Equus_caballus Locus ENSECAG00000013915
snOPY snoRNA Orthological Gene Database
Equus_caballus ENSECAG00000013915
Equus_caballus
ENSECAG00000013915
7
SNORD15, SNORD15
1924..2073, 5420..5564
7464
GGACCTGCAACTAAGATATACAACTGGGGGGTTGGGGAGATAAAGCAGAAAGAAAAAAA
AAAAGATTGGCAAGAGTTGTTAGCCCAGGTGCCAATCTTTAAAAAAAAAAAAAAAAACTA
AAATAGTTTTATAGAGAAATTTCCTTATTTTTAAATGCAAGCAAACTATTCAAAGTAAAA
TTGTTGTTGAAGTGTTTAGTGCAGTGTTCTGACGACTTTGAAATACATCAAAAGATGCAC
TGGTGGTTGGGTGGAGGGATGGATAGGCATGTAACAAAGCAAATAGCAGAAATGTTCATT
GTAGCAACTCGGTGATGTGCAAGATGGCTGTGCACTGCACAGTTCTTTCAACTTTTCTGT
ACGCTTGACAAGCTTCATAATAAAAAGTGGGGAAAAATTTTTTTAATTGAAAAAGAATTG
TGAGCCCATGAGCCACTACTTTGTGACTTCTTTACAAGTTGTAACGGACTTTATGAAAGT
GGGGTGGGGTAAACGAGTTAATAATATAAAGGGCGTGGAACAGTCCCTAGAATATTAATA
AATATTGGATATTATCATTTGGAACGAAGGAAATGGACACAGATTGGAAGAGCTGGGCAT
CTCAATGAATTTCATCGAGGGCTTTCGGTGAATTTTCATTACAGTGTACAGTGTAGGGAC
CAGGGTTCCACGGTTGATAAACTGTTGCTCTGTGAGCTTATGCCTGTAAATGCCTGTAAT
TTCCATCTCTGCGCCTCACGTTGCTCATTTTTACACTAATTAGTTTTGGATTCTAAGCTC
CCTGGCTGTTCCAAAGTTCTCATTGATCTGCTACCTTTCCTGTTTCCGCTATAGGTGTCT
CCATTACCTTTCTTCTCTTTCCTTTAACGCCTTCCTAATGTAAAAACTACATTTCCCATG
AGCGCCCACAGGAGTCGACGTCGCGCAGTTCTTTGTCGTCGCTCAGCGTCCTTTATACCT
ACTTCCGCCCCCGAGCTACTTCCTTTCCTTTCGGCGGCGCGCGGCGGCAAGATGGCGGTG
CAAATTTCGAAGAAGAGGAAGGTGAGATGCTGGGGCCCAGGTCCATGGGATTGCAGCCCT
GTGCGCTTTATGGGGTTTTCGAGGTGCCGCCGCGAGATCCGCAGCTCCGTGCCCTGCCCT
GGCAAGCGGCTTGGCCCGCGTGGGGTTCCCGAGGGCCGCGGATGGTGGTGGATTGAGCGC
AGGGCCTGAGCCGGGCGAGCACAGTGTGGCGGGGGAAGGGGAGAGAGATTTCTGCCGGTT
CCGGGCGGAGAGCAGGGATGTGCACCCGGCGCCCCCACTGCCCCGGAGAAGGCGTTTGTG
AGCATTTACTGGTCAACAAGTAAAATTAGTAAAGGGGTTGTATTCCGAGGGCGCCGTGGC
TTTGGGAAGGCCGGTAGCAGTGACCCCATTCCTGCCTTCTTACTAGTCGTGTCTGGGTGC
GGCCTTCTGACCCCAAAGACCGCGATTGCAAGGCTGCTGACAATTTCTCCCTCCATCTGG
GACCCGAGGAAAAGGCGTGGGCGAACTGAGGGAGGGGACCTGGGGAGGACACTTTCTCAA
GTGTAACTTTGCGCCTTCGCGTGGGGAAGAAATGTGCAGAGTCCGTTTGCTTTAGAAACG
CGCGGTTTGCCATTTGGGGTGTACGCATATGGCTGTTGAGATTAAATCCACACGCTTTTG
TGAGTTAGGGTTTGCCAGCTCAGACACGGGTACGTGAAGTGAGGCGGGGTAACGTGGCTG
CGGTTCTTCGGATGGTCCAGGTTGCGTCTACAAGGGACACTGCTTGCCTTCAGTTACCGT
CTGTCCTTTTCTCTAGTCTCAAGCGTAGTATCCCTGCGGTGCCGAAGGAATCAGTTGTAA
ATGTACCATTTTAGAGCAGCTTTTTGTTTAACCTGTGTACATCTAAGTGCCAGTCTTAAA
AACCCTTCAGTGAAGAGATGATGACGAGTCTGACTGGAGGTGTCATCTTTGTCCAGGAGG
CCCCTGCTCTGTGCTGCGTTCTGTGGCGCAGGTGTAAGGGTCCTGGGTCAAAGTAACTTC
CAAAAGATGACCTAGAGGCATTTGTCTGAGAAGGGTTGCTACCTTACTGTTGGAACGAGG
GTAATAGGATGGATGGTGATGGATCGTTTGTTGGAAGTGTTGCATTTTGATGAGGGTTGC
GGTGGCTGAAAGACCAGGCAGGAGAAAGTGAGCCTGCACCCCTGTCCTAATTTTGGATTT
TCCTTTTTCCTTAGTTTGTCGCTGATGGCATCTTCAAAGCTGAACTGAATGAGTTCCTCA
CTCGGGAGCTGGCTGAAGATGGCTACTCTGGAGTTGAGGTCCGGGTTACACCCACCAGGA
CGGAAATCATCATCTTGGCCACCAGGTAGACGCTCATTTTCCTGGCTGGGTGTTGTCTAT
ATTAAGATAGTTTATTCTGTAAACTTAAGGGGACAGCTAAGGAATTTGGCCTTAGCGAAT
GTGGGTTTTTTAAAACTGCATTTTTTATCTCACTCCAGTTCTGGTCATCCAAAGTTTATA
CTTGTCAGATGATTGTGAGTTTACTACCGAATATATGCAAGATTTAAAGGGACGTCTGGA
ATTTTGTGAGAGCTGTGAGTTGTCACTGTTTATTTTCTCCAGGACGCAGAATGTTCTTGG
TGAGAAGGGCCGGCGGATCCGGGAGTTGACCGCTGTGGTTCAGAAGAGATTTGGCTTCCC
TGAGGGCAGTGTAGAGGTGAGTGGTCCTGGCTTATGTCAGAGATAACTGTGGACCTGGAA
ATGGTTCTTTAGGGTGGTACTTCTAGAAACCCTTACTCTGAAGGCCTTGTTTATTCATGA
TTAATGAGTGTCGTGAATGGGTTGGTATCTTGTTGAAGTTTTCTTGATAAGCAGTGGGCG
TAATGTTACAGGACTGTTCTGCTCACTTCTTGGTTCAGGGATTGTGCATTCAACTTGGGT
ATAGTAATGAGACACATAAAGGTTTGGCCACCCCCTCGGTGTCTGGTGTGGCTATAGGAA
GAGGTAGGCATGGAGGGCAGTGAGGAATGGTGCAGCCTCAGTCACTGGGGATGTGCTAGG
TGTGGCTGGTAGAGGCGCTTTAGTCCTTGAGATGTGAGTGATGCGTACAGTGGTGATGGT
AACAGGTTTCAGGATGTGCCTTGTTTCCTTCTGAAAGCTGTATGCTGAAAAGGTGGCCAC
GAGGGGTCTGTGTGCCATTGCCCAGGCAGAGTCTCTGCGCTACAAACTCCTGGGAGGCCT
TGCTGTGCGGAGGTAAGTGTCCTGAGACTTAATGGTCGTGCCCTTTTCATGGATCAGAAT
GCGGTGTGTCTGACATTTTGTTAATTCAGCAAATGAACTGTTTCTACATGGCAGGTTCTG
CTAGTCTCTGAGGTTTTTAACAGTAAGATTTTGCCAGTCCGTGTTCTTGCTGAACTGACA
GTCCAGCAAGGAAGACTAGTAAAAAAGCAAGTTTTTAAAGAGTGGTCTGTGCTACAATAA
AGAAGTTCTGGGTGCTTTGGGAGCAGAACAGAAATAGAGTTCTCTAGGTAGGGTAGGTTA
GGCCCCCCGTTGGAGTCATTCAGATCCATTATGTTAACTCCTCTGGGAACTATAAAGAGA
TAATACGTAGTCCTGATGAGAGAGAGCTTAAAATCAGTCACTTATTTCTGTAGGCTTTGT
GTAGGGAGGAGCCATGGACTATAAAGGATGTGAGGTGGTTAGATTGGCCCTGGAGCTGGG
CCTGCTGGAAAAGGGTTCAGCAGGCAGTTCTTGGTGCAGCTTGACTATTCGAAGTAATTG
GAATGCCTTGCCGGGCCTGTGGAATTTAGTCAGTGCTTCATGCAGAGCCCTGGGAGCGTT
TTCAGCAGAGGAAGGAAATGACAGCTGTGCTGTGGGCAAGGCCGTGTGGGAAAGACTGCT
CACCTGGTTTAAATGGCAGCAATACCACTTTGAACGGTGATTCTCGAAAGGTTGGGCCCT
GGGCCAGCGTGACTGCCATCATCTGAGGACTTGTGAGAAATAGAAATTCTAAATCTCCGC
CCCGGACCCACTGAAACAGTGAGGGTGTAGCCAGCCGTCTGTCTTAACGAGTCCTCCAGG
TGGCTTTTGCACACACTGAAGTTTGACTCTGAAGTTCTGAGACCTGAGCAAGTTACTGCA
CTTCTCTGACCCTTGGATCTCCTCTCTAAATGGGGATCAGCATACCACCTCCTTCTTGTG
GGGGTTAAATGAGGAGCTAGGAAAGGGCCTGGGGCATGGTGGTGGGATTTAGTCCTTCCT
TTCCCTGTTGAAAGTGCAGCCAACTCTCCAGTTAGTAGCTCCCAGGGTGTGAACTGATGA
ATGAGTTGGGGAGCGGGGTATTTTAAGGTTTGGCCGTTTTATAGACCTAGTAGTGTTTTC
GCCCAGCACTCTAGTCAAGGAGCCTAAGTTAGTAGTTAGGGTTCCTTAATGAACATGAGT
TTGGAGGGTGAAGAATGGTTCAGTAATCCATAAAGGGGCCACTCGGTGTCAGGGATACTT
CTGGGCTCCTACTGATAACTTGCCTTGTTCAGAAATCCTGAGTTTGCGAAGATGGACTAG
ACTGGAACGGCCTGCTCCAGAATGGAGCCGGGGGGGCGGAGGGGGCCCTTGATGATTGTG
AGTTTAAGAGTGCAGTGGTCAGCCTTGGTTGCACATTAGAATCTCCTGGGGAGTATTTTT
AAATATGTATGCCTAACCTTTACCACCCCCACCATTTCCTTGCTAACTTAATTGGCTTGG
CCTAGGCTTCTGGAGTTTTTTTGTTTTGTGTTTTTTAATTTTAACTTTCTTGAGTTGACT
CTAACGAGCAGCCTAGGTTGGAAAGCACTTGGTTAGAAAGAACTTGGCGTGCATTCCCCA
GGAATTAGCCTAAAGTTAGGTGTGATGGGAGTGGAAGAGAAAGGAACGTTGAAGAAGTGC
AGATTAATGAGTCTTACTGCTTTGTTTTATGACACCGTGGGGCTGCGTAGGGTTGAGCAG
TCCTGTCTTTGGGACAACGTGACGGCCTGTCTGTCTCTTACTCCCCAAAGGGCCTGCTAT
GGCGTGCTGCGCTTCATCATGGAGAGCGGGGCCAAGGGCTGCGAGGTCGTGGTGTCTGGG
AAACTCCGAGGACAGAGGGCTAAATCCATGAAGTTTGTGGACGGCCTGATGATCCACAGT
GGGGACCCTGTCAACTACTATGTGGACACTGCTGTGCGCCATGTGCTGCTCAGACAGGGT
AAGCGCCTGGGAGTGCTTGCGGGTAAAGGTCCTTAGCGGATGGATGTGGTCTTCCACGCA
CACCTCAGCGTTTGGGGAATTCACCCTGGGAGTAGTGGAGCGTGTTTATACTCCCTGGGT
TTGTTGATCAGCTGCGGTGAATTGCTGAGATCGGTCAGATCTGAGAGTTGGTTTCTCCTT
ATCTCAGCCACCTGTGTACCCTTCAGTGATGACACGATGACGAGTCAGAAAGGTCACATC
CTGCTCTTGGTCCTTGTCAGTGCCACGTTCTGTGGTGCTGTGCATGGGTTCCTTTGGCAA
AAGTGTCCTGTTCATTGATTGATTAGAGGCATTTGTCTGAGAAGGGACCAGACCCAAGGG
TGCTTGAGTAACTTACTCTTCTCTTCCCTCTGCCCTATTCTGTTGTGTAGTGGGAACTGG
TCAAACCACAGTTAGGTCCTAACTATGGTGTCCTCTAGGTGTGCTGGGCATCAAAGTGAA
GATCATGCTGCCTTGGGACCCAAGTGGTAAGATTGGCCCTAAGAAGCCGCTGCCTGACCA
CGTGAGCATTGTGGAACCCAAAGATGAGATACTGCCCACCACCCCCATCTCAGAACAGAA
GGGTGGGAAGCCAGAGCCGCCTGCCATGCCCCAGCCAGTACCCACGGCATAACAGGTATG
TCTGTAGGGGCCCCTTGGGGTGGGATAGAACCCTATTCATTTGTCTCCCTGTTAATACTT
GGATCCTACACTGTGGTAAGCACTTGGTGTATAAAAATTGGATTACGCTTGTGCCCTACA
TGGGAGAACACAGGTTGGAGCTGAGCCCATTTAACCTGGGATTCTCTTGGGAGGGATGTT
TGCCTTTGGTCTCCTTATTTACGAAGTTCCTGCATGTACCACTGTTTGAAATAAGAGTTT
CCCTTTATCGTCCACCGTTGCTCAAAAATTTTAAGGCCCTCTTGCTATTAGTTAGCTGTC
TGTTTCAGAACCTCCCCCCGCCTCCCCCCCGGAGAACCGTAACATCAGGCCTCTCCTAGG
CCAGGCAGCTCTGCTTTTCTGTTTCTGGGTCTTTTCTGTGTGTTTATTAATCTTCATGCA
AACCGTAAGTGGGAATGTATCCCCATTCGGTAATTGAAAGAACCTGATACTCAGATGGAG
TTTCTCTTCTTACTGTTGTGCTTTATTTGGTTTCAGGGTCTCCTTGGCAGCTGGATCTGG
AGTCTGGATGTTGCTCTATAAAGACCTTTAATAAAATGTTTTTAAAAGATACATGGCCTG
ACCAGACTGTACGTCCGGTGTTCAGACTGAGGGTCTTGTCGCCACATGGGAGCATTACTT
CATTGATTCTTAGGGCTGCCTGGCTCACGATGTCTGTGCTTTCCCAGAAATCCTCCGTTT
CAGCTGAACTTGTGAGGCAAGGGCCAAGACAGGAGGACCCAAGCAGAGTTAACCAGGGAA
GTATCCTGTTGGGGGGAGTAAATCTGGTGATGGAGAAGGCGGATTGCTAACAGAAGGCAC
CTTGATTAGCTCACCTGTGCTTCAGGGTTACAGGTGTGGAAGAGGTATTATATACTTAAA
ATGATTTTCTGTATTGCACATAGAAAATAAATACAATAGCTGTTACATTTTGGGTCATAC
TGTGCTCTAGGTGGCGTGCTTTAAATGCTTTCTCATTTAACCCTCAATGTCTCTAAAGCA
TAAAGCGAATTTGTGCCGTTGGTGAAGAACCTGAAGCTCAGAAGTCAATTTCCCTAAGCA
GTGTAGAGCTGTGGTTAGAATTCACATTTCCATGTCCTGTTCTCTTAGTCGTTATACTCT
AGAAAAGTATAAAGAATGTTTAATTGTCTACAGTTTCATCTGTCAATTTGAAGTGTTTTC
TACTCATGTCTTTTAAGAGATTGGGTGCTCTTAGTTTATTCAGGTGAAACTAGTGAGGGG
CAGGCTACAAAATCCTACAAGACTAATTAGAGTGAATTAATGAATTATGTTGGGAGCACA
CTGACAAATGTATCTCTGTGTGTGTGCCTCTTTTTAATAGAAACTTTGATGTCTGTAGTC
ATGCATCACAATGTTTCAGTCAACGCTGTACACGTATACCGTAGTGGTCCCATAAGATAA
GTATTCATATAGTCTGGGTGTGTGGTAGGCTGTACCATCTAGGTTTGTGTGAGTACACTG
ATGTTCACACAGTGACAAAATCACCTAACAGCGCATTTCTCAGAACATGTCCCTGTCGTT
AAGCGACCCATGGCTGTACTGCCTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1040, 2234..2364, 2622..2715, 3157..3251, 5030..5217, 5678..5874, 6396..6464
1011..1040, 2234..2364, 2622..2715, 3157..3251, 5030..5217, 5678..5868
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved