Equus_caballus Locus RPS13
snOPY snoRNA Orthological Gene Database
Equus_caballus RPS13
Equus_caballus
RPS13
7
SNORD14, SNORD14
2114..2203, 3373..3461
4718
CTCCCTCCTCCCCAGGGCCACGCTGTTTTAGAACAAACTCCTTCATCTGCCCAGTCTTT
CAGCGGATTCCTGTGTACTAGCACGGAGTCAGTCTTAAAAGAGTTTCAGGCCGTTCCTGA
ATTTGCCAGGAAATTCAGACCCCTCGTTTTCTCCCTCATCCTCCCCACTGCACTTCACCT
CCCTACACCCAGCCCCTGCCTTTGCAGTCTTCTTCCCAAAGCTCTGCCCTGTCGCCAACT
CTCACTCGGCCACGCAGCCCAACGCTCCTCCCCGCCGAGCAGAGCGCCCCACAGCTCTGC
GCAGGGGAAAGAGTGGAGGGGTCCCAGGTGGAGCGGTAGGTAGCAGGTAGAGGTCCGCCA
GGGCCTGGTTCAAATCCCTGGGCTGGTTCTTCTCTGTGTTCCGGGACCCGTCTCCGGCAA
GATCAGATTAGAGATAATGGTAGTGCTGGCTGGGCCGTAGCCACTACCCTTACTGCCGGT
GTAGCACTTACACCATGGTTTGTACCTGCGAATTTATTAGGGGCAGGGACAGACCTTGAG
ATATTTAGTGCAAAGACAAAGCCTGGTGCTGCTGAATGAACAACTGTGGCTGAAGCCACA
TTTGGATTCGTTTCAGGAGCCCAAATTCGCCAGGCGGCGGGGGACAGATAACGGCTTTTC
TAGGACAGGGACCAAGTGCACCAACGCCTGCCGTTGTACCTGCTCCATGCCGACTCGCAG
GCAGAGACTTGAACCTGCACATTCTCGGGGCTAGCAGCACCTCCAGAAAGCGCATTCCCA
GCTGGAGTCTGACTCAGTTTCCCGCTCTGGCAACGACTGAAAGACCGATGCATGCCGGGA
AGTGTAGTCATGTTGTATGAGGAATCTGATATAACGTGGCAATGCATTTCGGGATATGTA
GTCACGCGGGCGCCGGGGTCCACGCGGCGTGGCTCCGCCTCCTTCATGCGGGAACGTGTG
AGGTCACTTCCTGCGTGCTAGGTGGCTTCCTGCGGCGTTCGGTGGTTTGCTCTCTTTTTC
GCTGCCTGACCGACGCCATCATGGGTCGCATGCATGCTCCCGGGTGAGCTCGCGTTTCCC
AGCTGGTTGCAGGGCTGGGCCGCGGGGGCGGGGGAAGGAGGGAGTGTGGGCGGCGGGTCC
AGGGGGTGATGTGGTGGGCTGCTGGGGTATTGGCCCCCCCCCTCACCGCGGCGCTGCTCC
TCTTCCCAGGAAGGGCCTGTCCCAGTCGGCGCTGCCCTACCGCCGCAGCGTGCCCACTGT
AAGTAGCGCGCGCGAACCGGGAGGAGTCGGGAGGAGACTGGCAGCGGTCGCGCGGGGCGA
GCCGGGTGGGCGCGGGCAGCGGGCTCCTTGGGCGCCGGCGCGGCTCCTCGGCCTCAGGCT
GCCCTCTCCTCCACGCGCAGTGGCTGAAGTTGACGTCTGACGACGTGAAGGAGCAGATCT
ACAAGCTGGCCAAGAAGGGCCTGACGCCGTCGCAGATCGGTGAGCGCTCGTGGCTAACGG
AGCCTCTTCCGCCCGGCCTCGTGTACCTGCCGGAGAACGCTCGGCGGTAACCGGGCCCCG
CGCGCTCCGTGGAATGCTTTTGCCCGTTTTCCCGGCTTTTCCTGTCGATGACCGAGGGCT
CGTGTTCGTTTGGGGAACTCTCAAGTTCTTACTTGGGAGACGGTGGAATTAGAAGTTCTG
GTGGTTCCCCCCGCTTCACACAGCGCGGCTGCATGACCAGCGCCCGGTCTCGTTAAGGGG
AGGCGTTGGGATTGCCTGCTGGCAGTGCTTGTCGCCCTCTCAGTTAGATGTGCGAGTCTC
AGCTGTGTGTGACTGTGCAAGTGGCTTCATTCAGCAGATGTTTGCCTGCTGCGTGGTTCT
GGGCCCCGAGGACACAGTGAGCGAAAAGAGGGCAAAACATCTGCCCTCCTGGAGCTGAGG
GTCCAGTGGAGGGATTACACACGAGGAAATAAAGGATTCGTGGCCAAGTAGTGAGGCTGT
GCTGTTGTGAGATTAAAAAGGAATGTATGTGAGTGTCTGGTACATGTTTAATAAACGTTA
GCTGGTTTTAATTATTGAACACATACACAGCCGGAATCTCATGGATTCCTTTGGGGGCCT
GTCATCTAGCACGCTTACTATGGTGCTGGTCTTCCAGCACTCGCAGTTTCCACCAGAAGC
GTTTTCCTTGCTGTTGGGTAAACCTTCCTTGGATGTCCGAGTGAGCTCTGCGTGCGTTCT
CCTGTTGGTCTCTGTGATGTGTAAACTTAAGCCCCATTTTACCGATGGGGAACTTGGAAA
GGGACTTGACATCACCTGCTCCAGTTTGTGAGTTTGGTGTGAGAAGTTATAACGTGATTC
CTTTTCAGGTGTGATCCTGAGAGACTCACATGGCGTTGCACAAGTGCGTTTTGTGACAGG
CAATAAAATCTTGAGAATTCTTAAGTCCAAAGGACTTGCTCCTGATCTCCCTGAGGACCT
CTACCATTTAATTAAGAAAGCTGTTGCTGTTCGAAAGCATCTGGAGAGGAACAGAAAGGT
AAGAGAATGGCACTGCTTGTACTAACTTATTTCAGTAAAACTCAATGCATCTGTCAGCAC
TATGGTTGTTTTGAAATAAAAATTCTACCGGAAGAGTTTTGGGATAGGAGGCCTTTGGCT
GCCCTAGATACAACATGTTCAGTTGGTTGAAAATGTTGAGGTGTTTATTTGCAGAGATTT
GCAAAGCATTCCTGTCAAGTCTTCTGGAAGCCTTAAATTTTCTTAATGACTTAATCTAGC
CACATGAATCCTAGCCTGTGATTCTGTTACAGGACATTGGGTGACTTTTCATTAGAGAAA
GTGCATCGTGTCTATACATTTCTTTGTTAAAATAATGTTCCATAGTGTTTAGTTGTTTTG
AATGGCTTTCTTGAATTCTCTCCATTTTTAATTTTAGGATAAGGATGCTAAATTCCGTCT
GATTCTGATCGAGAGTCGTATTCACCGGTTGGCTCGATATTATAAGACTAAACGAGTCCT
TCCCCCGAATTGGAAATAGTAAGTATCAGCCTTTTTGGTTAACAAGAGCAGGAGTTAACC
AGATAGTGAATATAGTAGTAATTATTGTAAAAGGCTTGATAGTAAATGTTTTAGGCCACG
GGCCATATGGTCGACTACTCCTCTAGCTCTGCCATTGTAACAGGAACACAGCCATAGATG
TTATATAAACAAATGGGCGTGGCTGTGTTCCATTCAAACTTGACTTACAAAGACAAGCAA
AGGGCCATAGTTTGCAGACCCCTGATTTAGAACATGAACAAGCCCTTTGAATCACTTTTA
GACGGTGGGTAAAGTTTTAGTTCATTCCTGTGCTCCCAGGTGTTTATGTTTTCTTAATTT
TTGCATGGATTGCTCATTATGGTGCTTAATTTACAAACATTCAGTTTCCACCAGAAAAGT
TTTTCTTTATGTTGACCAGTTCTTCCTTGGATGTCTGAGTGAGCATCTTCATTACACTTC
AGCACAGTGAAGTGATTCAGGAACTTAGCAGTTTGGTGCATTTTATATATTTGGGGTTTA
TTTTAGCTGTTGGGAAATAACTCATTGGCTGAGAGATTCTGTTAAAGAAAACGGAGGACC
TGTATTAATCCAGCTCTTCTCTCTTTCCCCTTTTTTCCTTTTCAGTGAGTCATCCACAGC
CTCTGCCTTGGTTGCATAAATTTGTCTATGTACTCATGCAATAAAATCATTGTTTAACTA
GAAGCACATTTTGTATTTCTTTCCCTTAAAAAATTGTGTATCAGTCATTCATGAGTGTTG
ATCTTTGTTGATGTGGAAGTGTTTGGGCAGAATTAGAATTGTCTAATTCCACAGGGAGCA
GTAAGCTAGAATCCATCTATTACATCCCTTCACTGCTCAGCTAGTTGTAGTTGAGCAGTT
TATAACTTCACGGGTGGTTAGTATATACAGGGCAGTGCGGGGAGGGACTGGAAGCGACTA
GGAAGTAGTGACTTGTTTTGATGTCATGGCAAAAATGTTTAAGTATTTTTGATAGATTTG
ATGTTAAATAGACGTGTGATAGAAGTAGACGTGATAGATGCTATCCACAGTGTAGTCTAG
CATCAGAAATAAATACATGAAAGTGCCTCTGGAAGAGTGTCTTTAGTATGGAGGGACCTT
TGGAGGCAGTGACATTTGATCCCAGTCTTGCTTGTGAGGTTAAAGATGAGGAAGAAGGGA
TTTAGGGAACAGTAAGCGAGCATAGTTCCATCTGAAGCAGAGGGAACGGGAAGAATTGTG
AGATGAGCTCAGGTCCCTGAACCTTGCAACTTGTGGGTGAGTTAAAATTAACCCACCTGG
GTGTTGTCAGGATGTTTTATTTAATTCATAAAACCACCTAATGAGGTACATGGGTATCCC
TGTTTGAAAGAGGCAAGTCTCTTGAACGACGAGTGAATTGTTCAAGGTTGTGAGACCAGG
AAATGATAAGCTGCACGTCTAGCTGGTTCACAGAGCCACAGTCTTTCAGACTTTAGAAAA
TGTTCAAGCAGGCCACTTGTATGTGCTGATTTTTTCCTAAGCGTTTATCACTTGAATGAG
TATATTTAGTAATAGGCTTTTTACTTAAGCTTTACGCCAAGCAGTAGTCAAAGTTGAGTT
TGAAATCACACTACCAGGCAAAGTCCCTTGTTTTCAAGAGGCCAGTATGGTAACCAGCAT
TGACGGCCTGTTGGTGCTGGGCTCAGGAGGTACAGACAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1062, 1209..1257, 1400..1478, 2348..2517, 2917..3017, 3645..3718
1040..1062, 1209..1257, 1400..1478, 2348..2517, 2917..3017, 3645..3675
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved