Equus_caballus Locus RPL27A
snOPY snoRNA Orthological Gene Database
Equus_caballus RPL27A
Equus_caballus
RPL27A
7
SNORA3, SNORA3
1741..1870, 3132..3262
4581
ACTGAGGACGCCCAGGACGACAGCACAAGCCAAGGGAGAAAGGAAGGCCAAGCGGCCGC
TCAGGAGCGCGGGTCGGCTGGGTGGGAGGCATCTGGGTAGGACTTCAAAGGCGGGGGCGG
GGGCACATTGAGTAACTGCCTCATGGCTCCTCACTGCGGCCGGGGGACAAGCAAGCAACC
GCTACCCCCGGGGACGAGCAGACCGCCAGCAACTGAGGCGGGGGCGCGGGACCGCTTGGG
GCTGGGGCGTTCGGTGAGGAGCTGAGAGCCGGCGGTCTAGGCGGCTTCCTGGGCCAAGGC
GCCAAGAAAAAGCCCCGACCGACCTGCGCCGTGGCTCCCCAAGCCCCGGATCCCACGACA
ACTCTCAGCCTCCGAGCCTGAGCGCACGGTGCGCTACCCCGAAAAGGCCTCCCTTCCACC
ACCGCCACCGCGATTTCACTCTGACGGCGAAGACAACCCGCAGGAACAGGAAGCGCTAAG
GCCCGCAGCCGCGCGAGACCCGAGACACGGAAGAGGCCCCGCCCGAGGCCGGGGCGCCCT
GGCCGGAAGTGAGACGGATTGGCTCCGCCCCCGTGTTCGATACCTCGCGAGACTTCGTGG
AGGCCTCCCTCTTTCGTCTCGGCCGCCAACATGGTAAGTGTCTCTTTCCGTGCCTCCGGT
TCATTGCTGGCGCGGGTCGCGAGTTCTACTCGCCTTTCACTCCAGCCATCTACTCCCAAC
TTTAGCCCGGTCTTCCAGAGTAGAACGGTCGGCGTGGGCCCGGGAGTCTGGGGCCGCGTG
TTGTCCCGGGGTTCGCATCTCTGGGACACGCGGACCGGGGCGCCCGGGTGCCGCCCTGAT
GAGGCCGCACGGCCGAGGGCCAGTCTGTAACCTCGGCTTTGCTGAATGCGCCGCGAGGCA
GATCCATGACCCCCGGGCCTCCAGGCGCTTCGCAGACTGGCAGGCTTCGCCCCCTGCCCC
ACCTTCCTTAGGGCTTACCACCAAGCACCTTTTTTCACACAGCCGTCCAGACTGAGGAAG
ACCCGGAAACTTCGGGGCCACGTGAGTCACGGCCACGGCCGCATCGGTAAGTGCCGGCTT
CCCATCCTGGTCGGCCTTGGCTCTCCCTGCCGGGTCTCAGCCTGTCGGGAAGTAGGTAGC
TTAGATTTGGGTTAGTAGGAGCTTCGTGCTTTCGAGTCGGGTTGAATTTGACCGTTAGCC
GTTGGCTTGTTCTCTGAGAGTTTTCTGGGGCTCCAGTTTTAGAGAATTTCACATCACTTG
GGGGTGTGAGAATTGAGCGGGGCATAGTATTGAATTGGTTGAAGGCATGGAGTACTGTGG
TGGTGCTGCAAAGAGAGGTTTAACCCGGACTCTTGGAGCAATCGCGATGCTGAAAGAGGG
ATTGTAAACTGACACGGCACAAGCAGAGGCACGGAAGTGTGGGGAAACGGTTTTGTGAGA
AATATTGGGGGGCTGGAGAAGGCTGTGTTAGCCATGTAGCTTTGTGTTCCTGCAGGCAAG
CACCGGAAGCACCCGGGAGGCCGGGGTAATGCTGGCGGCATGCATCACCACAGGATCAAC
TTTGACAAATAGTGAGTGCTCCTTGGACCGTGCTTTTACTGACACCGGCGGCTTTGGAGT
TAGGGGGAGAGGGCTGGCTCAGAACGTCTTAAATGGGAAGCAAGCCTCTTACCGCTCACC
GAGCTTGCCTTTTGCTGGCTTTTACCAAGTTAACCCTTGATGTGAACCGAGAGAACTTGT
CGTCGAGGCTAGAGTCACGCTTGGGTATCAGCTATTGCCTTAGTGTGCTAGAGTCCTCGA
AGAGTAACTGCTGACCTTATTCACTGGCTGTGGCCCTCGTGGCACAGTCAGTCACCGGGT
TAGTGACATGTGTCAGACTGACCTGTGCAGCTGTTAGATTTCACTTATGCCCACAAATTA
GGGGATCGTATTTTAACTATTTGCTTAGAAGACTCCTGCTATAGGAATAGAATTTCCATA
AAATGCTGGCAAGCGACTTGAATTCTAGTCTTGGCATTGCCTCTGACTTTCTCAGTGGCT
TATCCTGGTTCCATGAAATAAGGCCAGTCTTTTCCTCCTGAAGGTCTTCGGTGGCTTTTA
AAAGATTTGTTGTATTCAGCAAATGTAGTACCTGCTGTGTTGCTGTTCTCCACCCGGGAA
CAGCTTATACTGTAATGGTGGGACGTGGACTGTAATGATGATAAACATAGTTTCTTAATG
CCAGTGAGGTTATGAAAGTGGTGGCCTTCTTTTCCCAGTCACCCAGGTTACTTTGGGAAA
GTTGGTATGAGGCATTACCACTTAAAGAGGAATCAGAGCTTCTGCCCAACTGTCAACCTT
GATAAACTGTGGACCTTGGTCAGTGAGCAGACACGGGTAAATGCTGCCAAAAACAAGACT
GGAGCTGCTCCTATCATTGATGTGGTGCGATCGGTGAGTGATTGCATATTTTTTGCCTTT
GTATGGGTCCTTGCCCCCTCAAAACTCTGGGTAATCTAATCTACATAGTCTCCCACCTGA
CATCTGTACCCAGTTACCTAATAGACAGTTCCACCTTTTGGTAGAATTTCCACAGGTAAT
TCTCTGGTTGTGATTCAAGCAAAACATTTGAAGAGTAATCGTTCCCCACTCCTTTGTTCA
TTCAGTTACTTCATTTTCATTTGAATGTTTTCCCCATTCGGAATCTCATTCCTCCTGTTA
TTGCCCTGATTTGTACGGGTTTGCATTTCTTGTCTGAGCTCTTGGTACTAGCTTAGCTCA
CCTGGCTCTGGTCTGTTTTACACAAGCCTATGTGAGGTGCAGCTCTTGACCCTTTATGTT
TCTTACAGAATAAAATCCTAATATGTTCAGTTGTTATCTAATGCCCTACATTATCTGAAG
AGATCCCCCCAAGAAGCATTTTTGTGTATCACTTGGAGTTCTGGTCCTTGTGTCAGCCTT
ATATCCCATGGGTGTGGAGGTAGTCTGAACCCTGAGGGGACTTTTCAGTTAAATTTTAAA
TCCCCCCTCCCGGCCTCTTTAACATCCCTTGAAGAATTTTGATGGTCAAGACCTCTTGGA
AGGTTGCTGCAAATGTGGTTTTCCTTTTTTGCATATTATATAGTAATGGAGTGGAGGCGG
GGCTACGTTTTGCCCGAGACTAGAGTCACATCCTGACACAGCTCTTGTCCTGGTGTGCTA
GAGTCCTCGGAGAAAATCTGCTGGTCTTGATTCACTGGCGAGGGCAGTCTGTGCCCCCAC
TAGTGCCCAGATCAGAAACATGCCCCCCAGACCCCAGCTCCTAGAGGGAGTGGGTTGGCA
GGCGTCTTTTCTCGTACCATCAGGGAGTTGGTAATTGCCATAGTGTGTTAAAAACCCTTT
TCTCTGTTCTTCTAGGGCTACTACAAAGTTTTGGGAAAGGGAAAGCTCCCAAAGCAGCCT
GTCATCGTGAAGGCCAAATTCTTCAGTAGAAGAGCCGAGGAGAAGATTAAGGGTGTCGGG
GGGGCCTGTGTCCTGGTAGCCTGAAGCCACGTGGAGGGAGATTCATTAAATGCTAAGAAG
TGTTTTTCTCAGTGGCTTATCCTGGTTCCATGAAACAAGGCCAGTCTTTTCCTCCTGAAA
GTCTGGTGGCTTTTTTTAAAAGATTTGTTGTATTCAGCAAATGTAGTACCTGCTGTGTTG
CTGTTCTCCACCCGGGAACAGCTTATACTGTAATGGTGGGACGTCGACTATACTGGAGGT
CTGAGTGTAGGTTCTTTGTCACCTCTGCCTCTCTACCTGTACATCAGAAATCCACCTAAC
CTAGGAGTTAAGGGTAAGGGCCTGGACTCCTCTGCCAACTCTGCTAAGAAAGAAAATGTG
CAAGAGATAGCACCAATGCTTAGAGGTCTTTGCAGGTTACCTAACTTGAACCTTTTCATT
TATAAAGTAAGAATGATACCTGTTGATGACACGTGTATCTTATAGTTGAAGGGCCTGTTT
GCATTGTATACTGTGAATTTACAATTAGTGGGAGAATGTGCCCTTAACTTTTCCAGGAGG
CTCAAAAGGGGAGGTCTCAGTTTTGATGCAGCATGGTCTTTACAAGATTTTGATGGGTCA
CATTTTAAAGAGAGGACAGAGTGATAGGATTGAGGCAGTTCAGGACTTAATTCCTGAATC
TAAGGTTTTTCCACCTGGCTCCCGCATCTTGGACCAAGCCATTGTAAGTTACAACCAAAA
TCTTGGGTCCAGCAATCTGAATTTTAAACACAGCAGGGCTTTTATATCAAAGTGGTTTGG
ATTCTAGAGAGCACTTGTCAGGATTTATGGGTGCCTGTGCATAGGAGTCTTAATGTTGAT
AGAAATACGTCATGAAATGCTAACAGTTTTTCTTCTAGTCTGAAATGTATCCAGTAGAGA
AATTTGGTAATCCTGAAGGCATCATGTTTTCTGGGGTTTGTATCTCCTGCAAAACCGTGA
TGGTGACTGATGCTTGCATGCAGATAGGACCCTCATAGATCTCAGGGTAAATTAAAATTT
GCTATAATTTTTATAGTTCCCAAAATTTTGAAAATTTTCTGACCCAAAATAACACTTGCA
GTCTGGTGTGGTATCCTGACCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1065, 1495..1570, 2258..2432, 3375..3581
1002..1065, 1495..1570, 2258..2432, 3375..3500
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved