Equus_caballus Locus KIAA1731
snOPY snoRNA Orthological Gene Database
Equus_caballus KIAA1731
Equus_caballus
KIAA1731
7
SCARNA9
37109..37460
39139
ATATTGTCTGGTAGTTGTTATTTATTAAATGAATTTGAACATTAAAATGAAATAAAACT
ATATAGCCTCTATCCTTCAGTTGTTAGGAGTCTAACTAGAAAGGGCAAACTAGAGGAGGG
TAATACAACACAACGTTAGATTAGTCCCCATACGAATGGAAAGATAATAATGTTTTATAG
GTGGGTAAGTGGGGAATGAAGGCTTAGGCGAGCAGAGCAAGAATTGCTAGGGGACAGCTT
TGTGAAGTAGTGGGGCTTAAGCTAGCTTCAGAAAGATCAAGAACTGTATCCATGTTATAA
TCCGGGGAGGAGAGTGAGAACACTTGAGTATAAACAGTAGCACTAGAGGAACAGATCTCA
GAATCTAAACAGTTGGCTCATCCAAACGTCAGAATTGTTCTTAAAGAAATTTTTCAAATG
GTCATTCATTTAAAAATCAATCACACCACTGTAATTATTGAAGAATTGTTGCGGGGTTGA
TGTGATTCCATACAGTACAATGACACGTGGTGATTAAGTTATGTACGACAGACTAGGAGT
GGAATCTAGAGACCAACAGCTCTTGAAATTACAGCAGTCTTGCTGGTTATAAACAAGTTA
TCAAAGTTATGAACTGTTAAATTGTAATTGTGAAAACATTCATTCTATGCTAACACATCT
TTTTAAGTCTCTGCTTTTTTACGTTTAAGCTCGGTAAACTCTGGAAATCCCAATCAGGAG
TAAGTCAGGTCCCAGATAGTCTAGGTAAACAATAATCTGCTGAAGATAGGGACAGACTTC
TTCAAGTAGTGCTGATTTACCCTCCACTTAACCCCTTCCCACCCATCTGAGAACCGCTGA
TGTAAGTGCTGAATTAATAATTGCTATTTGTAAATAAGTTGAACTTTGTTTACTCAAATT
ATTTTATTTGCATGTATACAGCCCTTTAAATGTCAAAGTATTAATATGTATTTTAAAAAT
TATTCTTTTCTACCCTAATAGACATTTTTCTTTTTTAAAATTCAGAACCTTTGTATTTAA
AGTACACGGAAATGAAAAGAAAGGTAGCGAGTGCTGGCAGGCTGAGATTGAGTCCCAATG
AAGAAGCCTTCATTTTAAAGGAAGATTATGAAAGAAGACGAAAACTAAGATTGCTACAGG
TAAGATATATTTGGAACAAAGTTTCAAGTTCTTTGTCTTCCCCAAATTATTAGTATTTTT
TACATTAGAATGTTCTAAATAAAATGTTCCTTTTCTGGCTGTACACGAGCCCTGGTTCGG
CTCCTGCATATAAACTGGTTTGGGGACATTTGAAAAATAGGCTGAAATGTTAAATAGATT
GAAGGAGAGTTTGAGGATAGGGATTATTTGACTCAATAATTATTGGGAAATGGTTCTTTA
AATATTTTTTAAAATCATGCGTTACTGATGAAGATTAGAGCAGGAAGATTAGAATGACTT
TGAAGGAGACCTACTGGAAAGATTATTAGCTGCTGAAACAAATTTATTAAGAAGTTGTAG
ATTATTCTTTTTAAGTAAGATGGTTAAGTCTTTGTGAAGCGTGTTTTTGGTGCCATTCTG
TCTAGAATTGGTGACGATGGACCACAGATACGGAGTTTTCATCTAGCTCTGTCTGTACTC
ATCTGGGCTGGAAATTTTGTTGAATCATGCTTACCATTTTAGCCTCTTCATGGGTTATTA
GAATGATAATGGCAGTCCCATAAGGGCTTTGCTGGTGGGGTATATTAGCTAATCCATGAG
GGAACTTTAGAACTAGTATTGAAATTTTAATTTTTTCTCTATCCCTTGGATTTTCTGCTT
TACATAGGTCTTATCTAATTTGTGGATTTTGAGGAGAATTGATAGACCTAAAGAGAATTC
ATTTAAGTTCCTGTTTACAAATGGCTTTTCAAAAAAGTTGAATTAAGATCCTTTTCTTAT
AATCTGTTAAATATTCATTCTTTAGGTTCGAGAACAAGAAAGAGGTATTGCTTTACAGAT
AAGAGAAGATATAAAACAGAGGAGAAATCAGCAATTCACTCGTTTGGCAGAGGAGCTAAG
GACAGAATGGGAAGAATCACAAACTCAGAAAATAAAGAACTTGGAAAAACTATATTTGGC
AAGTTTAAGAACTATAGGAGAGGGACATCAACAAGCCAAAGAAAATGTGAGTGAGCACTT
ACTTGACTACCTGTCTGTGCCAGTTATATTGGTTAAAAGTAAATTTAGTTGTTAAATACT
TGTCTGATAAAAATGTTTTCATGTATAGAATTTGTTTTGGGCAGCCTGAACTAATTTGTG
AATTTAATATATTTTAAGAATGCTGCTAGGTTCATTTCCCACTAAGAGTCACGTCAAGTG
AAATCTATCTTCCTACGACGTTTAAATTAGCGTTATTCCCAGCCAGTCCTTAGCTAGCTG
GGTAAATAAAATAGTAACCTTTGGAATCAGGAGTTGTTTATTTCTAGCACTTTGGACAGA
TTCACTGGGGTAAATTCAGATTTCCCATGTCATTATTATTCTTCATACCTCCAAAACATG
TATAGCTTAATGTATATACACTTAGATTTCATTCAGACAGTAAAAATCCTTTGATGACTT
TCAGGAAGGCGAAGTAGACGTGAACTCAGTGTTTAAGATTGCTCCCTGACCTTGCTTTGT
TGTTTATTGTGATTCATGATTGGAAAAATACTAGATTGCAGTCCCAGAGAGAGTTGCACA
AAATAAGCGAGCTGGTTCTAAAGAAGGCAGGTCATTGATATCAAACTACTAGCAAGGAAA
AGAAAGATCTTTAAAGAATATGGAAGTCAAATATATTCCTTGGTCCCTAGTTTAGTCTGT
GTTTTTGGGGATAGCCTTTGGGTCTGGCATCAGATTGTGGTGCTGTATTTATGCCGTGAT
TAACTTTGTGCTTTAGTGCAGTGTCTCCCCAGACCTCAGTCATTTGAATACCACCTTCAT
GGTTTTTGCCCTGACTGAGGAGCCACCCGTATTATTTTATGTTTGGCATTTAATCTTGTT
TAACATGACATTTTAAGTAATATATGTATTTTAGGAACCTGATTTGAATGCTCTGGCACA
GCGGGCAGCAGAAAGAAAAAGAAAAGCAGAAATGAGGCATAAAGAGGCCCTGAAAGTACA
GAAAAATCAAAAAGAAATATTAATGAAACAAAAAACCTGGTAAAGTAATAATGATTTTTA
CGACATTCTCCACTGAAACTGATATGGCTGGAAGGCAAGGGTGCATTGGGTGCTGTTTAA
GCAGATATTAAGTAAAAAGCATATGGTATAACTATTGCGTTTGTTAAACTTGGTTTAAAA
ATAATGCAGTGGGGGAGTGTTTGCTTAGTGAACATAGTAACAAAACGAGCTTTCTCTTCT
AGTCCGGCTTCTGCAGTGATTACTTCATCTCTGTAGAAATGTACCGCTAGTTCAGAATAC
ATGTCAGCCAAAATCTTTCTACCTCTGATGTAAAAAAAGAAAATGAGTGTGATAAGAACA
TTAAAAGAGGGTGGAAGTCATTAGTGAGTATTTCTGTATGTTGTAAAAATGAAGGTGCCT
GTTACTAGTCACCAGTGGTCATTTTATACAGTGGGCCATCTTTATCAACATTTCTAGTTT
TTTTCCGCTAAACAGTTCTAAACTGAGGAACATTGGATCTTTGTTGGGTCAGTCCCCACT
GTAGAACGTCATGTCTTTAGATACACCTCTTTCACTTGGTAAACATTTTCTTGTTTGTCC
ACTGGGTATAGACTCTTTATTAAACAGCGTAGTGATCCTGTGGGATCAGACTGGAGGATT
CCTTGAGATCCTATGGCTTTCATATTTTTAACCATAAGGGTTGTACTGTAGTATTAATTA
AGAGATTAATTTATGACATCTTTTGTTTTTTAAGGCATATAAAAGCTCGAAAGGAAGCAC
TGCTTGTGGAAAAAGAGAGATCTGCCAAAATTACGAGTCTGCCACCTCCTCCTCCAACTC
TTTTTGAGGTGAATTACTTGCACTGTTGAGAAGAACTAGGTTATAATAATTCTTCTTTAC
CATTAAAATTCAGTGAGGTCAACATATAACAGTATTTTAATTTTAAGTTTAATGTTTAAA
CTTTATTGTTATTTGTACAAGTAACACATTGAGCTACTTAAAACTTATTTATAAATAATA
ATAATAGGTGTCATTTTACCTGTGAATACTTTAGTATGTATCTCTGATGTATAAGGACTT
TTTTTCTTTCTTTCTTTCTTTTTTTTGTTTGCTGAGGAAGATTTGCCCTGAGCTAACATC
TGTGCCAATCCTCCTCTTTTTGCTGAGGAATACTGGCCCTGAGCTAACATCTGTGCCCAT
CTTCCTCTACTTTATATGTGGGACGCCTACCACAGCATGGCTTGCCAAGCAGTGCCATGT
CCACATCCGGGATCTGAACAGGTGAATCCTAGGCTGCCAAAGCAGAATGTGCACGCTTAA
CCGCTGCACCACGGAGCCGGCCCCTATCCTCCTCTATTTTGTATGTGGGTCTCCATCACA
GCATGGTCCCTGACAAGTGGTGTAGGTCCACTCCTGGGAACTGAACTTGGGCCACCTAAG
CAGAGTGTGCCAAACCTAACTACTAGGCCATGGGGCTGGCCCCAAGGACTTTTTTTTTTA
AGCACAATAGTAAGATTGTTTCCAATATCATCTAATACCCAGTCTGTTCAGTTTTCCCCA
GTTGTCTTAAAAAATTTTTTGTTTGAAAAACTATAATGTTTTTGATTTTTTAAAAACTAC
CAATAGTTTGGTTGGTTTTTTTGATGCCCTTTATTTATTGGAAAAAACCCTAGATTATTT
GCCCTGTAGACTTTCCCACATTCAGAATTTGGGCATTGTAAATTGTTACCATTTTATAGA
TAAAGAAATTAGGTTCAGATAAGTTAATAAATTTACACAAGATTACATAGCGCTGAGAGG
GGTTTATTTCTTTATGGGAGTAAAATGTGTGCTTTTGTGATTTGGAGCTTATTTCTGAAA
AGAACAATTTATTAAGTAAAGTGGAAATTAATTTTAAGAAGTATTTTGTTCTCTGTTGTT
ACTGAAATGGTTATTTGGATAATTATCAAAATTGCATAGTTATTTTTGTCTAAAAAGTTA
AGTAGAAATAAAAAACTTATATAGGGATGTCTAGTTAGTTGTATATACAAGTATATTTTA
TGTTTATTTGGTCAGCGTAAGTACCAGATATTCGCCTCTTAAGCCTTTCATTTTGTCAGC
CTTCCCGCTTTTAGATTGAGCCATCTGCTGTGTAATATTTGATCCAACATGATTCAAATG
GCAGAGTCAGATTTCAGTCACTCCCTCAGTACCGTGTTAAAAGGCAGGCAGTTTTTTATC
CATGGTGTCTTTTGATTACCTTTGTCTTAATTCCTAATGTTTATAACAAGCCAAGGTCAA
AAATTTATAAAACGAGCAAAACATTGCGTAAGTGATTTAGCAAATATGAATTGTATGTAA
ATGTGTGGTTATACTTTTTTCCCTCAACTTTTTATTATGAAAAATTTCAAAATACAGAGA
AGTTGAGTCTAGTGAATGTTTGCATTGTGTATAAATTTCAGATAGTTATGTGTATATATG
TATACATTTGAATGTAAGCTGTAGAGATGACATTTCACCCTAATACTTTAGCATGCTCCT
TGTGAGAATAAAGATGTTCTCTTATGCAACCAAAATAAGACACCAAGAATATTAACATTA
ATTCCTTAATACCTTTTAATATACAATCCATAATCAAAATTCTTCATCTATCCCTAAAAT
TGTCTTACAGCTTTTTTTCTTTTTTTCAACCGGGATCCACTCAAGATTCACACGTTGCTT
CTACTTGTTTTGTCTCTTCAATCTCTCTTAATGTAGAACATTATTTCCCCCAACCCTACC
CGACTTTTCTATTTGAGACTCTTTGAAGATGCTAGACTAGTTTCTCATATTCTATATTTA
TCTCATTTGGTTGCTCTGGTGACTATAAGAGATCTCCATCGTGAAGATACATTTTTCTCT
TTTTAATTACCAAGTAATCTGGGAGATGATACTTTGGCACCAGTTAGGTGTCTGTCATCC
TTCTACATTTGTTCATTGGCCTATTTCTGTTTGAGAAAAGAACTTTCTCTTATCAGTGGG
CACGAATAACTGTAGCCAAATGTTCAAACTTAGTAATAGGGGAGCAACTTGCCATTATGT
GCCACCTGATGTTAATCAGTAAATTGTACAGCATCAGTTATTTAGTATTCTTTCCTAAAT
ACAATCTAGCTTTTAAATCTAAATGCCAGTTTACTGGAAATACAGTTCATGATCCCATGT
GAAAAAAACGAATAAGGATAACTGGGTAAAATACAATTATTTTTTTGCTTTGGGTCCAGC
TTTAAGTGGAAATTAATGCTTTTAGCTTAACACTCTATTTTCTGTGTTCCATTTTTCAGA
ACATTAAAGTAAAGAGCATTTCTGATGTGAAGACCAGTAGTTCTACCTACCATCATCTTT
TCAATTTTGTGAATAGAGAGATGGACACAGAGCAGGTGATTGACTTATTGTTTGTTCATG
ACCCTCACTGTTATTTCTCTGTCCATTGAATTGAGTTATTTCTTGATTCTAGGTATGTTG
TTCTCAGATGTCAAAATTTGAACAACTCTACTAACCATCTTTGGGTAATAGTGATAAAAA
AATCTTTTAAATATGTTTTGAATTATCATGTGATGTTTAATATGAATGAAAGGAGTTGGC
TATTTAAATGGTTATGTTTTAAAATAGCTGACTTAAACTTTTTATCATAAAATACTACAT
GCTTTTTGTGAAAACTTTGGATCTCTGCACATCAGCATAAACTATAGGAAAAATACCTGA
TTCCATCACCAAAAGTAATGTGGTTAATACATTAATGAATTCATTATTGTCTTTCTATAT
AAACATGTGCACACACTTTTCAAAAACATGATTTTTAATAGACACTTAAGATTTCATCAT
AGCATTTATTTAACCAATCTCAATTCATTTTTTTTTTGCTTGTCTAAATAATGCAAACAT
AATAATTGTGTACATTTCTATCTATAACTGTATAAGTTTAGAATAGATTCCTAGAAGAGA
AATTATTGATTCCAAACTGTATAAGATTTTATACAGATCATTAAATTGCCTTTTAAAAAG
CATCAGCAACATGAGAAAGGCATCTTATCATACCCTTGTCTGTATAGAATATTATGGTTT
AAAAATTATTGCCAGTCTTGGGGCCGGCCCAGTGGCATAGCAGTTAAGTTCACATGTTCT
GCTTCTCGGTGGCCTGGGGTTCACCGGTTTGGATCCCGGGTGCGGACATGGCACCGCTTG
GCAAAAGGCATGCTGTGGTAGGCGTCCCACGTATAAAGTATAGGAAGATGGGCATGGATG
TTAGCTCAGGGCCAGTCTTCCTCAGCAACAAGAGGAGGATTGGCAGTAGTTAGCTCAGGA
CTAATCTTCCTCAAAAAAAAAATTATTGCCAGTCTTAAGAGTGACAAATGATATCTCCTT
GTTATTATAATTGCTGTTTCTTTGTAACAATGAGTTGTAATTTTTTTCATGTTGAATATA
TCTGGCTAGTAGGAAAATAAACTTCTTCAGTGTAGCATTCATGTGAGTTTAGAATGCAAC
AAATACACATTTTGATTGACTGCTTAATAGCAGGTGTTAAAATAGATGTGTGGTCAAGCC
CTCAGATGAATATCATCATCATAGAATTAACTTGTAAAAAACAAGAATAATCTTGAGATT
CGTTTAAAATTGTAAATTATTATTACGACTTCAATATGATTAAAATACAGGAACAATAAC
TTCAGTCTGTTGCTAACTTGCTCTTGTGGTTACTACACTGCATTTTTGCAGTAATAAATA
GATGTTTATTTCCACCTAAGATTGATGAAGAGACTTTTTTTTGCCTAGCACTAGTATAGG
GTTCCACTGATGGTGTTACAGTAAGTTATTAAACTTTCCTTTTTGATAGTAACTAAAAGA
CCAACCTCCTCTTCAACTTGAAGATTGGATCAGTGGTTATAATGCGGTTTTATAAAAGCT
GTCCCACAAACTATAGCATTCTAATATTTCCTTTTATTTATTTTGTCACTCCATCACTTA
TGGAAAAATCTGTCCTTAAACTTTTGGTTTAAAATGTGACAATGGAGCAATGTGATTGGT
TTTCCAGATAACAAAATTACCTCTGAATTTTTATCTGCATCTAGGCTTGTATCACATGTA
CAGTAATTTAGCATCTTTCCTGGAGTACAACAATAGAATCTTTACAGCAGGTATCATGTG
AAAAATACTTGCACTCTTGGCATTTATGTTTGGTTATTATTCAGCAGCTTTCTGCAAATA
AACTACTTTCATTCTTCAGTCAGCCTTTTTAACATGTGACAGCTGCTATCCTGTTTTCTT
TGAATATACTGATAAAGTAGTTCTAAAATCTCTTATATGTCATAAATTTTGTCTTTGGCT
GAAAGAATGATGAAAGTGGCTGGCTATATTCCTACTTAGAACCAGTTATTCTCTGGCTTC
TCAAAATTATGTTTTGTGACATTTACTTTCTATACATACAACTTAAAAAAACATCATATG
CTTGAAATTCCTAAATTACTCATGGCCTTCATTGTGTTTGTTCCTTTGTCAATGACAGCT
GCCTAACACTTACTACAAATGGATTTTTCATCCTGGAAATATTTTTCCAGTCAGATCCAC
TGTATCATTTGCTGTGAAACCCAGAAATGTCGGCAGACAAGTAAAGCAGAAACTATTTAA
TTCATCAAATTACTCTGCTATTGTGCTTAAAAAGATTTCTGTCCAAATATCTGATGCAAA
TAAAGATGCAAAAGTAGCATATTTAATAATATCACATTGTTACGTGCATTGCAGGTTAAT
ACATGGATTATGCACAAGTTCTAGGAAGTAGATGTTCTGATGATTTGGCCTTCCTGAGGC
TGAAGCCAAGCATCAGATGTTGGCTGAAAACCAAAGATAAATCTTAGTGCTTCCCCTCAA
TGACTTATGTGACCTTTGGGTTTGTGGTTTCTTCACTACAAGCTTTGTCAGTGTTTACCT
TTCAACATTGCCATTTTAATGGAATTTCTTTACTTAACAAAAAACGATGGGGGAATGTGT
GTGAGTATAGCGTAATCTGGTTTAAAATGAACTTGTAAAACTTTACACTAAGAATTTGAT
TTTTTTTTTTCATGGATACATTCTGTTTATAATTGTGGGCATTTAAAAATGTCTCTTCTT
TTTGTTTAATTTTACATAAGAAGAAAAACCCAATTTTATAGTTGTTTTATTTTTTAGTTA
TCACTTTGTTTCACACTTCTAAACTGTGTAAAATGTTATTGATTGCTAGCCAGATCCTCA
TTTGGCTGCTGAAGAAGAAGCTAAAAGATCAGAAGAACTGCAAAAACAAGCAGCGCAGGA
GAGAATGCAGCAGTGTGAAAAAGCACATGTTCGGGGTTTCCAAGCAATGAAAAGGATCCG
TTTGGCTCAGGTAAGAATTAAGTTCTGGCTTGACCCCTTCTGATAGCCCCACCCACAGCA
GAACTGGATTAGTGAATGGGCTCAAAGGACAGAGGTGTGAAGAATGTGAAAACAGAGTCT
GAGTCCTAGGATTTCAAGTTTCCTAACATTCTCTTACCTCCTGATTTAAATTCAGGTTGG
GTGAAGCTATTCTCACTTAGAGTATACTGCTGTTCTAAAATTTTTACTGACAATGAATTT
ATTAAAAGTGTAATATTTTAATCAGTTCAAAAATAGCCTGAGAAGAAATTAATCACTTTT
CCACTTTAAGTATTTGAATTGCATTTGTGCCTTGCAAATTTTAGGATTCAATTCATTAAA
TATTTATTAAGCAAAATACTTGTCGGTTTTGCAGAGTGTTGATTCAGAGGTAGAATTAAT
CCTTGCTGTCAAGGAGCCTTGAAAAAGTGACTGTGGCAGAGCTGCAAAATATGTGTAATG
AAACCTCGCTTTCTGGTGTTAGCTTCAGTTCTGTTGTGCTTATTGTTTAGTGGTTGTTTA
TTTTTGAAACATACCGTGGTATGTAATTTATCTCTTTAGAAGTCTGATTTTATTTTCTGA
ACTTGGCTAATGCATTTGGATGTTTTAAACGCTGCTCTGAGGAATGAGTTTTTAAGTACT
TCTTTGTGAATTAAGTGCCTATTTGGTACAGGTCATTTGTGTAGTTTTAACTGAATTATG
ACCTTGTCCCTTAAATTTTTAGCTTTTGTAAACTGGGAGTAAATTGTGACTAAAATAACT
GAATGTCCAAATTATTGCCACTAATTCTCATCTGAGGCTTAAACCTATAGAAAAAAACAC
ATAAAAAGCATTGTAAACTGAACACATTCTTCTATAAGTCATTAGTGTTTAGTGGTTAAG
AAAGTGGACTCCACAGTCTGCCTGGATTTTCTTTCCTTCTTCACTGTTTAGCTGTTTGAT
CTCAGGCAAGCTACCTGACCTCTCTGAGCTCTGTTTCATCAGGATTAAATGAGTTTAGTA
AAGCCCCTAGAACTATGCCTTGAATTTCATAAGCTCACAGTAAGTGTCAGTGGTGGTAGT
AGTTGCTACTGTAAATAATTCAAGTAGAATAATATTCAACAGTTTCTGAGTCAGAAATAG
TATACTTATTCAAATAACTTTGAAGTTAATTTAATGAGATGATTTAAATTGTAAGATAAA
TGAAATGAATCCATTCATAATTTTCAGGGCAAGGCAAAAGAAAATTCATCTCCAAATGGC
ATAATATTTAGAACTTCACATAAGAATAAGTCGTGTGTGTATGTTATCACTTAACAAACA
CTTTGTTATACAGGCTTTCCACCTTTCTGTAGCCTTAGTGTCTCTACTCAAGAATAATCA
TGAAAACCATGTAATTGGAGCCAGCCCTGATGACCTAGTGGTTAAAGTTCAATTGGAGCC
AGCCCTGATGACCTAGTGGTTAAAGTTCAATTGAAGCCAGCCCTGATGACCTAGTGGTTA
AAGTTCAATTGAAGCCAGCCCTGATGACCTAGTGGTTAAAGTTCAATTGAAGCCAGCCCT
GATGACCTAGTGGTTCACCTTCCATACTCACTTCGTTAGTGGCCTGGGTTCATTTCCTGG
TTTTAGAACCACACCCACCTGTCTGTCAGTTGCCCTGCTGTGGCAGCGGCTCACATGGAA
GAACTAACAACTAGGATATACAACCATGTACTGGGGCTTTGGGGAGGAGAAAACAAAAAC
AAACAAAAAAAACCCATGCACTCTCACTACTATTAGAGGATTCCTTTCCCCTATCTGAAC
CTTCTTGCTGCAGACCCCATTGTGCCCTGGGATCTTATTTCCTGCTAGTTTCTGTTGTAA
CTAGCATTTGGCCTCTACCTGCCTCTCTCCCTTTATCTTTTTTCCTTAACCAACCCTGCC
CCCCATTCCCTACCTATAATGAACGGTATACTCTTAGCATCCCATGCCTTCATCTGCAAA
CCTTTGTGCTACTGTTGTTATTTCTTACTTGTACTCCTCCTCCACCCAGTTTTATCTGGC
TAAATCCTTGTCCCAAGGGGATGGGAGGTCTTCCTTTATGCCCCCTCACTGTCTTCCACC
GCCAAAATTCAGTTAGATAACCTCACTGATACGTTTGCTTAAACTTTCATATTAGCAAGA
CTTTTTGAGCTTCAAGATACACATACAGATCCCCTTTAATCATGGGGATTCCTAAGTGTG
TGAAGTAACAAGAAATAGCGTCTGTTAAGCCACAGTCACTCTGGTTCTTGTTGCTTACCT
GAGACTGGTATATGCTGCTGGCTATGTGGAAAACTGGCACAAAGTACACTGCAGGAGCCG
TGGCAACTTATATAGAACATCACTTCATGAGTGTCCTAAGAAAGGAAAACTGTAACTGAC
AGATGCTTTTGAAGCTCTGTGGCCTAATCAGTACCACCGTGTTATAGTGCTTACTAACAA
TACTACTTACCTGTTTGTTGGTCTCTAGGCTAGGGGTCAGATTGTGTCTCTAGCATCTAG
CATGGTATCTTTCATTCAGTAAATATTTTTTTTTTGAGTGAATAAATTAATATCTTTTTG
TGGCGGAACAAATGACAGGGGAGGAAAGGAAACCCCAGGTCCTGTTTCTCATGATTTCTC
CATTTTTCCCTCACTGTTAATGTTACTATCCAAAGTTTGTGACTCAACTATTGTTAATTA
ATTCTCTTTATTCTTGAAGAATCAAGAGAAACTAATGAAAGAACTCAAACAGCTACAACA
AGAGGACCTGGCTCGTAGGAGACAGACTGTAGCACGAATGCCACCACAGCTAGTTGAACT
TCCATACAAACGCAGTGAGATGAAAGAAGATTGGCAGAGAGAGCTGGAGTTTGCCTTTGA
AGACATGTATAATGCAGACAGGAGTAAGATATTCTTAATAAACTTTCAACAGTGCTTTTA
AATATTTTGGTGGGAAAATAATATTTGTATTGATGAAGCAGTTTTTATTTTGAAATAAGT
TCTCTATTTGAAAGAGGCCCTCATATTTTAGACTTAGAAACTATGATGGTCTTTAAAATT
TTATGCACAAGTTCTGTTTAGTCATTCTGGAATGGAAACATGTCTCTGTATTTCTTTATT
GAGAGGTGAAAGGAAACCTGATTTTGCACCTCGAACCGGAGCCTTTGCCCACTGTGACTG
ATCAGATCCAAGATGAAGAACTGGACCTTTCAATGGAACAAGAAAATTTAGGTGAAACTG
AAAACCGTCCAGTGACAGAAGCTGAAGCACTATGTTCTAGTGAAGCAGACGGTAAAAACT
CCTGAGCTGAATGTTACAATATTTCTTAGAAAAAAGTGCTAATCATTTGCCAACAGTTAG
GAAAGTCTCATCTGATTTAAGTACAAACAATGACTAATATTAAAGGGAGTGACGAAAGGA
GGAAACAATATTTTCAGATTTCCATCATTAAAGATCCTTTTCACATACATAGAAAGAAAA
TTATTTTATTCATGTGTACATATAGTCTGAATATTTTCAGGTTATTTCATTTAGATGCTC
AATTCTGAATTCATTTGAAAGGTCAGCAGTTTTTTCAGACTTTCATCAAATCACCGAAGA
GATCCTGTGTGTTAATTACTGCCAGGCAGTTCATGTATAATGATGAATAGCACAAACTTA
GATCTCTCTTCTAATCTTCTCTATCTCCACCATTCTGAACTCTTGCACTTGGCAGTCGCG
TGGGTACTTAAAACTCAGTGTCTAACGATAAATTTATCATCATCTCTTGCTTTGTTCCAC
ACCATTCTGCCCTTTGTATCATCTTCGCTCTGCACTGGATAGGTAGCTCTTTAGGATTCC
AGCTTTATGTGGGTCTCCTATTAGACTCCTTGGGTGAGGGCTCTAGGCTTTATCCCTGCC
TCCTATGCCCACGCTGCTGTCCAAACAAAGCGTAAGTTCACTGTGGTTTGTCATAAACTT
CAGAAGATGGTTTCAGGGCTCACTTGCTTTCCAGAATTCCTGCTTAAATTTCATTTCTGG
CCTCTGCAGAATCTTTTATTTTCTTACCAGATCAGCAATGCCTTTAAGAAAAGGTTTTAC
TATTTCATCCAGCTTTTTTAGTTTTTTCATTGGGAATATCACTCAGATCTAGTCTGTCAG
AATTGCAAGTCTTGCCTTATCTAAAGAGACCTTTACTCTTCAGCTCCTGCTCATCCCATT
TGGGATTGCTGGCTTGGTGTTGCCAGCTCTCTTGATTTTTCAAAAGAACCTAGGAATCTC
ATTGTTTTTAAAATCTTATTTTTAAATATTGCCAACTAATTTAGTTTATCTCTTTTTTTT
ATTTTCATTTGTGTTTATTCAGTTGTAGTGAGGTTGAAATATTTGTCTTTCTTTCACCTG
GTCATATCCTGTGCCCATGTTTCTATTCATCCTTTCCATACTGATCTGTAAGAGCTCTTT
ATACACCAAGGATGTTAATTCTTTGCCTTTAATATGCATTGTAAATATTTTTCTCAGAAT
GCAGAAAAATGTGTTCTAAAAAATATTAAAATTTATATGGTTATTTTCCTCCTAAATTGG
TCTGTTCCTCCACAAGATAGATGCAAAAAAAAAAAAATTAGGAATGTGTTGTTCATTTGT
GTGAGTTCTTTATATATTATGGAGATTAACCCCTTGTCAGATATATGATTTACAAATATT
TTCTCCCAGTTGTTGAGTTGCCTCTTTGTATTGATCCTAGTTTCTTTTGCATTGCAGAAA
CTCTTTAGTCTGATGAATTCCTACTTGTTTATTTTTTTCTTTTGTTTCCCTTGTCTAAGA
GGACATGGTATTTGAAAAGATCCTTTTTAGTTCGGTGTCAAAGAGTGCACTACCAATATT
ATCTTCCAGGAGTTCTATAGTTTCAGGACGTATCTTCAAGTCTTTGATCCATTTTGAGTT
TATTTTTGTGTATGGTGTGAGACAGTGGTCTACCTTCATTCTTTGGCATGTGGCTGTCCA
GTTTTCCCAGCACCATTTATTGAAGAGACTATCTTTTCTCCCATTGTATGTTCTTGGCAC
CTTTGTCGAAGATTAGCTGTCCGTAGATGTATGGTTTTATTTCTGGGCTCTCAGTTCTGT
CCATTGATCTGTGTGCCTGTTTTTGTACCAGTAGCATGCCATTTTGTTCACTATGGCTTT
GTAGTACATTTTGAAGTCAGGGATCGTGATTCCTCCAGCTTTGTTCTTTTTTCTCAGGAT
TGCCTTAGCAATTTGGGGTCTTTGATTGCCCCATATGAATTTTAGTATTCTTTGCTCTAT
TTCCGTGAAGAATGTCATTGAGATTCTGATAAGGATTGCATTGATTCTGTAGATTGCTTT
GGGTAGTATGGACATTTTAACTGTTTATTCTTCCAATCTGTGAGCAAGGAATCTCCTTCC
ATTGCTTTAAGTCATTATCAGTTTCTCTCAGTAATGTCTTATGGTTTTCTTGGTATAAGT
CCTTCACCTCCTTGGTTAAATTTATTCCTAGGTACTTTATTTTTTTAGTTGTGTTTGCAA
ATGGAATTATATTTTTGAGTTCTCTTTTTGTAAGTTCGTTGTTGGAGTTTAGAAAAGCAA
CTCATTTTTGTAAGTTGATTCTGTACCCTGCGACTTTACTGTAGTTGTTAATTAATTATT
TCTATTAGTTTTCCAATGGGTTTTTTGAGGTTTTCTATCTATAAGATCATGTCATCTGCA
GACAGCGAGAGTTTCACTTCTTCACTCCCTATTTGGATTCCTTTTATTCTTTTCTCTTGC
TTAATTGCTCTGGCCAAAACCTCCAGTATTATGTTGAATAAGAGTGGTGATAGTGGGCAT
CCTTTTCTCGTTCCTGTTCTCAGGGGGATGGTGCTCAGTTTTTGCCCATTGAGTATCATG
TGGCTGTGAGTTTGTCATATATGGCCTTTATTATGTTGAGGTAGTTTCCTTCTATCCCCA
TTTTCTTAAGAGTTTTTATCATAAATGGCTGTTGGATCTTGTCAAATGCTTTCTCTGCAT
CTATTGAGATGATCGTGTGGTTTTTATTCCTCAATTTGTTGATGTGGTGTATCACGTTGA
TTGATTTGCGGATGTTGAACCATCCCTATGTCCCTGGTATGAATCCCACTTGATCATGAT
GTATGATCCTTTTGATGAATTGCTGAATTCAGGTTGCTGAAATTTTGTTGAGAATTTTTG
CATCTATGTTCATCAGTGATATTGGCCTGTGGTTCTCCTTTTTTGTGCTGTCCTTGTCAG
GCTTTGGTATCAGAGTGATGTTGGCCTCATAGATTGTGTTAGGAAGTGTTCCATCCTCCC
TAATTTTTTGGAATAGCTTGAAAAGGATAGATATTAAATCCTCTCTGAAAGTTTGGTAGA
ATTCCCCAGGAAAGCCATCTTGTCCAGGGGTTTTATTCTTTGGGATGCTCTTGATTGCTG
TTTCGATCTCTTTCCTTGTGATTGGTCTATTCAGATTGTCTGTTTCATCTTGACTCAGCT
TTGGGAGGTTGTAAGAATCTAAGAATTTATCCGTTTCCTCTAGGTTATCTATTTTGTTGG
CATATAGTTTTTCATAGTATTCTCTTACAGTCCATTGTATTTCTGTAGAGTCTGTTGTTA
TATCTCCTCTTTCATTTCTGATTTTGTTTATCTGAGCTTTCTGTCTTTTTTTCTTTGTAA
GTCTGGCTAGGGGTTTGTCAATTTTATTTATCTTCTCAAAGAACCAGCTCTTTGTTTCAT
TGATCCTTTCTACTGCCTTTTTTGTTTCAATAGCATTTATTTCTGCTCTGATTTTTATTA
TTTCTGTCCTTCTGCTGACTTTGGGCTTTGTTCTTTTTCTAATTCAGTTAGGTGTAATTT
GAGATTGCTTATTTATTTATTTTAAAAATCGCAAATATTGCCAACTAATTTAGTTTATTT
CTTAAAAATGAGTGACTCACAGACTAATGGTGAGTGAAAGAAGCCAGGCAGAAAAGAATA
CCTGAGTGTAATTCCATATTTATATAAAGTTAAAGGGAAAATATATAATCTTGTCTCAAG
GTTAGAATAGTGATTATCATTAGGGGTGTATTGACTGGGAAAGGATATGAAGGAGCCTTA
TAGGTGCTAGAAATGTTCCACATAATGATCTGGGTGGTATTACATGTATATGTAAAATTT
GTTGAGCTGAAAAGTTAGGTTTTGTGCACTTTATTGTTTGTAAGTTATAATTCAGTTAGA
AAGCTTAAAGAAAATTGTGGGTCAGACAGAACTGCAGTCTTCCAGTTTTCAACCTCTGTA
GATTTCTTAAATTTTATTCCTCATTAAGCCAGGGAACTATATATTTGTGACACAGTTTTG
TCCCCTTAGAGAATTGTTAGTAGTGTACTGAGTTTTGGTGTTATACCATTAGCCCATATG
GAAGGATGTTTAAGGAAACAACTTAAGACTCTTTTTTTAAACTGTAGAGATCTCTTTTTT
TTCTTTTTTTAAAGATTGGCACCTGCGCTAACATCTGTTGTCAATCTTTTTTTTCTTCTT
CTTCTTCTCCCCAAAGCACCTCGGTACATAGTTGTATATTCTAGTTGTGAGTGCCTCTGG
TTGTGCTATATGGGATGCCACCTCAGCATGGCCTGATGAGTGGTGCCATGTCCATGCCAA
GGATCCAAACCAGCGAGACCCTGGGCTGCCGAAGCGGAGCGCACAAACTTGACAACTCAG
CCACGGGGCCAGCCCCTATAGGGATCTCTTTATGATGATACGTGGGAGAAATTTTCCCCA
GATACTACCGGAATAATTTGGGAGCACTTGATTTGCTTTTAAGGTTATAACTAGTAATGT
TTTGCTCTGTAGCCTACTAGTAGAGCCATATTTGGGACCCTTCTCTAGAATAGAGTATCT
TATAGTGCGTATTTTGAATGCTAGTCTTACCCACAAATTAATTAAGAGGTATGCATTCTG
TCATCATTTAGCAAGCAAAATAAACATGCTTCTGATAAGTTTTTAAGCTTGAAATTTGTG
TTGCATGCATATTGTAGGAAAATAGTTGAATTTCGGTGCCTTTATTTATATTTAAGTTGA
AAAAACTATTCCTGATTATAAAATTGTGATTGTGGTCAAATAGCATTATATATACTGTTA
AATTAAAAATATTGAGGAAAATAAAGTGCTTTTGTTTTAACTAGTGGTCATAGTGATAAC
TAACTATAAAGATTGAATAATTTGATATGTAAGAGGTGCTGAATAATTTCTTTCTTTTCT
TTTAGCGCCCTTGTCAATGAAGACTCACCAAGTCCCTTCAAAAATTCTTTTTAAAAAATT
ATTAAATAAGATCCGAAGCCAAAAATCTCTCTGGACGATTAGATCCATGTCTGAGGATGA
AAGTGAAATGATTTCAACTGTTAGTGAAACTGAGAGTAAAGCACCAATGGTTGAATCAGG
AGCAACTGCTGCTGAAGAGGGAGCATTATCCTCGGGGCAGGAGCAAGGTGGTTCTCTCCA
GTAGTCTCCTTTTGTGGTGCATAACCCATTCTAAGTTCAAAAATGTGCTCATTCCTGAAA
AATCAAAGAATAGAGGTCAAAAGGAAGAAGACGTGTTAAAGTCCATAATGCTGCTACTTA
GAGGCAATAAACGTTGAAAAGCTTAGTGAATCTTCTTGCAGAGCACTTTCAATATAGTAG
TAGTATTCATATATATTAATTCCAATGTAATTGTTGAATCAGAATTAACCAGTTCCCCAT
GGTTGAGATATTTAGACTGTTTCTAATTTTTCTTGTGCTACAATGAGCATCCTTTTAGCA
AAATCTTCTCCTACATCTTTAATCATTTCCTTAGGAACACTCTCGAAAGAAGAGTTCCTG
AATCAAAGGATCTGACACATTTTAACAGCTTTTGAGTGTGTTATTTTGTGTTTATTAAGA
GTTTTATCTTCTGGATTTTTTAAAAATGTGATTGGATTTGTGTGGAAATATTTTGCTACC
AGGCTTCTGAAAGAAGTGTCTTTATAGTCTGTATTTGGATTTTGGATTTTATCTTAAGTA
CAACAGGAAGTTGTCTGGAAATAATTTCTTCCCTTGACCTCTTGACCCCATCCTCTTTTG
GTTTTCCTGCCTGGCTGGCTCCTCCTTCGTGGTTTCCTTTGCTGCTTATCCTTGTCTATA
CAACCACTAGTCATTGCCCCCAGAGCTTGTTCCTCAGATCTTTTTTCTTTGTATCAACAC
TCCCTAGTTGATCTCTGATGTTGTGACTTGACTTTACCATTACATACTGAGGATTTCCCA
GTGTGTCTTTCTAGGCTTGGCCTCTCCTTTGAGCACCACTCATTTAAACATCTATTTGAC
ATCTTCCTTGTATATCTAATTACATCTTAAACTTTTCCAAAACTAAACTCTTGATATCCC
CTTGGACCCTACACCGTCTTTTCCTACAATCTTCCACATTTCAGTAAATGGTAGTAAAAT
TCTCTTGGTCAAGCGAAAAAGCTTGTCATTCTGGTTCCCCTGTTTTATATCCTATGTCCA
AACCATCAGCAGATTGTGTTGATCCTACCCTCAAAATATATCCAAAGTTCAACCATTTCC
CACCACCTACTATCCTAGTTTAAGCCATGTTCATTCTCTAGTGTAGATCTTGTAGTAGCC
TCCTAACTGTCTTCAGTTTTTGCACCTCCTTGCTGTAATCTATTCACAGAGTCATCTTGT
TAAAACACACATCAGCTCATGTCATTCCTCTGGGGAAAGCCCTCCAACAACTATCCATTT
CACTCAGTAAAAACCAAAGTGCTTGGAGTGGCATCAAAGCCTTCTATGGTCTGCACACAC
ACCTCTACCCCTCCACTTCTCTCACCCTCACTCTCTTTCTGACTTCATTTTCTACCACAG
CTCCCTTCCGAGCCACTGCACCCTAGGCACTGGCTTCCTTCCTTGCTATTCCTCAAACAC
AGCAAATGTAACTCACATGGTCTTTGCAATTGCTGGTCTTTTTTGGCCGAAATGCTCTTG
GATATTTCTCTGGCTCACTCTCACGTCCTTTAAACACTTGCGGGATACCACTTTCTCAGT
AAGACCTTCTCTGGCCACTCTACAACGTCAAGCTGCTTTCCCTCTCCCCACTCCATCCCC
TTCACTCCCTATCCCCTTTACCCTGCTTTTTCTCCGTAGCTCTTATCAACATCCGAGACC
CTAAATTTACTTTGTTGCTTATTTGCTTCTTGTCTTGACACCTACCCCACTCTACCCTGC
CTACCCTCCAATCCTGGAATATAACCTCATGAGGGTAGGAACTTGGTTTTGTTCCTTGCT
TATACCAAGAGCCTAGACTAGTGCCTTGTACATGAAAGGTGCTCAGTTAATATTTGGTGA
ATTAATTGATTAGCTTAGAGCAAGAGAGGTAAGTTTGGAAGTCAGACATATATATGATGT
TTAAAGCCATGGGCATGGAACACTCTTAGGGGAAAGAATTCAGTGAGGAGAGGGCTTAAG
AGACCCTCTGAGGCCCAGCGTTTATAAGATGGCGGGAGAAGGAGCAAACAGTAAAGGCAG
CAAAAAGGAGCGGCCAGAGAAGTAGGAGAGAATGTGGTGTTGGAATTCAATAAAAGGGGG
TTCTTTCATCTTCAATCCATAACCAAGTTATTTTTCAAAAGCCCTGTATGAATGAGTCGG
CTTTCCCTAGCCTCATCCTCTCCTTTGTCTGACATACCCCGTATACGTTGATCCTCTTTC
AGTTCTTGAATGAGCCAAGTTTTTTTTATCCTCGCTGGACTTAATACCTGCTGATCTGTC
TGGAAGGTCTCCTGTGCATCCTCACATTCTTTACTTGGCTGATTCCTCCTTATCCTTAGG
TGTCTGCTTAAATATCATTGCCTAAGAGACACCTCATCTGAGCCCCTTGTCTAATTCAGG
TTTCCCTGGAATATACTCCTGTATAACCCCTTATTTCTCTTTTATAGTACTTACTACAAT
TTCTCATTCTGTAATTTTTTTCTAGGATAATTATATAATGTTTCTGTCCCCATTCCCCCT
GTGAAACCTCCTGGAGGCCTTTTCTTATTTACCTCGGTGTCCCCAGCATGCAGCACATTA
TGTAGGTGCTGAATGAAAGAATGAATGAATGCATGCTTGATGCAGAGTTTCTGGCTACCC
TGATATGATTGCTTTAACTTCCTTCTCTGGTTTCATAAATAAAAAAAATCCTAATATCTA
AATATGTCAGAGATACATTTAAATTTCTTTAGCTTCTCTTTTTAAACTTTAGTGCCTTGC
TTATTCTATTCCTTCTATGCTTTTCCAGTGTGTTTAAGCTCTTGTGGGCATACCTTTTTA
ATCAATTGTCCTTCGTTTTTTTCCTTCTTGTTCACAATTTTAGTCTTGTCTTATATTAGG
CTTGGGTTTAATGGATAAAATATATGGACATCTGGAAGGTGACTGGATCCTGACTAAATA
AGACATTCAGGTGGACCAAGATTGACTTGTTAATCTGAATGCAGATTTTCGTTATTTTGT
TTAGATTTAACATTGATAATATGTTCATAATGTATCTATTACAGTTGTTGAAAGTGATTC
GCTAACAGTTGACTCTGGACCACTTACTAGTGAAGATAAACCACTTTCCTGCCATATAGA
CTCTGAGAAGGAACAAGGTATTTCTTTTTATCGCACCCTCAAATTAAACTTGCCTGGCTC
TTCATATCTTTTTCCTAATAAAATTGCGTGTAATAAATGAATAAAGGGCATTGTAGTGGT
GTCAAAATTCTAAATTGTTGAAATTAATTTTTGTTTTATCATTTCTCTTAGAAATAAATG
AGGCTCAGCCTGTCACAACTGTAGCTCAGAGTTCAGTTCTGCTTCATCCTCAAGAAGCGG
CAGCCAGAATTAGAATGGCAGCAAGGCAGAAACAGGTAATTTGAAATTTTTCTTTTTAAA
GGTTCTTTTCTACCCCTAGGTACTGTACTTTTGTGTTACCGGTGAGCTTTGTCTTAATGT
CTGGCTGCTTCTGATACTATTTCTTCTACCTTGTCTTTCACATTCATCTGACAGAACGCA
CTTCATCTTCACTTGTAGTACTCGTTTGACCCTTACTGCATTCTGCTTTGTGATTTATAC
TTTTGTATGTATCTTATCTTCCCTATAAAATTTGTTGATATTTTTAAGGCAGAGAGTATC
TTTTTTAAAATTCAGTTTATCCTGCATAGTTTCTGGTACAATGCCTTCTACATAATAAAT
GTGCAGTAAATATTTGTTGAATATCTATGTCCAGTGTGGTGGCTGCTAGTTGTATGGGCT
GTTGAATACTTAATATATGGCTAATGCAACTGAGGAAGTGAATTTTACATTTTATTTAAT
ATGAATTAATTTAAGTTTAATACTTGCATATAGCTACTGCCTACTGTATTGATAGTGTAA
TTCTAGAGGTACTACAGAACTGTAAATGGTCTAAATTCAGTGGCTTCTATGAGTGAGGGA
AAGTAAGGAATATGAAGACAGGAACTCAGTTAGAGCCACTAGTGCCTGATTAGAAATATG
TAAAGTATCAAACTGAGACATTTTTTATTTTGAAAACAAGATTATTCTTCATTATCTCTA
GTAGATGTATTCCTCTTAATAAAACTTCACATACGTTCCTTTTTTTCTACATGTTCAGTG
AGTATTTATGTATTGTGTATGTATCAGAGACTGCACTAGGTGCTGCATTTAGTAGGCAAC
CAGACACTCGTCCCTCAAGAAACTTACAGTTACTCTAACCTGACTTTTTATTACTCAGAT
CCGTGTGTATGTGTTGGTATAATATTAGAGTTTATGTGTCATCCCTCTGCCGTTGTCTTC
CTATCTGCTTCATGCCTGGCAGCAAAGATATAGACTGTTGCTCATTGTATTATTTGGCTT
TTAGATAACTGTACCCCTTTATGAGTATGCCTAAGAAATCAAAGTGTTTGGGGAGGTCTC
GATGTTTAATTTCTTTAGTCATTCTTACTGAGAACAATGTAAAATAAAAATATGAACACA
GAATCTGGCTGAACATCGTTTGCTACTTCTCTGGGGGTGAGTCTTCAGTGGTGATCAAGG
TTTCCTTGTGCTCCCAAGAAATGGAAATAGCGCGTTTATTTTTTCCTCAATTTCTGCCTC
TCTTTACTTCTCTCCCTCTTTCTCCTTTTCTCTTTTCCCATCTCTCACTCCCTTCCTTCC
TCTGGCAATGGCAACAACAGAAATAAAAATCACCACTTTCTTCTCGGAAAATTGGTGCTT
TTGGTGATAAGACCTATTTCTTTTCAATGTTATACATATAAAATTTTCTTTTGTATGAGT
TTGTTGTTAATAGATCAATAGTATTTTTATTACTTAGATAATGGAAATAGAAGAGCAGAA
GCAAAAGCAGTTGGAATTACTTGAACAAATTGAACAACAGAAGTTAAGATTAGAAACTGA
TTGCTTCACGGCTCAGCTGGAAGAAGAAAAAAGAAAAACAGCTCAACAGACTGGGGTAGG
ATGTAGGAAATCTCATCCCTACGTAGATCGCTGGGGGATAAGAAAATATGAGCACTCTAA
GCATTCAGAAAAGTAAAAGCATTTCTAATTCTTATTTGGTAAATTTTGTACCAAGTTTGG
TAATTATATATATAAGGCAATGTAGATAATGGCTTTCTTCTTTCAGTTTATAGAGGGTGC
CAGTATAAGTGACCATAATTTGTATGTAATGGGCATGTTGAGCTCTTAGACTTGGCACTA
AAAGAGAATGGTGGATTCATTTCTTAATAATGGAAGTGCCAGTCTTTTTTTATAAAAAAA
GAAAGCTATATGGAAGTTTACAGTTATAGAACTTGAGTTTATATAAAATGATTTAGTACT
TGCTCCTGGATTTGCCTTTTAATTAGTAGCTTTGTCTTTTATTAGGTTGGCACTGCTCCA
GCATCATGCACCATAGGTTCTGATGAAGATAGTCATAGGCAGATGATTCGAAACTATCAA
CATCAGCTTTTACAGCAAAACAGGTATTAGCTAGGATACAATCTATATGTGATAGTATGT
GGCTACATCTTTAGGCTTTATTTGTTTTGTATGAAGATCTAATCAGGATTCCCTCAGAAC
TAGGCATATGGATTTCTCAAAGAGCATTGTGAATGTTATTCCTTTTCCACCATGATTGTG
GCCAACCCTAGATTGTTGTTAAATTTAATGTATAGAAACTTGAGAATATGGGACTTTTTT
AATCCAAAAAGAATAATGTATATTTGTTTTTGTGTTTCTTATTGGTAGGTTTCACAGACA
ATCTGTTGAAATAGCCAGGAAACGATTACTTGAATATCAGACCATGTTAAAAGGAAAGTA
CTCATCCATGTTAGCTACATCATTGATATCTGATTCTGTTACATCAGTACCATCGCAGAA
ATCTGAAAGACCCACTGTTACATCAGAGCATTGGGATCAAGGTCAGAGACCCAAGTTGAG
TCCTAACAAATATCAACCTATGCAACCCATACCAATCCCCAAATTAGAACAAGATTATTT
TCAGGTTCCAAGACAAAATCACTTTCCACAAAGACATGTAGAAACAACAGAAATGTTACT
CACTTCAGATGTTTTAGCCAAGCAATCTTTGGACTCACAAGAACAGCCAAAGCAATTCTC
ACAGACTGAAACACAACAGAGAGACTATAAATTGGTCCCTAAAGATTCCTCTACATTTTC
AAGGGCTTTGTCATTTGATAGGCCGCTAATAGTACATGATGCTAGACAAGTAGCTGAAAC
ATCGAGGGCAACCACTTTTCAAACTCCAGACTCCCAGCAAATGTTCCCAGAGAACAATGA
AAGTATATCTTCTAAGTTAACTGAACCTTCTTCATTCCTACCACTGGTGGCTGAGCGTTC
TTTTAGTTCTCTGCCTGCTAAAGTTGAATCTGGAAAAATCCAGGAACCCTTTTCAACCAT
GAGCAAAAGTACAGTTTCTGTAAGCCATTCTGTAATCAGCCAAATGCAGGATAAGTCTTT
GCCATCCTCAGAGAATATCACAGCCCAGCAAGATAATTTGAAGGCTCTCCAAGAGCAGTT
AGACCTACAGAAGGAAGTTCTTCGGTCAAGACAGAAAGCTCAGGAACAATTGCTTTTGTG
CAAACAGAAAGAATTGGAAGGACAAACTGGTGTGTCTGTATTCCTTCCATTGGTATCTCT
GGGTTCATTTGCTTCATTGCCTTCTGCTAAAGCTGAATCAGGGAGAATCCAGGAATCTCC
AACCACAAATGATACTGTAGTTTCCTCGGGCCATCCTGGGGTCCCACAGCTTCAGGATAG
GCTTTTGAGTTTTTCACAGCCTGTCTTACCACAGCAAGATAATTTTCAATTTCTCCAAGA
ACAATTAAGTATTCAGAGGGACAGCCTTCAGCCTAGACGGGAAGCCCAGGAAGTATTACG
TGTACATAAACAGAGTGAATTGGATGGAAGAGTATCGTCTGAACAGACTGAGACCCCTTC
TCTCCCATCTCAGGTAGCTCATAATACATTTACTTCACTACCTTCTGCCAGTACTCAATC
TGGAAAACTCCAGGAGCAATATTCATCTAAGAGTGAGACGGGCCAATCTGAAATCCCAAA
ATTTCAGGATGGATCTTTGAGTTTCCTACAGCAGTTCCTACCTTTGCATAATAGTTTGAA
GTTGCTCCAAGAACAGCTCACTACACACAGGGATGCTCTTCAGGCTAGGCATGAAGCCCA
GGCAGAATTACTTTTACGTAGACAAAGGGATCTGGGGCATAATAAGTCTGGGCAGATGAG
TTCTTCATTCCCACCAACGGTTGCTCAACGTTCAGTGGTTTCGCATGCTTCTGCTAAAAC
TGCGCCTAGAATTCAGAACCTTTATTTATCTGAGAAGGAGAGTATTATTCCCTCAAGTCG
TTTGGTAATCCCAACGTTGCAGGATGAGTCTCTTAGTTTTCCACAGCATAGCCTGCCACA
GCAAGAAGATTTGACAACGCTCCAAGAACAGTCATACATGCAGAAGGTAATACTTGGTGC
TAAACAAGAAACTCAGGAATTTGTACGCGAACAAAGTGGATTAGAAAAAAGAACTTCTTC
TGAACAGACTGGCACCTCTTCATCCCTATCCCGAGTAGCTGAATCCGATAGATTCCAGGA
ATTTATGTCAATCAAGAGTGATAGTACACTTCCCTTAAGCCATTCTAAGATCCCAAGATT
TCAGGAAAGACTTGCGAGATTTTCACAACATATACTACCTCTACAAGGTAATTTGGAGGA
ACACCAAGAATGGCTAGACACAGAGAAGGAGGCCCTTCATTTTAGCCAGAAAACCCAAGG
GAATACATCTTCTAAACAGACTGGCTTCTCCTCATTCATACCCCAGTTAGGACAGCTTTC
ATTTACTTCAATACTTTCTGCTGAATCTGGTACAACCCAGGAACCTCTTTCCACAGGGAG
TGATAGTCAAATTCCTTCAAGCCGTTTGCAGATTCCACAACTGCAGGATAGGCTTTTGAG
GATATCACAACTTATCCAGCCTCAACAAGATAATTTGAGGTCACTTCAAGAACAGTTAGC
TACACAGAGGGAAGCCATTGTTCAGTCTAGACAGAAACTTCAGGAAGAATTACTTTTACC
TAAACAGAGTGAGTGCAAGGAAAGAACTTCTCCTGAGCAGACTGGCACCTCTTCCTTATT
ACCCCTAGTCACACAACATTCATTTGCTTCATTACCTCTTACTGAATCTGATAGAATTCA
AGAACCTTGTCCAACTGAGAGTGATAATATAGCCTCCTCAAGTCATTCTGAGATACCAAT
ATTGCCTGATAGGCTTTTGAATTTATCACAGCCTGTTTTACCTCAACAAGATTATCTTAT
TGCACTTAAAGAACACTTGTCTGCACAGACAAATTCCCTTCCATTTACTGAGAAAACCCA
GAAAGAAGTGGTTTTGCCCCAACAATATAAATTTGAGGAAAAGTTTTCTGAGCATTTTAG
CCAACCTCACCATGGTGATTTAAAGACACTTCAACAGCAGTTAGATGTACAAAGGAAAGC
CATTCGGTCTAGCCAGGAAGTCCAAGAAGAATTGCTTTTGCAAAGGCTAAGTAAATTGGA
GCAAAGGGCGTCATCTGAGCAGCCTAGCTCCTCTTTATCCGTATCTCAGGTAGCACTGCC
TGTTGCTGACTCTGAGAGAATCCAAAAGTCTTTTCCAACCAGAAGCAATAATGCTGTTCC
CTCAAGTCATCCTGAGATCCCAGGATCACAAGACAGGCTTTTGAGTTTGTCCCAGCCCAT
TCTGCCTCAGCAAGATCACTTGACAGCACAGTTGGACTTACAAAGGGACGTGGTACATTC
TAACGAGAAAGCCCAGGAAGAACTGCTTTTGAACAAACAAACTAAGTTGATGGAGAGTGA
ATCTACTGAACATGCTATGCCCTCTTTGGTTCTGCCCGAGGAAGGCGAGCATTCATTTAT
TCCACTACCTTTTGGCGAAGTTAAGTCTGAAAACATTTGTGAATTGTATCCATCCAAGAA
TGAACATGCAGTTCCTTCAGGCGACTCTATGATCCCAAGATTTCAAGATAGACTTTTGAG
TTTTTCACGACCTGTCTTAGCTCAGCAAGATAACTTGGGACTTCAGAATCAGCTGAATTT
ACAAAAAGAAGCGCTGCACTATAGCCAAAAAGCCCAAGAAGTATTGCTTGTACAGAGACA
AACAGCACTGCAGCAGCAGATACAGAAACAGAGAGAGACTTTGAAGGATTTCTTTAAAGA
CAGTCAGGTACGTATTAAACTTGAATATCTAAGAAACAATGCAGGTAACCCAACTCAGAC
AAACTAAATATTTGTTTTAATCTTAGGCCTAAATAAGTCCTTAGTTATTGAGAATAGGTG
GTTTGTCCTTTTTTGTGCCTTAATTTTCTACCTTCAACAATACGGAAATTAAAACATAAA
AATTGTTCTATCTTGCATGGTGTTTATAAGGTTAACAGTTATTTGAATCCAAACTAATTT
CAGCCAGTAGTTTGATAGAACCAAGTGCAAACACCATTAAAACTGTAGATTGTCATTTGA
AGTTTTGTTATAAAGGGTTTTGAGCTTTTTAGCAGAATTTCTCTTTAACGCCAGACCTTG
TGCTTTCTGTATAGCACTTTGTTGACGTTTGTATATGAATCAAAATCAGTACCATCTTTT
TCCTTAAGTGACAATATTAACACCTCTTGTAAAACTGGCGTTATTTTAGGCTGGTGGACA
GCTAGACCTGCTGCTTGTTACTGAACTGTTGAGAAGACTCTGGCATGCTCATTCAGATAT
TCATGGTTTCTTTATATGTGAAACAAGAGTATGTTCTCAGTATGAATGTGTCTGTTTTAT
CTTAGAAGGCCACTTCCTAAATTTGTGATTTAGCCTAAAGAGGATTCTACAGATCCTTTG
ATGTTCAGGAGAAACTTGAGTTGAGTTTATGAGAACTTGAATTCTAGGGATTTACTGGTC
ATTTGAAGGGAAAGTAATAGGAAAAGAAAAGCAGAGGGGGATACTAAAGTATAATCTCTT
ATTGAAAGGTACAATGGAGGCTGAGTATTTAGGTTGAAGGTTGTGAATGGTTGTACTTAT
CAATGGAAATATCACTCTTTCGGTATTAGAAGCATTTCTCATTTTTCTGTTGTGCCATTG
AGTCAATTCCAACTTGTAGCAATTCTGCACAGCAAAGTGGAACCCTTCTCGGTCTTTTTG
CGCCATCCTCTCATCTTTCGGCACTACATCAGACAATGCTCTGCTGCTATTCATAGGGTT
TTCGTGGCCAATTTTTTCAGAAGTGGGTGGCCAGGTCCTTCTTCCCAGTCTCTCTTAGTC
TGGAAGCTCCACTGAAACCTGTCCACTATTGGTGACCCTGCTGGTATTTGAAATACCGGT
GGCATAGCTTTCAGCATCACAGCAACGTGCAGCCACCACCGTATGACAACCTAGAGACCC
ATAGAGTAGTTCCCTGACCGGGGAACGAACCTGGGCCATGGCGTTGTGAGTGCCGAATTG
TAACCACTAGACCATTAGGGCTGGCTCTTCTCATTTTTTATCTATGAATGAAGTTGTAAT
AGTGTGATTAATGGAATTATTTATTTGGTTGAGGTTCTTATTTAAAAGGGAGATAAAAAT
CTAATAAATGCTTCATATGATCCCTGATCTTATGTCATCCCCACCCTCCTCTGTCCACTG
TTTTTTCAGACAAGTAAGCCTGCAGTTGAAAATGATTTTAAAACCCAGAAGCTCAGAGAG
TGGCTTCCTCATCTCCACGACCTAGTAAGAGGTGATCAGGAAAACATCAGTCCTACAGAT
AAGAGCAACTCTGATGATAAGCAGCTGCTTTCAGAAGATAGTAGTACCAAGCAAAGTGGT
AGGATAATTGTATTTTATTGTAATATTCTGCTCATTATTCTTTGTTTTCACTTCTTGCAA
CTTGCTGGTTGAAGAAAAGTTTGTAGTATGTTAATAGATTTGTATTGTGCCTAACTTTGT
CATTGACCTGATAGGTGAGCATCTGGACAAGGAACTGGGTAGGAGAGCCTCAAAGCCACC
TGTAGCAAAAGTTAAATGTGGACTGGACTTGAACCAGCATGAACTAAGTGCTATACAAGA
GGTAGAATCACCAGCAAGTGCAAGAACTTCTATACTAGGTAAACAGATGGTTTGATAAAA
TAGGGTTTTTTAATACTTGGCCAGTTTTCTACATTTTTTTCAGGATGCTAGATGTTTTTG
TTGAAGAAACTTAGGCTGTGTGTACTCATGAAAGGAAAAAAACTGTTTACATAAACAGTA
TTTAAAATTTGGACTTAAAGAGATGTGACATTAGGTAACTAATTTCTCCTTGTATATAGA
GGGAAACCAATTTATTGTAGACAAAAGTCTTCAGTATTCCATATTCTGACACTCTTGCTT
CCCTCTGCTTCCTGTCATGCCTGCCTTCTAAACCTATGTCTTTAGGATATAACTCAGTTT
TTTCTCTTTTCTTTTGCTGTTTTTCTACTTTAGTACCTTCACTGCTCTTTTCCTGTATCT
TTTATGGGATAATTATTATGTTTAAAATCTTGGCTTTAAGGACAATTAGATATATTTCTT
TACTATACTTCTTCCTAGATCAAATTATCTAGAAAAATTTCTCCCTGTGATCCTTAGTAA
ATAAATAGCTTTACTTGAATTTCATAATTATTTTTAGATTCCAGACACCAAATAATTTTC
TTGATCAAATTTATCAAAGCAAAATCCTTTTCTAAGGTGGAAGATTAGCTTTGTCAATAT
AAAGGTATGTATAAGTGTAATATTAATATTAGCTATTTTGATCTTCAGCCATAAAATATT
GTACCTTTGTTTCTGGTTCAAAGAATTAAGGAAGGTAGAGATTCAGAGTAACTCTTATGA
ATCACTCCCCTTTCTACTTTCTTCTTATGTCTGTGGAACTTATAACATAGAGTAATGATT
TTATTTATTAGTAGGCTTTGGACGCTTTTCTCCTATTTTGCCAGATTTGGCAAACCACAG
CTATTCGGGAATCGATTGGTGCTTTCCCTGATTCAGAGTGATCAGTGGGAAATTCTCACC
ATTGATTCTTATGACTTAATGAGTCCTGTTTGAGATTGCAAAATGTTGTCTTGTCTAGAA
GGGAAAGTTATATATTCCCTCACCTCCACCTCTCTATGCCTTTAGCCTTCTTTCTTCAGT
GAATAGTACCCATACGGAAGTCTTGACACTTCCTTGTCTCTGCCTCTCTGACTCCCAATA
AATCAATCACCAGTTCTCAGTGCTTCTTGGACAGCTCTGGAATCTGACCACTCATTTAAT
TCAGGCTGTCATTTCTTTCTTGAATGGCTGCTACAACTCCCAGTGTCTCCTATTTTCACT
CTAGCGTTACTCTGATTCATTCCCCGTGGTATATTCAGAGTCCTCACCCTCTTTCTCCCT
GTTTAAACTCTTGAGTGGTTTCCGTCTGATTCGAGGAGCAAGCCTACACTAAGTCTAGGT
CCCTGGCTTCACCTACCAGGCCTTTCATTGTCTTGCTCCTCCCTTTGGGGTTGGCTTAGT
GCCTCTTTTCTGATAAACTTTTTCTAAACTACCAAGTATCCCTCTCGTGTGCTTTTTGGG
AGCTTTCATCCTAGCTTTTATCACCCTTCTTTGGGTAATACTTTTAATCCAAATATTACA
GGCAAATAGTTTAAAAAGGCAAATAGTGCTAAAGGGTTATAACATGAAACGGCATTTCTT
CCTGCCCCTACCCATTCCTTACCCCTTAATCCCACTCACCAGAGGCTTTTCAAGTCTTTT
TTCAAGTCTTTTAGGTATTTCTTCTTGTATTTACATCTACACTTGGCAATGGGTTTTAGC
AAAAATTAAGCTAAATTATCATGCTGATGTATAAATATTTTTCAATGCTGAGACAATTAG
TATACTATGATTATGTTTCCTTTTTGTAAAACTTTTCCTGTAGTAAATTGTCTCCTTTTT
AGAGTTTGCTTGAGTTTCTGTTGAATGTCTGTCTTCCTACACTAACACTTCTATTAAATA
CCTCTAATATAATTTGAGACCACGCCATTTTCTCTGTTTGTGGAACAGCTTTTAGTTGGA
GGTTGGATGACCTATCTGATGCATTCTCTTTTTTTTTCCTCCCCACATCCCCACAGTACA
TAGTTGTGTATTTTAGTTGTGGGTCCTTCTAGTTGTGGCAAGTGGGATGCTGCCTCAACA
TGGCCCTGTGAGCGGTGCCACGTCCTCACCCAGGATCCGAACGGGCAAAACCCTGGGCTG
CCAAAGTGGAGCATGCAAACCCAACCTCTCGGCCACTGGGCCGGCCCCATATCTGATGTA
TTCTTATCAAAGGTATCATTGTTCCCACAGGGAACGAAAACTGGTTCTTGGGGACGTGAA
ACAGTCTTACTCGTTTTATGTACCAAAGCACAAATGTACATAAAAAGATATGCAGTGGGG
CCAGTCCCGTGGCCGAGCAGTTAAGTTTGTGTGCTCTACTGTGGCAGCCCAGGGTTTCGC
TGGTTCAGATCCTGGGCGTGGACATGACACCACTCATCAAGCCACACTGAGGCAACGTCC
CACATGCCACAACTAGAAGGACCCACAACTAAAAAATAGACACCTGTGTACCAGGGGGCT
TTGCGGAGAAAAAGGAAAAATAAAATCAAAAAAAAGATAAGCAGTTATTAAAATTTCATG
GAGATTGTAGGCAATTAGGAAAAAAAAGGTCTATAAATAGGCTCCTTAGGGGGGAAATGA
TAAAAGTAATGTTGAGAAACACTGATCTGTATTGCTCTTCCAATTTTTTTTTCTTCTCAA
TAGTTCATTTTGTTTTCTTTTGGTTTTACTTTCTAGGAGAATCTCCTCAACTTTTCTTCT
AATTTTTCTTGTGAATTTGTATTTTGACTGTCAAATTGTAGTTCCTAAAATCTTGCTCTT
TTTACTGATTTTTTTTTTCCTTTTTCATGGCATCCTGCTATTGTTTCATGGATGCAAAAT
ATTACCTACTTTGAATATTCATAGTTTTCTGTTTGTTTGGGTTCCTGTATTTTCTGTTTG
AGTTCTTTTGTTCCTTTTTGTTGTTCTTTCTGTCTGATACTTTAGAGGCTTTTCTCCAAT
ATCTTGCATATTTGAGTAGAATGCTAACCAGCTAATTGGAAATTCTCTGGGTAGGGGCCA
TATTTATTGCTGAACTTCCTTAGGAAAGGTGGCTTTTCACTGGGGACCCTCAACTTAGTA
TCTGTAGTTCTTTTACTTTTGCAGTTTAGTTTCTTCAAAGAAAGATCCTCCAAGCCTGGT
ACAAGTCCGGCTGTCGCTGTTGTGGAGCCAGACCTGGGGCATCTGGATTAAGGATGCAGA
CTTTCTTTTAACACCCCTGATTTCCATATGGCACTCTCTCTTCCTTTCACCCTTGCCCCT
CTCAGTGCCTGATCTCCCTGAATTCAGAGGGTTTCGGGTTCAATTTCTCAGAGAAAAACC
TTCAGTCTCCTCTGGGGATGATGTTGAGGGACAGGGATGTCAGGAGATGGGAGGAATCTG
TTCCAAGTACATATTTTTAAGCATTATCCCTGTTTTTAATTCCCTGACATACACCTTCCT
TTTGTAATACTTGGTGCCTTTAATTCCCAAGTTTTTCTGGAGTTCTGCACAGTAAATTAG
CTTCTATTACTGGGTATCTCCCACTCCTTTGTTTGCCTGTTTGTTTTTATTTTTGTATCA
AAGTATAACATTCAGAGAAGTGCACAAATCAGAAGTGTTTATTTCAGTGATTATCACTGT
AATAACCAGACCCTGTAAACACTACCTGGTCAAGAACTACAGCGTTAGAAAACTCCATAA
ACACTTCCCTCATACCCTCCCAGTTGCTGCCCCCTCAGTTCTCCCCAGGGTAAACCCCCG
TCTTGATTTCTTATACCATAGACTAGCTGGGGCTATTTTTGAACTTTACGTTATGAATGC
ATATTATTCCTTATAATACTATTAATGGCTATAAATTCTCCAGGCATTTTCCTGGGATTA
GTCAGTACTGAAGCATTATCTGGTATTAGGAAGTAGGAGTATCATTATAAACTTAGTAAA
ATAATTTAAAGGCCTGTATGAAAGATAAGCAGTTATTATTTTCTTGCTACACAGACCAAG
TCTTTGAGAGTTTAGAATTTTACCTATAATCTAAATTGTCCTGTTAGTTTTAGCTAACTT
TAGAGACCTAAGCAGAAATCTAATGAGTCAACTTTTTTTCCTCCCAGGTAAACCAGAATT
TTATCAAGACAGAGACCCCTTGAGGGTCTCCATTAGCCAGGAACAGAGTTTCCTTGGGAG
CCCACTGGACAGTGATTCATTTGGTGATCTTCATCCAGTTGCCCAGGAGAACATGTCTGG
TGATGACTCGGATGAAGCAGGTGAGAGAGAAAGAAATTGAAGGTGGAATTGCTGTGCACA
AGGATATGTCGACAAAAGATATTTATTATAGTTTCATTTGTAATGAAATATGGTAAATAA
CTTCAATGACTGTTGGTAGTGGAATCATTATGGTGCACCCACACTATGCAGTTCAGTGTG
GTTGTTAAATGATGGGGGAAAATCTGTGTCCATACCCTGAAAATTGTCTGGAATGAGAAT
CACCAAAGTGTTGGTCCAGGTTTACCTTTATTGGAGGCTGGGTTTCACTTTCTCTTTTAT
AAGTTCACATACTGTAGTTGTGGGGGTTTTTTTTACAAGAAGCATGTATTATTTCTGTAC
ATAAAAAGTTAAATGAGGGAAGTGAAGTTTATTTAAAGAAGAATTAATTTCACTTTTAAA
TTGTTTTACTAAATAAATGCTAATAGGAAGAGTATGAAGGTATGAGGTTTTTACATTTGG
CAACCTCTATGAATTTTGTGTTTAAGCCGATTCATAACAATTCACATTTAATTAAATACT
ATTAAATATTATCTTTAAAAAATTCTGTCTCTAGCATTCTAAATGAGCTGCTTTATGTTT
GCTTTTAAATATTTGGAAAATAGAGAATTACAAGGAATAAACCTTAAATCACTTAATTCT
GCTACCCAAACACAACCAATGTTAATTTTCTCACTTTTGAATTTATGCAGGTCTCTAACA
AGCTGCTTTATATGTGTAATATTGCTTACTGACCCTACAAAGCGTAGTCCTAGTACTGCT
TCATTGGTTCTAAAGCACCTTTTAAGTAGTTACCTTTTCTAACCAGAGCTCTTTTTATTC
TTGCTGTCACACATGCTTGGATAATTATCTTACTTGTGTCTATAGTTTAGTAGAATGAGA
GATGACCGAGACTTATTCTGTTTTTGAGAGTTTATGGAAAAATTGACTTCAGCATCTCCT
TTGTAAATTGGAGATTGAAATAACTGCAAAGGATCTAACTTCCAGTGAATTATAGTTTTG
ACCTTTTAAAATAAAACTGTTATCACTCTTTTAGATTTAGCCAGTGGATACTTATATTTC
CTTTTTATTCTACCTGTGGATGTCCTATAGCCAAAGACTACCAGGAACACACCTGTGGGT
GGACAAAGCTGGGTGTTTTGACTTGTTGCAGTGAAGGGGAATGCACACCTCAGGGAACCG
TGAGGAGTCTCAGTAGGAGGATATTAGAGAGGACTTACTATAAGATTTGGGTTTGTATTG
GGTGACTTGGGGAGGGTTCAAGGGAATGGGGTTTTGCTTATTAGCGCTGGACATTATCAG
GAAGCAGGGATAATTCTGTTATTGGGCATCTAAAAAATTCTTACCTAGAAGGTAGGAATA
ATGGAGTGAGGCGAATTAAGGCTCTAATGTTAAAGCAGCAGCAGTCACTCATATTAGCCG
GGATAGGGAGACGCTTGGTCATTTGTGTGGTTTGGACAAGATTCATGGTTTTGTCTATGT
TCAGAGATAAGTATGGGTGGTCTGATTTTTGTCTTGATCCATCGCAGTCACAGAGTGGCC
TTTTCTGATATTGATGTTCTGTGAAACTGATAATGTTTAGAACACCAAGGCCTAGCTGAC
AGTGCCAGGTCAGCTCCTGGCTCTCGGGCTGCTTTTCTGTTTCTCATAATCATCCCAGGT
TCATATTGTTTCTCTCTTGGAAGCAAGAGCCTTAGTTTTGTTACTTCTCTATTCCCTCCC
TACCACTTTATTCAGGTCCTCTTCACCTCACCTTGATTTCTTAATAGCTTTTTAGCTGGT
ATCACTAATTTCAAGCTCTGTACCCTTTGCTTTTGTAGGAAGGCAGGAAATGGCGCCTTC
CCACATAGCATGGGAAGATTACTCTGTTTAAGGCATTGCTTTCATGCTGTTACTTCCCCT
TTTTAGGAACCTCCTTAGTGGGTCCCTGTTATCAGTGAAACATTTCCAAATTAATAACAC
TTAACATCTTTTCCAACACTTTCAGAGACCTATTCATTGAATTCAACATCTTAAATAACT
GACCTTTCTCCTTTCTCTATTCTTTTTTTTTTGTGAGGAAGATTGGACCTGAGCTAACAT
CTGTTGCCAATCCTCCTCTTTTTGCTTGAGGAAGATTGTTGCTAACATCTGTGCCCATCT
TCCTCCAGTTTGTATGCAGGACACTGCCACAGCATAGCTTGATGAACAGTGTGTAGGTCT
GTGCCCAGGATCCAAACCTGTAACCTTGGGCCACCGAAGTGAAGTGCACGAACTTAACCA
CTATGCCACTGGGCTGGCCCCTCCTCTCTCTTTTTTATTTTTCGCTTCTTATTACTACCC
AATTGCTACCCTGTTCGTTCATCTCTCCTCTGAGGGAATCTTCTTGTTATGTGGCAGATA
ACAATATAGAATTGTGATTATAAATGGAAAAACCTGATTAACTTCTCATCTCCCAACTAG
CTTTTGAAATGAGCTCCTAAGAAACAAATAACTCACTATATAATTTCACTGTCTTTTTCT
CTTTTACTTAAAATTTTAGTGTGGATAGAAGCAACCAAATAACAGTTAATGATTACATTA
ATTATGTCACAATAAAATGTTTTTAAATGAACTAGAATAGGAGAGAGTAAAAAACTGTAT
TTTAAAACAAATTGTATTTAAATATAATATTTAGTATTAACTTTGTTTCTACTTCATTAT
CCATAATATAGATATTGTTTTACAAATAAATACATATATACACATACAGATACAGATAGG
GGTGTGTGTCATGTGTGTGCCCTGGGTTACCTTTTAGGAAACATTTCTTACACAAACATT
TAAGAAACATACTTTTAATGTGCATGATATCTTTTATTAATATAGTGATAATGAGAGAGA
AATTTTTAGTTTATATTTGGTGGAGGAATTTTAATTTTATTCTGTTTCAGAGCCACAGAC
AACCATATGCTTTGGCCAGCTTTCTCACAAATGTTGGCTCTTGGGAGTAAGAGAAAAATT
AATTCAGAATACCTGAATTATTAATAATGAGACAGAAAGGGTAATGTTTATATAGTTTTA
ATGTCAAATTAATTAGGAATGATAATTCATAATCAAAGCAGTATATGCTCATTGTGATTT
TATAGAGAAGTAAAATTTCTCCTTGTCCTGTCATTCATAAGGAACTGCTGATTACACTTT
GATGTTTTTCTTTCTTGTCTTTTTTATATGCATTTTTCTAAACTTTGAGCTCATACTGTA
TTTGTGATCAAATATTCTTGCTGCTTCACTTAAAATAATGACAAAAGCATTTCCCATCAC
ATTCTCTTTTCTAAAGGGTTTTATTCATAGAATAATAATGACAACTACAGTTCTCCAGGA
AAAAGTATGTTGTGTTGACTAGTAAGTGTTTTTAGTGAATAATAAAATGACTGTTTTTTG
TTTGTTTTTGTTTTGTTTTGAGATAAGGCAATTCTGCTAAGCAAAATAGGAATAAAAATT
GTAGGAAAACAAAGGAAATGATGCTCTCTGGTTCTAAGAATTTGATATGCCATAATCTAA
ACTGTGTCGTGTGTGTGTCCTTCCCATCCCGTCCTCCGTCCCTGTCCCCCACCCCCACTC
AGTCAAGGTCGAGGAGGCTGTGGTTGAGAATCATGCAGTAGTAAGTTCTGCTGTGGAGGG
AGAAGCAGCTACATATCTGGGTCCAACTGTGAAGCCAGATAATAAGGTTAGTAATATCTT
AATGTGTACTACGTTGTTAGAGTTGTTAGAGCTATTTGGCTTCACTTTGTCTTTAGTTTA
CAGAAATCGTGAACTATTAAAGTCTGTGTTCTCTGAGATCTGCTCTTACTGAAGTGGATC
AATGATGAAAATAGCCAAATCTGAGCATCAGAAGACCTTTCAGTCTACCTGATGCATGAT
CTCTGTAGTTCTGAGAAGCAAAAGTATAGAGTAATTTAAAACAATAAGGGCTTGTGTGTG
TGTGTATATATGTGTGTGTGTGTGTATGTTTGTGTTTATAAAGGTGACAGTGGATAACTG
AGGACTTGTTGATGGATGAATGAGATTGGCAGGGAGTAACGTGTGTGTATGAAAGGCTAA
TCAGTTCTGAGCAATGATGAAAAAAGGTTTTTACCACTGACCTTTATAACTATGAAGGTT
TCTACACTTGATCTGAGCTCAGAATTGATAACTGCTTATTTTGGTGATTTGGGCTTTCTT
GGTATTACTTCCTGTATTGTGGTCTCATGTTCTCCTTAATTTTTAGGCTGAAACAAAAGA
GATTTATCATGAGCCATTATCTTCAATAAGTATTTCTACTGGGAGCTTTTCAAGTTATGA
CAACACAGATTTGAGCCTTACAAATCCAGGTAATAATGTCAAAATGTTAATAAATAAATT
GAAAGACCAGCACCAGTTGAGTTGCAATACAGTGGTGAGAGCAAACAGTGCTTTTCACAG
TGTGCTGAGCAGGATTGTTTCTTTAAATCTCAAAAGTAAAGTATTCATGCCTGATAGAAT
ATTGGACACTATGATGTTCTAAACATGATAGGAAGTCACAGGCCTGCACACCCTCTGTGG
ATCCCCAACAACACTGAGAAGTATCCACTAATGTCACATTTCCCATTCAGTGGGACTCTA
TCTGAGCAAATTTCTTGGTTGCACTGATCCCATATCAATGTATATTGCTATGCCTTTTAA
CCAAAATTTGTCTCTAAGGAAGTACCCAGCCATTAAATATTTTCATTAAACTGAATTTTC
AGAGTCATTTTCAGAGCATGTGGACCAGAGACGACAAGAATCTATCACCAGTAAAGAAAA
GGAGACAAATATTTTAAGTTCTATACTTCCTTCATCACAACTTATTTATCAAAGGCAGGA
CTCTTGGGGATATTCATAAACTTCTGTAACCTGCAGTAGAAAGATTTACAACTGGCCAAA
CACACATTCAGCAGGTGATAGAGAAGTATATAAATGAAGCAAATTTGATGAGTGAAAAAA
CAGAGTTGTGGGGTAAAATTATTTTGAACAAATACTTTCATATAAACTAAATGTTTTCAA
CGTGTGGCTTTTTAGTTTTTTTATCCTTTTTGTAATGACTGTTTGAGCTTCATGTTTTTA
TGGCCTGCTGCAGCACAGTTATGACGTGGAAAACATTGAAGGCATTTAGTGAGAGAGGGG
ATCTGGAACTGACTAAAGAACATGTAAGAGATTAGCATAACTTCCTTTACTATCGCAAAA
ATAACAGCTTGAGGCAGTATTGCCAATATTGAGAATAAAAGCTCAGAAGTCAGACAGACC
TGGATTCAAGCCCTAGTTTGACAGTTTTACTAGCTGTGAGACCATGGGCAAGTTACTTAC
TCTTTCATCTTCTATACAAGAGGGATGTTGGAGATTAACTGAGATATTGCACGTAAAGTA
CAATGCCTGGCCCATACCAACTCTCAGTACAGTGAGCTTTTCTTTTTTTAATCATTGATC
CTAAAATGAGCTAAGTGAGAATAACAAACCTTATAGCAAAGCAGTGTTCCTAATAGCCTC
TTACTCCCAATTAACCTCATTGGACTTTTGGCCTGTTAGAAATGGAAACATATTTGTCAA
GGTTTTGATCATTAAGAGTATCCTTATTTTTTTTGTACATCAGAAATAATGATAGGAGTT
AATTTGAAAGCAGCTGCTGGTAATGAAAAAACTGAAGTAATCTCGTTGAATTGGAGTTTC
CTAAAAATAAACTTTTACAAATATGTTCTTAATACTACTTTTCTATGCTTTATTTTTTTT
TCTTTTTCTTTTTTCTTGTGAGGAAGATTGGCCCTGAACTAACAGCTGTGCCAGTCTTCC
CCTATTTTGTATGTGGGATG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1138, 1945..2145, 3034..3158, 3874..3967, 6419..6514, 9349..9489, 12199..12382, 12603..12770, 17705..17926, 20984..21076, 21231..21334, 22777..22914, 23325..23422, 23688..27186, 28629..28797, 28934..29077, 33167..33319, 36902..37005, 37546..37648, 38042..38139
1001..1138, 1945..2145, 3034..3158, 3874..3967, 6419..6514, 9349..9489, 12199..12382, 12603..12770, 17705..17926, 20984..21076, 21231..21334, 22777..22914, 23325..23422, 23688..27186, 28629..28797, 28934..29077, 33167..33319, 36902..37005, 37546..37648, 38042..38139
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved