Equus_caballus Locus ENSECAG00000024469
snOPY snoRNA Orthological Gene Database
Equus_caballus ENSECAG00000024469
Equus_caballus
ENSECAG00000024469
7
SNORD105
1826..1912
5525
GAGATAAGAAGAGAGAAATTTAGATGAATACATACAAACATCATAGTCTATCTGTCCTT
TGATTAAATGCATAATGACGGAATGGCCAAAGTCGGCGGGAGGGAGCCAAGACTGGGAAA
AAGATAGGAGAGAGAGAGAGAATCTGATTGGCCGGCTGGGTGTTCATTGAGCTCCACAGC
ATATGGGCATATGACTTAATTGTAAGATGGTACTGTAGTGCAGGAAAGTGTGATGAAGGC
TTACTATCCCCCCCCCTGGGTTCCTTGGAAAAAAGCACATGGCCCCGANNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNTCTTCTTGAGAGACGCCACATGGGCAGTCGGGACGGTGTA
GCGAAGCGGCCGGTGTCTCCGGGGGTCGGGCCGCGCTGGCAGCGGCCCAGTTGAAGGCCG
CGGCACTCACCCGCTCGCCCTGTCGCCCCCGCAGTCCCGGCCACCAGAAGCGCGCGCGCG
CCCAGGCCGCAGCTCCGCAATCTCGAGGCCTACGCCGCGCAGCCGCACTCGTTCGTGTTC
GCCCGGGGCCGCGCGGGTCGCGGCGTCCGGCAGCTCAGCCTGGACCTGCGGCGCGTCATG
GAACCGCTCACCGCCACCCGCTTGCAGGTCCGCACCCCCCGGCCCGCCTCCCTGGCTGGA
GACAGGGACCCTTCCGAGGACCAGCGTCCCTGCTCTCAGGGCTTTGCAGCGAGGCCACGC
CGATGAAGGCGCGCGGCCTGGGGCTCGGCTGGGTGCCTGAGGCCGGTGGTTAAGCTGGGT
TGGAAACTCGGATTCTCAGAGGCCTGGAGCAAGTTCCTTAACCTCGCTGGGCCTCCGTTG
GCTCAGCTGCAAAATGGGGCGATGCGCAGTAGCCAAGGGACAGAGGCAGTGCTCGAGATC
AAGTCTCATTGGCCCTAAAGGCCAAGGGGCTAGACGCAAGAAGGGGCGTAACAGCTTAAA
CTGAGGGCTTTTGTCCGACAAGGGGATATCTGAGCCTTGCTTTTTCTTTCCGTAACTTAC
AGGTCCGGAAGAAAAACTCTCTGAAGGATTGCGTGGCAGTGGCTGGGCCCCTTGGGGTCA
CACACTTCCTGATCTTAAGCAAAACAGAGACCAATATCTACTTTGTGAGTGGATGCCCAC
ACCCCTCGTCTCTCCTACGCCCTCCTCCCCCAGCTCTGGTGATGAACCCACGTGCCTCTG
AGCTGTCGTGATTTTGGCTTCAAAGTAAACGCTCTGAAGAGATGGGGCAGAAGTTCCCAT
GCCCCTGCTCCCTAGCTGGAGGCCTGGACCCTCACTGATTCTTTCTCCTCCTGTAGAAGC
TGATGCGCCTCCCAGGAGGCCCCACCTTGACCTTCAGGATCAACAAGGTGAGGACTGGAG
GGGGCATGAGGACCGTGTGGGGCAGGAGCTGGGTGTGGCGGTGGCGCCGGGCACGTGTGC
TTGGCCATCGCCCACTCCTTGCCCTGCCCTGCAGTACACACTGGTGCGTGACGTGGTCTC
CTCACTGCGCCGGCACCGCATGCACGAGCAGCAGTTCACGCACGCGCCCCTCCTGGTGCT
CAACAGCTTTGGTCCCCACGGCATGCACGTGAAACTCATGGCCACCATGTTCCAGAACCT
GTTCCCCTCCATCAACGTGCACAAGGTGGGCTGGGCCTGGTGTGATGTCAGGTGAGGGTG
GATGGGGCAGGCAGCAGGTGCCACACGGGCCCTGGGGGCGATCGCACAGTCCTTACCTCC
CATCACTGAGGCTGAGAGCTCCAGCCCTGAGGCCGCATCTCACTCGTACGATCTGGGACA
CTGGGCAGGAGGCTCCCCCATGCGCTGCCTTTCCATCCAGCAGGTGGGAAACCATGCCAG
CAGTGCGTTATTTTCTGAGCGTGCGTTGAGTACTGGTCTTGGCAGTGGAGCGAGTGTTGT
TAGAGCTCTATTTGACACGGAGTAAAGCAGGTTGGCGGAGGTGAAGTCACTAGGCTCAAG
TTAGATACACGGGGGCAGGACAGGATGTTGTCATCTCTCTGGCCCCAGAGCCCAGCTCCT
AACCCCTGGCACCAGGGGGTCTCCAACATGGCTTGTTAGGTGCTGATTATCAGGGAGCCT
GGTGTGGGTGGCCTCAGTGGGCCTGGCACCCAGGATTTGAGCCAGCGCCCCGGGCACTTC
ATGGACGCCAGTCACAGCCCCATCAGTCCCCACGGTGCTAACAGCATCCTGTTCCCCCTT
GGTGGGGTTTCTGGAGTGTGGGTGGCCTGGGCTCCCACACGCACTGAGGCCCGTGGGCAG
CTCCCTTGGTGCCATGGCCCCTCTTGGGTCCTGTCCAGGTGAACCTGAACACCATCAAGC
GCTGCCTTCTCATCAACTACAACCCCGACTCTCAAGAGCTGGATTTCCGCCACTAGTGAG
TGCCCGGGAGCGGAGCGCGGGCGGAGGGGGTGGCCTCCATGTGGCTGATGACAGCGCTGC
TGCTGAGACTCTGTGACTGCTCAGTGTCAAAGTAAACGCTCTGACGCACCGTGGAAAGGG
TCGGGGGGTGGAGCCAACCCCATGACCCCTGACCCCCCTGCTTGCTCACTCCGGCCCCTG
CAGCAGCATCAAAGTCGTTCCTGTGGGCGCAAGTCGTGGGATGAAGAAGCTTCTCCAGGA
GAAGTTCCCCAACATGAGCCGCCTGCAGGACATCAGCGAGCTGCTGGCCACGTGAGGAGG
GTGTGGGGCGTGAGACCGCCGCAGTCCAGGGGACCCCAGAGCTGTCCTGGGAGCATGGGA
TCCCCTGCTGAGCCGCGTGTGTCCCCCGCATAGGGGCGCGGGGCTGTCAGAGAGTGAGGC
GGAGCCAGATGGTGAGCACAATATTACAGAGCTGCCACAGGCCGTCGCGGGGCGCGGCAA
CATGCGGGCCCAGCAGAGCGCCGTGCGGCTTACGGAGGTGAGGCCCGGCGGCAGAGGTGG
CTTCCTCTGGCAGCCCCCTCTCCAGGGAAGGACTCACTCCTGTCCTGTGTCCCTGCAGAT
CGGGCCTCGGATGACGCTGCAGCTCATCAAGATCCAGGAGGGTGTCGGGGAGGGGAACGT
GCTGTTCCACAGTTTCGGTGAGGACGGGGCTGGTGGGCACCCAGCCTGGGCTCTGAGGCC
TGTAAAGGTGGCTCGCAAGGTGTGGTGCACCCACCTGGGTCTTGGTGAAGATCTTGGGGT
CCATCTCTTCCTGCTCAGTGCACAAGACCGAGGAGGAGCTACAGGCCATCCTGGCAGCCA
AGGAGGAGAAGCTGCGGCTCAAGGCCCAGCGGCAGGATCAGCAGGCCCGGAACGTCCAGC
GCAAGCGGGAACAGCGAGAGGCCCACAGGTGAGGGGCTGCTGGCCGGGTGGGTGCAGCCC
GGGCCCGGGTGCAGCCGCCGTGCTGACTGACTGATGCCCGTCTTCCAGGAAGAAGAGCCT
GGCGGGCATCAAGCGGTCACGCGCCGATGGGGACAGTGATGCGGAGGACCCCGGGGCCCC
CCCCGAAGAAGAGGGGGCCGGCCAGCGGGAGGAGGAGGAGGAGGATGAAGCCGAGTACTT
TCGCCAGGCAGTGGGCGAGGAGCCTGATGAGGGTGCGTGGTGGAGGTCGACACAGCCGGG
CACTATGGGCCTGTCCCTGTGCCCCGGTGACCCTGACACGAGCTTTCCCTGTAGACATGT
TCCCGACGGCAGCCAAGCGGAGACGGCCCGCTGGACACCCAGGCAAAAAGCAGCAGGGAA
AACAGCGGAGGCTGGACCGAGGCAGTGACCGGAGGCAACTGAAGGCCAAGGGCAGAGCCC
AGGTGGCCCAGGCCAAGCTGGGACCCGGAGGAGCCACCCGGACCCACGGGCGAGGCCGGG
CACAGCCACCTAAGAGGGCAGCCTGAGCCCCAGGGTCGGACGGAACGCCCCAGATTGGGG
CCCGAGAGGCGCTCCCTGGTTCCCCCGGCCTCCAGGGCCAGCCTTCGGTTTCCTTTCATA
AAGGAGCTGTGTCCCCACCCCCCTAATAAACTGACCTTCTGGGAGTCTGAGTCTGTGCTG
GCGATGGGGTCCTGGAGGCCCACTGGGCGAACCGAGACGGCTGGGGCTGCAGCCCCTGGG
AGGGGGACATGGTTTCTGCCCCAGACCTGGCTGTGGCATGCTGGCCCTGGTCTGCCGTGC
CTCGGGGTCCTGGGCCCCTCCCCACTCCCCCTGACCGAGCTGAGGGCTGCGTGCAATGAG
GAAGGAAGCGCGGTGGGGGCAAGGGTGCTGCTCTGACTGGCTCTGCTGGCTGAGGTTGGA
GTGGCGGGCAGGGCGGGGCCAGGCCAGGCGCGCCGCCACCACTGCTCGGTGGGGAGGGAC
CGGCAGAGCGTGGGCAGCGGACTCAGCGGCCGGGTGTGCAGGCCATGGCAGCCACCATCC
CAGGTGAGATCCAGGGCCCAGGACCCTGCAGTCAGCCTGGGGCCGGGGCTGGGGGCACAT
GGTGGAGGCAGCTGCACCCCGGAGGTGGAGGGGAGGTGGGTTAGCACCTGGGGCTGGACG
GGGACTAGAAGCCTAGAGCAGAGGGGACAGGTAGGCAGCCGGCGAGGGCAGGAAGCAGTG
GGGCGGGCAGGGCTGTGTGCACCTTGCCCGGGGCTGGCGGCCAGCCTGCTGGACAGGCCG
AGAGGAGGCCATTTGTCAGATGAGAGCGCTGAGGCAGGGGTGTGAGAGGGAACCGTCCCC
AGGGCTGTGCTTGCTCACACTATTGGCCCAGGAGCTGGGACTCCCTGCCCTCAGGAGGTG
ACCTGGAAATTTGTCTCGTGGTGATCAGATGGAGACACACAGAGAAGGCGGCCTGGAGGG
ACCGAGGGGGACAGTCCCAGTGTTCAGGTGGTCAGAGCAGGCCTCTCAGGGCCAGAGACC
AGAAGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1014, 1114..1144, 1149..1286, 1682..1783, 1976..2026, 2134..2304, 2978..3054, 3243..3350, 3453..3576, 3658..3736, 3858..3987, 4068..4231, 4314..4525
1001..1014, 1114..1144, 1149..1286, 1682..1783, 1976..2026, 2134..2304, 2978..3054, 3243..3350, 3453..3576, 3658..3736, 3858..3987, 4068..4231, 4314..4522
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved