAAATTTGTTCTGGGTTTACTTTATGTAATTTTTATCTGATTATTTGGTTAC
AACACCCTTCCCACATCTCTCCATCACTCCTGCTGCCACTCTAGAGCAAGCTTCCGTTGG
CTCCTGCCTGAGCTGTAGCGATAGTCTTGTGACTGATTGCCCCGTTTCCTCTCTTGCCCA
TTAGTATTATCTTCTCCACACGATAAGCAAAGCAATCTTTTCTAAAGACATAAATCAGAT
CACATCATACCCATGCTTAACACCCTCCACAGATGTCCCTTTGCACTTGGAATAAATCCA
AACCCTTCTCGGTTCATAAACCCTAACACAAGCTGGCCCCTTTTGGTCTCTTTAGCCTCT
TCTAATTTTTACTCTTCCTCTAACTCTGTGCTTCACTCACACTAGCCTTCTCTCATTTCC
TCGGGCTTAGCAAATTTATTGTTGCCATTGGGTCTTTTCACTCACTGTTTCCTCTGCCAC
TCTTTCCAGATCTTCATAGGCTGACTCCTTCATAGCCATTCAAGTCTCAGATCACATATC
CTTCCCTGGCCATCACAGTTAACACCTCTCCTGTCTCCCATCATTCTCTATTCTATTTCT
CTGTTGTATTGTCTTTACAACTCATTTGTCATAATTATCCTGTTTTGTTAAGATGATTTA
TTTTTCTTCCTTCTCCCCTCAAAAAGGTAACTTCTTGACTGTCTTGTTTACTGCTATATT
CTCATTACCTAGAAAAGGTTTGGAACATGACAGATTCTTAGTATTGAGTGGATGAACAGT
GAGTTCTTTTTATGCAAGTGCTGTCCTCTTATATTGTTTCTCTTGTACCATAGCTGACTA
CATCTTTTTTTTTCATAAGTAAAATAAACATTGATGCTGGATTGAAAATAATAGTAATGA
CTTCTTCTTTTAAACGTCTTGACATTGTGGTTATTATTATTATTAGACATGAATTTCAAT
AAGTCATGTTGACTTACCTCCCATGGGTCATAACCATTTCAGGGCAATATAAATGGAGTA
TACCTATAATATGTTGGAGAGTTAAAGTCCCAAGAGATGGTCTAGAAATAGCAAAACTTT
TCAGATCATAAGATACATTGCTACCTACTCAAATATGTGATGTAGTGAGCTGGTTCCTTG
GATGGAGAGACCCTAGAGAGAAGACTTGCTATCCTCCCAAGTGGGTGCCAGTCTTTTCTA
TCCCATTTTACAAGAGCCTACCTTATAACAATGCATTTTTAATTTTTTATCCCCTCCTGT
ATGGCAGTCACGTTGCTGAGGTATTTCATTGACTACCATCATCGGTTAGAATCTCTTATT
CTGAAAGTCTGTAACTACATGATTCCTTTTCTCATCTTATGGGGCCTTTTTAAAGGAATT
ATAATCTGTCCCCCACGCTCCTTCTTTGCCATTTCTACTCTATAGGCCCAAGTATTAAAG
AATCTTGTTAGATGATATTTTCCCAGGCTGAATCAGAGGAAACTACAACTGCTCAAAGCC
TGCTCTCCTGGAAAGTTACTGTACATCCTCTGATGGAAAAGTACAGCACTTCTCTTTTAT
AGACATAGACCTAGCATATCCAACGATTCTTATAGCTCATTAAAATATACAGTGCCCCTA
ACCCATACTCTCCAGTTTCCATATCCACTTGAAGTACTCCACTACCTAACTAGCTAAAGG
AGAGTGATTATTTATTATATAATTGTATTTATGTATTCTGTAAATCATATTCAAAGTGAA
ATGTTATGTTCTTTTAGTTTTTATGGATAAGTGGAGTCATTATTCCTTTATAGTTACAGG
GGATTGACTGTTGAATTCTTCTCTAAGCCTTTAAATCTTGTTTTTGCTCTAGTTGTCTCC
TAAATCTTTCCTAGCAACTAGTCAGTCTAAGTAGTCCTGAACTGACCATCTATTTTCTGG
TCTCTTATTATTTTATCTATTTAATAATTGAGAAGATAAAAAGAAAAGAACCCTCTGGAT
TTGTGTTTTGTACATGCTGTATGTCTAGCATACATACAGGAAAACAGTGGCCAGGAAAAC
AGTGGTATGTGAATCCACGTTAACTACCATGTCTCTGTGTTTCTCCTCCAAGTTACCATG
TCCTGCCAGGAGAGCAGAATGATGGCTAAAGATTTGTCATTGTAACATTATTATTGCTTT
CACTGACAAATTGTTACTCAGTCTGATCATATCAAAATTTAACATTGAGTGTATGTTTAG
ATTATCCCAGAGAACAGGTGGATATCTCTTCAGTTTCATGTTCTTTACAAGCAATAGGGG
AAAAAGTGGTCCACCATCATGGGAATTTGCCCTGTGCCACTCCAGAGATCATCCCTCTCT
AGATATGTACAAGAAAAATAGTGACTCTGGATAATCCTCATCCTTTGAGATTTTGTGTTC
CAATTAGAATGTTGTTATGAAGCCTGAATTTTCAAATAACACTTAGATATGCCTGTTTTA
ACAATACCTTTGGTTCCTATTACAATTTATCCTCAGCCTTGATAGACTAGATATCTGATA
AGCTGGAAGTGAGATGTTGAAATGTATTCTTTTAGTGATAACTGCATTGGGTATTGATGG
AATACTGGAAAGTAAATTACAACTTTCGCTATGAAAATAATAATGCTAACAGTTGAAACA
TATTTATATTTGTAGAGTCTTTCTTTCAACCCTAAATATTTTATAGATATTATCTAATCC
TAGAAAGTTCCCTGTACATGAAAAGATAGCATCCCCTTTTTTCTTGGGGGTATTAATGCC
CACACTGCTTAAGTGAGTTGCCCAAGGTCACTCCGTAGTCGTTGGTAAAGCCAGAAATAG
AATCCAAGTCTCCTGACTCCCAATTCGGTTCCCTCTCCTCTATATACCCGTGCTGCCTCT
CATGGGAAAGGAAGTTAATCTTCCAGCTATTAATAGGCACCAAATTGGTGGTAGCAGCAC
GGTGGAGGAAAGTAACTGTCTTTACACTGCAGCATTAGTATAAAAATATCTGGTAATGGA
AAATTTGACAAATGTCATGGTAAAGGGAGTGGAAAATTATTTTAAGATCTGGATCTCATT
TATCTAGTTCTCAGAAAAGTAAAATTCCATAGTAGAACAGGAATCATATTTTTCTTCATG
TTTTTAAATTGTGTTTCCTAGAGAGTAATTGTCTACCTAGGCATAGCAGAGCCCGTTGTC
AGCTAACATAAGAATAACATGTATACTGTTGGTGATTGTGATAAGTCTGTTTTCTAAGTT
GGTTGGAAGTTTGAATTGCTTTATTGAAATGCACAACACTTATTTTATTCAGTTTTCCGA
GTTAAGTTAGTGTTATATTGTAAAGCAAATGTAACATAAATTGGGAATTTTACTGCATGA
TTTGAAAACATGGGCAAAAGTACGCATTATAGTTTCTTCCCTGAACAGTACACTCCAAGC
AAAGTTACGTCATGTCAGGCACCATAAAGTGCACCAGAATGAAATAGGCAAAATAGAAGA
AAAGTTCATTAAGAAATACAAGATAAGCACACTGGAGCTGATCAAGTTTATTATTATGTA
TATAATCAATTCTTTATTTTGTCCATTCCAAAAAGGTGTTCGAGAAGTGTTTATGTACTT
AAATATTTAAGCATGTCTAGTATTGGAATTAACACTTGAGTTCAAACAAAACAATTTTTC
TCTTAATTTTGGACCAAAGAACAAGAAGTCTCTACTAAAACTCTCAGGATATTATATTTC
TGTTTAAAGATTACTAACAATCTTTAATCAGAAGAATGATATGATCAGAATTATGTTTTA
ACTGTAAGTATAAGAGAGGCGGGATTGGTAGAGGCTGAAAATGCAAGGAAAAGATAAAAA
ATCTAGTTATTTGGGACCCAGGTGACTGAGCAGGTCATGGCAAGAGGATAACTAAAAATA
AGAGAGTTTAGAATAAGAAGAATATAGGGTCACGTACAGGTCCTTAGGGAAATATATACA
TTTACTGACTGGAGGAAGAAGAAGGTAACAGCGACGTTGCAGAGGTAGCAGGGAAATCAT
TTGGAAAAGCTACAGAAGTTATGGGATAGGGTTAGGAAAAGTTGGTCAAACCTGGTTACT
TTGGCATTTGGGAGAGTCGCCTTTACAGACTGATAAGGGTCAGGTAAGAGAACTCGGAGC
TCTTCAAATTATGTTCATTTATCTTTGGTATTAGTCTGATTTTTGCATACCTATGAATTA
TGTGTGCCAGAAGAAATTAAGCATCTGGTTGATTGATTTATTAACTACCATACCTGAGGT
AGTAACAGATAAAGTTCTTGCATTCGCCTAGAATTTTACTGGTTGTTGCCATTCTTGTTA
ATTTAGACTAGACTTCCACTCAGTTAGTAATAAACTGGTGTTATTTCACTGTAGAACAAG
TTACTAATCTCTGCCTACAAATGTAGAGTACTTTTTTGTTATCTTAAACTTAAATCAAAC
ATGAAAGCTGGAAATTGCTTATGAATTTTGTTGGAATTGTTCGAAATTGTTTTCATGATT
AACCCAGTATCTCAAGATAGCTATAACTGTAAATTAATATTGACGTTAGCCACTCATTAT
TTATTTTATGTTATAGAATTTCTTTATACTGAGTTTATTAACTTTATTTAAAATTACTAT
CAATAAACTATGATTTTTTCCTTTCCAACTAATTTTTCTTTTCGATTTTTATCAATTGGC
AGAAAATGTGCCTTATTATCAGTAGTCTTTTTTTTTAACTGGTAGTGTTATTGGAAAATA
TTTAAGCAGCATCTTGAGCTTCTTTTTAATTTTGTTGAACAGGCACATCTTCAAGTGAAT
CTAATCTGCTTAAAATTCCTCCACAAAAAAGAACCCGAAGAAAACTAATGCCTTCTCCCT
TGAAAGCAAAACACACCCAAAAGTCTACACTGTCTGAAAGTATGCAGCTCAATGATTCTC
TCAGCAAAGAGCTTCAGCCTATTGTGTATACTCCAGAAGACTGTAGAAAAACTTCTCAAA
ACCCATGTACAGTGACCTTTTTAAAACCATCGTTACATACTACAAGTTTTCAGGCCAACT
CAAATATAAACAGTAATAATTCTTCAAAAATGTTATGTGAAGTAGATACTCCTCTCAGCA
GGAGAAAAGAATATGGACAGGAGGATTTGGACCCTACATTTATTATACGTGAAGACACCA
GGAGCTTGAAAAGTACATTACCTGAACAAGAATCATTATCAAACAATAACATTTTACAAA
GGTACAGAAAAAGAGTATTTGCCAATTCTTCTTTTTTTTTTTCTATAGCCTTTAAACTGT
TAGCTTTCTTTTTCTTCTTTAGCTATATTTCAGTCTATTTTATAGAGCAAGTGTGCTATC
TTGATTACAAAAGTCAGTGTTTTACCTTCATTAATTCCTCATTGTCTTTGTCTCTAAATG
TTAATTCACTAACACAATATTTTAAAGCCTTTAATTTGATCTCAAGTTGATTGACCCTCG
TTAGGATAGAAGAAACGTTAAGATATATTTAGTTCTTCATACTCCAAATTTAGATGGTGT
CATCAGCAAAGATTACCGTGTTTATTATTATTCATTAATATCTTCACTGAAGGAAATTCC
ACTGTTCCTGTTGATGTTTAGCAAACCTCAGCTTGCTCTGAAATAGTCATAGGTCTAAGA
TATGGTTGACTGCATGTCATCCAAGCAAACGCATCCTTCTCACTTCGTCCGTATAATCAC
ATATGATCTAAATATGGGAAGAATGATACCTTCACTTTTCTGTGCTGTTGGGAATGCAGA
AATTTCTTGATAGCAACTCTATCAATGGTGTAAAATGAAAAGAAAACCCCAGGGAAGCGA
GGGAAATTTTACAGTATAGAGTAATGTTTTCCTTTATATGTTAATACAGAATGATGTTCT
AATTATTGAAGTGCATACCTCATTTTTCTCTGTAATACAAATGAAAATTACTTTTTATTT
TTGATTATTTAATATACAGGCTTGACCCGTCTTCATTCTCAACTAAACATTCTCTGCCTA
CACCAAGCGTAGTACCATCGTACATGGCAATGACTGCCACTGCCAGAAGGAAACGGAAAT
TAATAAGGTACGATTAAACATAAACTGGTTCAATCTCTATAACCATGTGAAACCATTTTT
ATACGGGTTTTCCCCACTCTCTGAAGGTTTGCTTTACACAACTTCGCTTTCACAAAAGAC
CTACATTAGTACCAATTTTCGCTAACCAAAAGATATCCAAAGAGGATTTCCACTTTTATG
AAGAAAAGTATCTCAGCATCAAGCCACCATAGTATTGGTTTGTGTCTGTGAGCATCTATG
CTCTGTCTTGATTTATTTTGGTAGGTTATATTTTGTGTCTGGGAATGCTCAAAAGTTTTT
CCCATATAAATTAATGGTAATTGTTTCTTCACTTTACGCCGTTTCAGCTTACAAAATTTC
ATAGGAACACTCTACTTTTGGATAGCAGGAGAAACCTGTGCTTTGGTTTCCACAGCTCTT
CTTTATTTCTTGTAATTAGACTGTCAATTCCTCTTTAAGCACAGATTGCTCTGAATGTGG
TGCTGGATTTATATTATCAAAGGGAAATCTTGATAAAGCCCAGGTATTTCACTTGATATT
TACATAAAGTATTCCATATTTCAGATTATTGAAAATGAATTGAGAAGTCTTCTGGCCTTC
AGAAATGTCATTTAATTTTAACTTTTCTTCTGGTGACAATTTTTATCCATTTGGTATTTT
TCCTTTTAGACATTAGTGAATTTCTTCAGTCCTAAAATTGTGTTATTTGAATGGATTTTG
ATATATGACTAAAATGTAATGAGCAAAGAGACTTCTGTTTCTGGCTATGACAGTGTAGCT
TCTATCAGACCAATCAACCCATCAAGAATGATTATAAAAACTGATAAAATGCAACTCATG
GCTGCTTCAAGGCACTGAGGAACTGCCAAGACAGCTAGGACTTGAGAGTCTAAGATCCCA
GAAAGAAGGAAAACAAGCTGTGGAGAACCAGATCTTCTCTGCCGCTTTTTTTCATTTTGT
ATTTGCCAATTTATGGCATCAGGTATAGAAGTATAGAGGCCATGCAGAAAATGGAAGCCG
AGAGCTATCATGAGTCTCGGTGAGCTAGGGAAACAGAATCATTTTGTGTAGCTTTTGCCC
TCTAGATATTTGCCAAATTCTAAACTCTCTGGAATAAAAGGCCAAGAAACCAAGCTAAAA
GTAGCTGCTAAGAGGCTAAAGTATTAAGCAAAGTTTTGACATTCTCATGGGGCCAAAAAT
TGTTGTTCAGGAATCATCAGGGAGAAAAGGCCCTGTTAAACATCCAGGATTTTATCTGAG
ACCCCTGAAAGCCTGTGCTATAAGAGTAGGGCAAACTGGAAATAGACCAGTTCTTGAGAG
CCTAAAATAGACCTTAGACCAACTCAATCCATTTTTGGATCAAGGTAATCTATCTCTATT
GTGTCTGCTTCCCAGAAGAAAATTCAGTCGTCTCTAGAAGAATGTATCATCCAGAACCTC
CACGGTTTTTCATATACAACGTTTAACACTTAAGCAAAAATTACCAAGTATGCCAAGAGA
CAGGACCAAATGACTGAAAATCAAGAGGAAAAGACAAATTAGAGAAGCATTGATCCATAA
TTGATACGGATATTGAGATTATCAGATAGGGACCTTATGACTAAGTTCAACAAAATAGAT
GATAATTTCCCAAGAACTGGATTCTATTAAAATGAATCAAATGGTTATCCTTGAACTAAA
AAAATAGAATTTACTGAAATTAGGAACTCAGTAAATCGATTTAATTATTAGGCACAGCAG
AAGAGAGTTTAGTGAACTGGAAGATAAGTTGATAGAAAAATAGCCAAACCAATATACAAA
AGGATAAAAAGAGAAAGTATGGAGAAAAGATAAGAGATATATGGGACACAATTAAAAAGG
CCTAGCATATATATTTTTTGAGTTCCAGAAAGAAATGAGAAAAAGAATGGAGGGCAAACA
GTAGTCAAGAAGATGCTGGCTAATCATTTTCCAAAACTGACAAAAAAATAAATCGCAAAT
TCGAGGAGTGCTGCAAACCACAAGCAGCACTAGTACTTTAAAGAGAAAATACCTAGGAAC
GTAGCAGTAAAACAGCTAAAAAATCAAACACAAGGAAAAAATCTTAAATATTCTGAGTTA
TAGGATATGAAGTCTATTATATAGTCTTTATAGCCTGCAACACTGAATGCAACGATAAGG
TAGAGTGAATGGTTGGTTCTATTGTAAAATGGATCTGACTTGCTCTCTCTTTTTCTTTGA
CGTGGTTTTGGGGAGAAGAGCGTAAGATCTTAAGGTAACTCTTTTTAAGTTTCCTATTTT
CTACCAAGGACCTGTTATCGTCTGGGCTAGTGTAAACAGATTTACAAATATCCTATTTAT
TTGTGCCATGTAGAGTATCATCTCATAAGTGCATTTAGGATCTGTCCTTTTGCTTCCAAA
CAAAGTACAGTCGTGTGCCGCACAATAGTGTTTCAGTCAATGACGTACCGCATGTACAAC
GGTGGCCCATAGGATTAGTCCCATATAGCCTTAGGTGGGTAGTAGGCTATACTATCTAAG
TTTGTGTCAGTACACTCTGTGATGCTTGCACAACTGTGAAATTACCTAATGATGCATTTC
TCAGAACATATCCTCGTCATTAAGCAACTCATGACTGTACAGCAGAGCCTTATAATGTGT
AGATTTAAAATTCCTGGGTTGATTTTTCCTGAGTTTCTCTGACTACTCATGACATTTAAA
ATCTTGTATTTTTCTATGGTGCAAATTTGAACTGTGTAATTAGTCTGGCTTGTGTATGGG
AATCAGTCACTTAATGAGTGAGCCTGGCTAACCGCCATCATCAGTTTCATCCATCTTATC
ACTAATTTTTATTGTGTCAGTTGTGTTATTCTTTCCATTAACTAATGTTGGTGACTTTTC
TTGTTCTTGACTGGTAGCATGTTACCATCTGTTGTGTTAACTAAGATTTGGCAAAAGTAT
AGCTAAGAATAATTTTAAAATGTAAACATAATCACTACCAAAATCAGGTGACTTTTCAAG
AAATGTCCAGCTATGTAAATTGTGTATTTGGTGTGGTTTTAGATGAGTTGAAGGGCTTCC
AAATGAGCAACTAATATTGTGAAATAATATTAAAGGACATATAAAGAAAGTAAGATTTCT
CATAGCCTATTAATTGCTCTATTACATTCCCTCTGGTACCAATAATTAGATCCTGCCATT
AACTGAGGTTAAAAGAGATTAATGCTAGAAATGTACATAATTACTTTTTTTATCTCCCTT
TTCCCCAATTAAATCTACATGAACTTGAGAGTAATAAACTCTGGTATTTTCCACTTAACA
GCTTTATGTACATATGTAGGTGTGTATGTATTCTAAGATGGTTTTTAAAAATGAAGAAGG
GAAGGCTCCATATATATAGTTATTTTACTTATTTTGTATCAGTTTTTCTCTCTGGAAAAA
AAATTAGAGGTTAAAAGCACTGGGTATTCCAAAAACCTACCAAACTGAATTTTTTAATTA
CTACTTAAATTGAGAATATTAGATTTTTAATCTTTCAATTTATTTAATATCATTGTAACA
AACTCTTTTAACTAAATGAATTAGCCTGCCAATCATACAAATACAATATATACAGATGTA
AAATTTTACGTATAAATTATATTAATCAGAGTTTTTGGTTTTTGTTTGCTTTTTCTTTAT
TTGGTTGATTTTCTATTTGTTCTGCAGTCTTTCTTAGTACACAAAAATGGTCTCACATTT
GCCATACATTTTTGGTTTGTTTTGAAAGATGTCTAATGATTCCAACTAGAAATTATCTCA
ATTGAAAGACTATGAGGTGCCTTATGTTTATTAAGCAGAAACGTTCTACCTGTGTAAGGG
AACAAAATATTAAATCTTAACTTTTAATAATAGTTATGGAAATATATTTGGTACACAACT
AGAAGAGTTTAGATTTCTTCTCAATATAGTCTTTAACATAATTTGAATTTGTACTCATAC
CAATTTTAGGTTTTTTAATTTTATGATATTTGTAACAAATGTTAAACATTTCATCAGTGG
ACTGTTTTATCTAAATTCTAAAAATGTTTCAATGTATTTTACTTATATAAATAATTAATA
ACTTATTTTGTTAGGCTTTGATTTCCTTCCTAGAAATATGAGTTTTATTCAAATAGATTT
ATTCAAAAGACTAATTTTCAAATAAAAACAATCTATGAGTAAAAACAAAGGTCCTAGAAC
TAACCAAAGCAAAGAATCATTCCATAAAAATACTAAAGACAACTTTAAGATAAATTGCAG
GGAAAGACAACACTTATCAAAAGTAACCAATAACATTGATCTATGTACTTGAAGAGATAA
AATCACCAAATGACCAAAAAAAGAATTTTTGCCTTAGACAGCTGATATTTATATATATTT
TGTCAAAAAAGAGTGTTTAGTATCCAAAACAGAATTATAGTAATTTACTTTATTCAGCAC
CATTTAGGAATAGAATTTTTACAACTGAGTGTCTTTACTTTCCTAACACTAGTACTTCTT
TGTAACCATTTTGGGTAAGTATCATTTGCATTCCTGAATAGAGAAGGCAAAAATCACCAT
TAGAAACACCGTAGTCATCTCTCTTGCAGGCTCTAGAAAATTGAGGTGCACAGGTTGAGT
TTTTTTCCCAGCATTTGGTCTGCTTGTGCCTGTTTTTCTTTGCTGTCATATTAAATAGCC
GCTCTGACTACTTTCTGTGAGCACACAGCTAACCCATCTTCTCCTTGTTCCACAAACATA
CATCCACATCCGTTAACCACATGGTTAGGGTTGCCAGAAGACCAAGTTCTTGCCATAAAA
GGGAAGCCTCCGGTTGTTAATCCAACTGACAGTCAAATTAGTATCAACTTGTAAAATGGT
GTGTAATATCTTTATTAGCCAGAAATGCCATAAAATTAGCTTATTTGAATCAATGTGGAG
GGGGCGTGTTCATCCCCCAAGTCGACCCCCAGCCCTGCCTGTTGAAACTTGATGCTCTGT
AGGGCCAGGAAGGATTGGATTGCTGTTTTTCAGGGCCTAGATCAAACTCATCTCATCCAC
AAAATCTTCCATCTCTCTTTTTTCTGAACTCAGGAACTGAGAGAGCTCCGTATAGTTTGA
AAACCTGTGGCACTAGTTTTTACTCTACTTTATATTATTTACAAGTTTGTCTTATTTTTC
CCCCTTCCCATGATATATCCATTATGTAAGTTTTCAAGACGGGTTGTTTGTGCTTTCCTT
ATTTGTGTGTCCTGTAGCATGAGACCATAATAGCTGTTTAGTAATATGTCAACTCAAATT
GAGGTAGAAATTTGAGCCGTTAATAAAGTGAAATTGATGTAAATTTTTGAAGATAAATGA
AAATAGGTCATTCTTTTCATTTCAGTTCCTATAAGTGCAGTAGTCAGAGATTCTCAGACT
GATTTTTACTATGCTTCTATTTAAAAACAAGGTTTCCAAACAATCTCACTTTTTTGTATT
CCCCAGATTAGGGTTCTTGCTCCAAATTTGTAATATGAGCTTAGTTTTTCACCTCTTGCA
ATGTGCTCCTTATCTCTACACTTTGAATAACAGTACTCACTTATATTCCAGCAGAGCACC
CTGGAAATGTTCTGTTACAGAATTGTTACATACACCTACAGACATAATGTCTGGTTTGAA
TAAACATCATTAAAATCACACACAGCTAAACTTCCCTGTGGGCTAAAACATGTATTTAGT
ACTTCCAGTTATTTCCATGGGATTTTACAACTTAATGTTTTAGTATTTCACTTTTTCTTT
AATCTTCATTGCATGTAGAATATATATTAGAACTTAGAGATATAAAAGATGTGTTACTAA
AATAAAACTTTTTCCCCTCAAGTTCTGCATCAAATACTTCATTAACTGCTGAGGTAAATT
CTGGATTTGCCAAACGTGTTCGACAAGATAATTCAAGTCATGAGCTCTTACAAGAAAACA
GACCAACAATGGGTATGTCTTAGCTCTTATTTTGATATTAACAATATGATGACCTAAAAT
ATATATAGTACTTTACGTTTTTCTATAGTGTTATCATAAGAATCTCCTTTTACCTGCTCA
TCACCTTTGTTACATATCAAGTCTGATTATCCATGTTACGGATAAGAAAATGTAAGGCAC
AAAATTGAAAACACTTACCCAAGATCACCGGATCTTTCATGGTAGAGCCAAAACTCAGAG
CCAAATCTCCTAACTCTACGTTCTGCACCCTACATACTGCCTCATGTTGCAGAAGAGTTG
ATAAATAATTTAACTAATAATTGAAATAATTAGCTAATTGTATTATTTAATAGGTTAGTG
ACTAAGTATATTTTATAGATAAACTATATTCACTTGAAATTTTTCTCTTAGCCTATTATT
TTTACTAATTTGAGGACCGGTCCAGTAGCATAGTGGTTAAGTTCGTGTGCTTTGCTTTGG
CAGCCCAGGGTCTGCCAGTTCAGATCCCAGGCACAGACCTACGCACCGCTTATCAAACTG
TGCTGTGGAAGGCATCCCACATATAAAGTAGAGGAAGATGGGCACAGATGTTAGCTCAGG
GCCAGTCTTCCTCAGCAAAAAAGAGGAGGATTGGTGGCAGATGTCAGCTCAGGGCCAATC
TTCCTCAAAAAAAATAAATAATAATTTGGCCTCTGACTCATTTGTGCAATTATTGCCAGG
CTCTAGTCTGTACCTAGTTACAATCATATTGTAGCTCCCATTAGCAACTTGAAAAAGAGG
CTCGTGGGGTGACACAAGTCCATGGTAACAAAACCACGTCTTCAGTGAAACCAGAAGTAT
GTAGCACCAACCAGTTTCTAGGCCTTGGTGTCCAGACCTCTGTCTCTCTGACTCTATAGT
TCTTAAGACTTTGTTCAGGAAGTATTTATTTACTACACACTCACTATGTGCTAGGTTCTG
TGATGAATACAAAGATAAATAAGACCCAGTTTGGTTTCTTCTCTAAAGGAACTTATAATT
ACAGTCGTGTGCCACGTAACGTTTCACTCAACAACAGACTGCATGTACAGTGGTCGTCTT
ATAAGATTGGTCCATAGAGCACAGGTGTGTAGTAGGCTGTGCCATCTGGGTTTGTCTAAG
TAAGTGCACTCTGCGATGTTTGCAAGATGATGAAATAGCCTAATGAGGCTTCTCTCAGAA
TGGATCCTCATCGTTTAGCGACACGTGACTGTACAGCACTCAGAATTTAGAGGAGTTTCA
TGAGATAACATGGAAACTATTGTTACTTTTTTCTGTCAATGCTTTTTCATTAGAGTACTG
TAAAATTTCTCAATAGCTTTGCCAAACTGTAAATCCTTATTTCTTATGGTAGCCAGTGGC
AGTTATTCACCTTAAGTTCAATAGAAATGTCTTTCATGCAAATGCAAAAATCAAACAAGT
CCTGAAAAGTAAAATTTTACTATGATTATTTGGTTTAACATGCCATGTTTAATAATACTT
AACAATGTGTGTATGCAGTTGGTGTAGATATGCACTGCCCCGTTTGTCTCCTGAAAAAAT
TCTCCAGGAAGTAATAATTCTGCAACCTAATAATAAATTTATAATAATTCTAAAATAATA
GAGATTTGGTTTTTCTAATATGCTTATTTTCTAAGAATAGTATAAAATGCATCAGATATC
ATGTATAAAGAGAGATGAATAAAAAAATTTACTATGGAGGAAAAAGTAGGAGATGATACC
AAACTACAGTGCTTGACAAAAAAGAAGAGCTAAGGCTAAGTTAAAAGATTATGTGTCGTT
AAGGATAATGGAGCACTTAGAGAGAGGTATTAATTTAAGGGAAAGGGATAGTTTATGTAC
TTTAGGATATCCAAGTGAAAATGCCTGAAATATACATCAGGAATTACTGGAAAAGTAAGA
GAATACTGGGACTGCCTTCCTTAGAATGTACTCAGCTGTGGTCTCCAACTAACAGTGTAC
AAATGAAAGTACAAAGGAGCATCAGTGGGAGAGGAGCTAACTGCTGTTTACTGAACAGTT
AGAGAAATGAGAAATAGTGTCAAGAGAATACGTGCTCCTAAAACTACAGCTGATGTGACC
AAAAACATGGATATGAGATTAGACTGATCCGTAAAGAAGTCAGTGACGCCTTGCTGTAGC
AGCACTCCATTGAGTAGAAAATCATTGTGAAGGCTGGTGAAGAGCCAGAAGAATGGGCAG
AGGTAGATGGAACACATTTGAGAGCCGGCAGTGGAAGAGGAAGGGGCTGTGGGGTCAGGA
TCAGCACTTTAGGAAGTACTGATCTAGATTCAACGATACTTCTAAAGTGGAAACTGGAAG
TTTGAGAACCCTGGGAAATAATCCAAAGAATGAGAAAAAAATGGGTGATGTAAAAAAGAA
TGGGAACAATGCTTGTAGAAACAGCCTTTCATTAGTTCAAAAAGAAGGGAAGCAAATGCA
GAAGTTTATTCAGTGACTGCACTTGTTATCTGCAGGGAATGCGTGTGCATATGTGTGTGT
GTGCATGCATGCACGGCTGCACTAAAACTTCAGTTTGCAGTATGAAAGGGTGAATTTCTA
TTTTTAAACCAGGGGTATTAATGTTTCTTTGTTGTTACATTTTAAATCATGTTAATTAAC
AACTTGCAATTTTTAAGAATAAATTTACCTTCTGATGGTTATAATTTTCAACAATTTTTT
ATAAGTTGAATGGTGAAAATTCCTCCTAAATGATACTTTTACCATATTTATATATCTTTT
TATTTCTTCTCTAGAATATAAAAGAAACATCCATAAAGTAAAGCCAAACATGGTTAGAAA
ATTTGGAAGAAATATTTCAAAAGGAAATCTAAGATAAGTCACTTCAAAATCAAGGAAAAT
GAAATTGACAAGTCTGCTTTTAAAAGGGTTTGTTACCAGTACCCCTTCAGAAACTTATTT
AAAATCTTTGAAAGACCATCTTAAAGCTAAGTTTACCAAAATACCTTCAGCGAGCAGAAA
ATGAAGTTTTTTGTTTTGTTCTTTTGTATTCTAAACAAATATAAAATTTCAACAGACAAG
GTTATGTTTTAAGTTTTTAGAATATTTGCTACCCTTTAAAATCCCTAAGTCAGCATGGTG
GCAGCTGAGTTTTACTGTACTGCAACAGGTTGATTGGGACATCCTAGAAAATAATAGTGA
GTTAAATTATCCTTACTGTTTTTTGAAAATAAGGAGAATTTAGAAGTGGTAAAATTTTGA
CCCAGGATGTATTTAGTCTTACATTATTTCAATCATATATATGACTTTCCTTTCCAAAAT
TACTTTGAGGTACAAATGTACATAAATGTATGTGACCATAAAGTTGTTAAATGTTATTTT
AATAGTCTTAATGAATAAAATAGTAGTATTGTTCCTTGCTACTCAATATATTAAAGATGT
AGATTTTATAATGTTGCTTTTCTGTCTCATTACTACCTGTTACCCACTTTAAACAATTAT
TTTTATAAAGTGTGAATTTTGCAGATTTGTATTTCATATTTCATTAAGAACTGTGGCACT
AGAACCAAGTCGGAAAGTAATCTATGGTGGGGCTGGCCCCGTGGCCGAGTGGTTAAGTTC
GCGCGCTCCGCTGCAGGCGGCCCAGTGTTTCGTTGGTTCGAATCCTGGGTGCGGACATGG
CACTGCTTGTCAGACCACGCTGAGGCAGCGTCCCACATGCCACAACCAGAAGGACCCACA
ACGAAGAATAGACAACTATGTACTGGGGGGCTTTGGGGAGAAAAAGGAAAAAAATAAAAA
TCTTAAAAAAAAAAAAAAAAAAGAAAGTAATCTATGGTTCCTTACTGAGAAAATGTTATA
ATCATTCCCTCTGCTAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1367, 3468..3625, 7794..7898, 8358..8468, 10114..10311, 12193..12369, 13650..13724, 13939..14051, 18023..18185, 28894..29058, 34858..34979, 48292..48527, 74082..74520, 75259..75366, 81202..81311, 84074..84156
1043..1367, 3468..3625, 7794..7898, 8358..8468, 10114..10311, 12193..12369, 13650..13724, 13939..14051, 18023..18185, 28894..29058, 34858..34979, 48292..48527, 74082..74520, 75259..75366, 81202..81311, 84074..84153
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved