Equus_caballus Locus TNPO2
snOPY snoRNA Orthological Gene Database
Equus_caballus TNPO2
Equus_caballus
TNPO2
7
SNORD41
8066..8135
13247
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNTAGCTGGGCTCCGCTAACACGATGATACGACTGTTCTACTCACA
CTCCCTGTCGCTGTACACTTGAGGGAGCTGTTATCTGGTTTCTTCACATCGACTAGTGGA
GGGCTTTGTAGATCTTTAATTGTGGAAAAATCTGAGGTTTTTTAGCAGAAGTTTCTGCGG
CCTCGGGGACGGGACCGGGGGGAGGGTGGGTCGGGGGGAGGGCTTGGCCGCATCTGATTG
GGGAAAGTGACAGGGACGGCCCAAGGGGCTTCTGTCACGGTGTGGGCGGGCTTGGCTCGC
TTTCATTCTCTGAGAGGCACTGGGGACCTGTTTGGGGATTGCTTCGCGCCCGATTAGGAG
GACTCTCTGGACGGGGTCCTGCTAGGCCAGAAAGCGGGGCGTCTGGCATCCGGTTGAACT
CGGAGGGCCGGATTATGGGACGCGGCAGGGATCAGGACAATCGGAGCACCTTGGGACGGT
GCACCTGGGGAGGCTCAGGGACTGCTCAGGGGCAGAGGAGGTGGCTGGGATCTGGCGGAG
CTCGAGGGCTGGATTTTGGGAGGAGAAGCGGGGGTCTTTGGGGACCACGCCTGCATGGGG
CCGGGGCGCTATCACAGTCTGGGGCAGGGTCCCTAGACGGGGAGGTGGCTGCTGCGAGGG
AGACAGAAGCGTTAGGGCCCACAGCCCGGGTAGCAGCACGGGCTGCCGTGGGACGAAGGC
TCCGCGCTGGGCCGGATGAGGATCCGCCGGCCCTGCCACCTCCTCCCATAGCCCGCTTCC
ACATCCCCCGCCTGCGCGGCCGTGGATGGTGGGCGCGGCTGGCTGCGACCCCGCGCTTGG
GCTACTGTGGATGGGCGGACTTGTCTGCCGGGTGTACTCCAGTCGTGCTGCCTCCGAGGG
GCCTCAGCCTCTGTCTCACACGGAGCCCCGGGGACCCAGGGCTGACCCTGGCCCCTGCCC
CCACAGCTCGCCTTGCGCCATGGACTGGCAGCCAGATGAGCAGGGCCTGCAGCAGGTCCT
GCAGCTGCTCAAAGACTCTCAGTCGCCCAACACAGCCACGCAGCGCATCGTGCAGGATGT
ATCCTTCCTTCCTTCCTTCCGGGCCTGGGGGAACCTGGCAGACATCTGCAGCCCCTAAAG
GCCAGAGAGGAAGGGGCCGCCTCCCGGATCCCCAGACTCTTTCTCCTGTGGGGAGGAGCT
AGCCTTGGCTGAGAATGAAGGATTAGAATTCTTGGGTCCCATTCCCAGAGGAAATGTGGT
CCTGGGGGCCGGGGTGGGGGGAGGTGCAGGGCTGGAGGAGGACACCTTTTGCTGGCTCTC
AGTTTTTGTTTAGGTTCATGGTTAAAATTTCTTTTTTAATTGGTTTAAAATACTATGTTA
GACTTTTAAAATGTTTAACCATTAGTAAGTTTTGCTTGAAAATGTGGATTTCCTTCTTTT
TGAGAAAAGCAGGCAACATTGAACTGCTGGTGAGCGCCTGAGTGGCAACAGCTGCCTTCA
GACGGAGCGGGGGGGCTGCCAGCCCTCTCCTGCTCTGGCCAGGGCTGCAGGACTGGGCCG
AAAGCTCAGGCGTGCTCCCGCAGCCCCCTGCATGGATTTGATGGGGCTGAAGTGCTGTGT
TTGGGGCACGGGGGTTGACAGGTGGGGTCAGGAGCTGGCTGCATGGTCCCAGTGGTCAGA
GGTACCATCAGCTATGTGACAGTAAGGGGGCCCTGCCTGGGGAAGGCCCCTCTCTCCCAA
GTCCCTTAACAACCGGCAGAAACTCAAACAACTGAACCAGTTTCCCGACTTCAACAACTA
CCTGATCTTCGTTCTGACCAGACTCAAGTCGGAAGGTACGCCTTCGGGGCCCCTCCACGC
AGGCTGGACCCTGCCTTCTCCCCCGTGGTCCCTTGAGCCTCAGTCCTCTTTCCCCAGATG
AGCCAACTCGCTCTCTCAGTGGCCTCATCCTCAAGAACAACGTGAAGGCGCATTACCAGA
GCTTTCCACCGCCTGTGGCTGACTTCATCAAGCAAGAGTGTCTCAACAACATCGGGGACG
CCTCCTCGCTCATCCGAGCCACCATAGGTGAGGGGGCAGTAGGGGTCAGCCTGTGATGAC
CAGAAGCTTCTGAGCACGTTAAGGGGGTTGACTCACTGAATGCTCCAGCACTGTGGACGG
TGGTACTATTACTGTGGCCGTTTCACAGATGAGGAAACTGAGGCACAGGGATGTTAGGGG
GCTTGCCTGGTGAGGAGGAACTCGGAAGCGAGCAGCGCAGGCCCACGCTCTGGACCGCTC
CCTCCTGAAACAGCCGCGCTTCCTTCTGAGGCAGTCACTCAACGTGCAGAATTTGGTGTT
AGGTCGGGGCTCCCTGCCCTCGTGGAGCTCAGTGTCATTAGCCAGCTCTCACCCATGACT
ATTTAGGTGAAGCGTGAGCCAGGTGGCATTGGAGCGTCCTGACTCCTGGGAGGCTGCCTG
GGGAAGGACCAAGAATTTTCTAGCAATTTTCCCTTAAGCTTTTCACTACTGATAAATACC
GATGCTACTCTGTATTACCAGCTTGATTTTATTCCCAGCTGTCTTGAGATATAACGGACA
CGTAACTGACTTATACTCTTTTAATTTAAATTTATGTCAACTTTTAAAAGGTGCTGTTGA
AAGAGTGTGGTACATAACTTGTAAATGAAGAGATATTTGCTTGTCCTAAAGGGCAGGTAA
CCTTAAAAACAAATGCAGTAAAGACAGAAAAAATAGTCTTAAATTTGAAGTAGATGGGGG
GCCTGCCAGAAGGGCTGGTCTTGGGGCCTGCCGCCTCTGTTAAAAGTGACCCTTAGCCTG
GACAGCCCCCACTTTGAGGCTAGCAGAAGGACCTGGATGTAAAGCTTATTCTAGGGCCAG
GTTCTGCTCCAAGTACTTAAGTCGTTGACGCTTCCTGGTAGTCCTAGGACGTTGTGTTCT
TTATCTCCGTTGAGGCACAGAGAGGTTGGGTGATGTGGCCCAGGTCATACAAGGACGGGC
CTAAGGCTGCACTCAGTCTACCTGATCAGGGAGCTGGGGTCATCTGGAGTGTGGGCAGTG
GCAGCTTCCCCTCTGGGAAACACTGCCATCTCCTGGCTTTAGTTACCATCTGCACTGACA
TCATGAGTTCAGTCAGCCGCCAGACCGCTCCACTGCCCTCTCACTTTAGAAGCCTCCTGC
AGGTCGCACTTGGGTTTCTAATACGCAGTACAGGGCTTCCCCAAGGCCACGTGGCCCTGC
ACGACCTGCCCCGCTCCCGACCCAGCCGTCACCTCCTCTCGCTCTCTCCGTCAGCCCCAC
TTACTCCTCACCCATCTGTGAGCACACCAGGCCTCCTGCTGCCAGCCCTTTGCACCTGCC
CTTCCTTCTGTCTTGGCTGCTCCTTGCCCAGGGACCTGGACGGCTTCTCCCTCACCTGCA
GGTCTTTGCTCAGATATCAAGATGGCACCTGGCTGAAGCCTGCTCTGGACACCCAGTTTA
AAATGGCTGCCTTCACCCTCAGCCCTTGCCGGCCACCTTCTCTGCTTTGTTTCCCCACTT
AGCTCTTGGTGTCTCACTTCCCAGGTCTTTGCTGCTTTCTCTTTACCTCACCAGACGGTC
AGATCCCAGGGGCGGGGATTTGGTGTTTAGTGCTGGGCTGCCTCAGAGCCGGGAGCGGAG
CTGGCTCACAGTGAGGCTCGGAGCATCTCAAAGGGGCGTGTGGTGCTTCTGGGGGCGGTG
AGGGCCGGGCTGCCGAGCGGGCCCGCACCCCGCCTGAGGCAGCGTCCTTTCCCGGCCGCC
CCAGGCATTCTCATCACCACCATCGCTTCCAAGGGCGAGCTGCAGATGTGGCCCGAGCTG
CTGCCCCAGCTGTGCAACCTGCTCAACTCAGAGGATTACAACACTTGCGAGGTAGGCAAC
AAGCCGTGGCCCCCGAGCGGGCATGGGCGCGGGAGCCTGACCGGGACCCACGCCCGTCTG
GCCGCCCCCCTCCACTCAGGGAGCCTTCGGAGCCCTGCAGAAGATCTGCGAAGACTCTTC
TGAGCTTCTGGACAGCGACGCCCTCAACAGGCCCCTCAACGTCATGATCCCCAAGTTCCT
CCAGTTCTTCAAGCACTGCAGCCCCAAGATCCGGTGGGTGTAGCCCCGGGGTCTGCGGGT
CCTGGGCAGGCAGGCTCGAGGCTGACCGTGTGCTCGCCCCCTGGCAGGTCCCACGCCATC
GCCTGCGTGAACCAGTTCATCATGGACCGGGCCCAGGCGCTGATGGACAACATCGACACC
TTCATCGAGGTGGGCTGCCGGGCTGGGGGTGAGCAGGCCGAGGGCTGAGGGCCCCGCCAC
AGCTGACCCCGCCTGCCCCGCAGCACCTGTTCGCCCTGGCCGTGGACGACGACCCCGAGG
TGCGGAAGAATGTGTGCCGCGCTCTGGTGATGCTGCTGGAAGTGCGAATCGACAGGCTTA
TCCCCCACATGCACAGCATCATCCAGGTGTGCATGGCCTAGGCCAGTGCCATGGGGTGGG
AGGCAGTGGGGGAGCCCCCACCACCAGCCGGCCGGGCCTCACACCTTCTCCCACCTGCCC
CAGTATATGCTGCAGAGGACCCAGGACCACGATGAGAACGTGGCCCTTGAGGCCTGCGAG
TTCTGGCTGACACTGGCCGAGCAGCCCATCTGCAAGGAAGTCCTGGCCTCCCACCTGGTC
CAGTGAGTGCTGCTCCTGCCCTCCGTCCCACCCGAGCCTCAGTTCATGTCTTCTGTCTCA
GTTTACCTTCTATCCCTGCAGACATTAGTATTGAAAGTGATAAGAATGTAGCTTTTAATG
ACTTAAAAATTAGGTAAATTATAGGTAGAAAAAATGAAATGTCAACAAAAGCTTCAGGTA
TAGCTGGATCCAGGTGCTCAAAGGATGTGAAAGATATCTATCTAGTCTCACATCTACTTC
ATCTGTGCCAGCTTCGTTCTCAGGCATGACCTTCCCTCGTGGTAGTGTTGTGGCCTTGTG
CAACCTTCCAGCTTAGGAACCTCAGAGTAAAGAGTTTCTCTCTTGACCAGTTTTTCCAGC
AAAAGTCCTAGGGCTGACCTTCCTTGACCAACAGGGATCACTCACCTGTCCCCAAGTCAG
TGGAGGTGTAATCACAGTTTCCAGTCCCGAGGTGCATGGGCTCCGGCTGAGGGGGCTGGC
TGCCCTGCCTCCTGTTTGCTCCCCTAACCTGGCCCCATCCCATGGAAGTGCCTGATGGTA
GGGTCCCATCTCCCTGCCTTGTGGGGTGCTAGGGGTCTGGCATTGTTCTCAGCTTTTCAG
TGTATTCAGGGATCTGGAATTCACTGAGGGGCCAAGTGTGGGTCAGGAGCCCTCCTGTGG
AGCCAGGAGTCGTGTCACCTCTGTCCCAGTCACGGGCTGAGACTAGGCTGGCTTGGCACC
CCCTGCGGGAAGTGAATGGACACGGAGAAGCAGAATCAGCAGGCTTGGGACAGGCGGCCC
CTTGGCCCTTCTGCTTTCCTCTTCCCGGGGCTGTCAGCCTCCCTGGGGCCCTGCAGCCCG
ATGAACAGCTTCTCTCCCGGCAGGTTGATCCCCATCCTGGTGAACGGGATGAAGTACTCG
GAAATTGACATCATCCTGCTCAAGGTCGGTCAGGCCAACTGCTGGGTGTGGGCCAGCGGG
CGAGGCGTAGGCCTGGGGGCCCTGGGGGTACTTAGTGCTGTGCCTGGCCCCACAGGGGGA
CGTGGAGGAGGATGAGGCGGTCCCCGACAGCGAGCAGGACATCAAGCCACGCTTCCACAA
GTCACGCACGGTCACGCTGCCCCATGAGGCCGAGCGGCCTGACGGCTCCGAGGACGCAGA
GGATGATGATGATGACGATGCTTTGTCCGACTGGAATCTGAGTGCGTGGCCTGGCCTGGG
GCAAGGGGGGATCGTGGGGGGCAAGCCCTGGGCTGTCTCTCGAGAGGTGATTGGAAGCCT
CCGCAGAGCAGATCGTGCAGATTCTGATCATGATCTCTGACCCTGGGGGTACAGGCGGCG
AGGGCCTGCGGCGTGCCCGATGGGCCTCCCTGAGCCTACCCCACAGTTTCTCCTCCCACC
CCAGGGAAGTGCTCGGCGGCTGCGCTGGACGTCCTGGCCAACGTCTTCCGGGAGGAGCTG
CTGCCCCACCTCCTCCCCCTCCTCAAGGGCCTCCTCTTCCACCCTGAGTGGGTGGTCAAG
GAGTCAGGCATCCTGGTGCTGGGTGCCATCGCTGAGGGTGAGTCCTGCCCGCCCGGCTTC
GCCTGACCTCTGAGCCCCGTGCTGGCTCAGACTGTCTGGGGCTGGCCCACGCAGGGCTGT
GTCTGGGGTGAGCTCTCCAGAGGCCTGCTCACCCCCCTCCAGACAGCTCCGGGATTTGAA
TCTTCCCCTCAGCCTGTGGGCCTGAAAGGAACCCCAGCCCCACAAATGCAGGCTCTCCCC
AATCCTCACGGGCCGGCAGTTTCGTGAGGTTGGGAGCATCATTACAGCAACCCGACATCA
AGGGACTTCTGCAGGGTTTGCCCTGCGGCAGGCAGCCGGGGGCCACCGGCTCACCACCCC
AGTGAGCTGGGTGTTCTAGATGGGGATACAGAGGAGCAGAGAGATTGATGCCACTTCCCT
GGGCGGTCTGGGTGCAGCTGGCCGCCAGGCTGCCTGCAGAACGACAAGGGTGCAGCGGTG
CTGTTTCCTCCACTTCTGCTCAGAGTGCTCTTAGTGGCGTGTTCCTCCGGCTCCCTTTGT
CCCAACAGGGTGAACAGCTGAATTCCCAGACTGCTCTGTGCATCTGTTGCAGGCATCCCT
GGTGACTGCCTTGGCCTCCAGGCCTGTCAGAAACAGGCCACAACTCGGCGGGGACACCTT
TCCCCGAGAGCTTTTTTTTTTTTTTTTTGAGGAAGATTAGCCCTGAGCTAACTACTGCCA
ATCCTCCTCTTTTTTGCTGAGGAAGACTGGCCCTGAGCTCACATCCATGCCCATCTTCCT
CTCCTTTATACCTGGGATGCCTACCGCAGCATGGCTTTTGCCACGCAGTGCCATGTCCGC
ACCCAGGATCCGAACTGGCGAACCCCGGGCCGCCGAGAAACAGAACGTGTGAACTTAACC
ACTACGCCACGGGGCCAGCCCCAGCCTGGGAGCTTTTAAAGCTTGTCATAAAGGTTTCCT
TGTATGCTAAGTGTAACGTAGCTTATGTTAATATGTGTATATGTATTAACAGACTACATT
TTGTCTTCTGTGTGTTAATGGGAACAGATCTAGAAGAACTGACCCGAAACCAGTAAAAAT
AGGTCTCGTGTCGTGGATTATTAGGGGTGTGCTATTAGCTGAGATCTCTGATTAACAGAG
AGATGCGTTCATGGTTTTTTAAAAAAAGAAGAAAAATAGAAAAAGAAAAATCACAAACAT
CAAGAAAGTTTTCAAAGGAAGAAACTCCGTCCATCTGGGTCACTGCTGCCCACAAAGCCT
GAGTCACTGTGCAGCCCAGCTGTCGGTGCATTCACGGGTCACCAGGACGGGCTGGGGCCA
CTGGAGGGGACAGGCTCGCTCTGAGCTGTCTTCCGTCCTGACCCTGCCTTTACCTGCTCT
GTGACGCTGGGCCACTTATTTAACCTCCGAGCCTCAGTTTCTCCGCCTCTCCCCAGAAGG
GTGGGTGTGGCCCGGCCCAGCTGGGCTCAGCCTCACCCCTGTCCCTGTCCTTGCAGGCTG
CATGCAGGGCATGGTGCCCTACCTGCCTGAGCTGATCCCGCACCTCATCCAGTGCCTGTC
GGACAAGAAGGCCCTGGTCCGCTCCATCGCCTGCTGGACGCTGAGCCGCTATGCCCACTG
GGTGGTCAGCCAGCCGCCTGATATGCACCTTAAGCCCCTGATGACGGAGCTGCTCAAGCG
CATCCTGGATGGCAACAAGAGGGTGCAGGAGGCGGCCTGCAGGTGACCTTCTGCCCCTGG
TCCCACAGCCCCTACCCCTGCCCCTCCGGGAAGTGATGATATGCATGACCCCTGACATCA
AGCTGATTTCTCGCGTATTCGTACTGGCTGATCCCAAGCACGCCCTCCCCATCCCGCCCG
TGGTTCTGCCCCGCTTGCAGCCACCCCCTGAGCCCTCCTCTCCTCCAGCGCCTTCGCCAC
CCTGGAGGAGGAGGCCTGCACGGAGCTGGTGCCATACCTTAGCTACATCCTCGATACCCT
CGTCTTCGCCTTCGGCAAGTACCAGCACAAGAACCTGCTGATCCTCTACGATGCCATCGG
CACTCTGGCCGACTCTGTGGGCCACCACCTCAACCAGCCGGTGAGACCCCACAGCGGCTC
CTTCTTCCCGATCCCGGGCCCCTCGGCATCCGGTGACCTGGCGGCGACCCCGTGTCACAT
GCCAGGGACGTGGCCGTGACCTCAACAGGCAGACAGACAGACCCAGCCCCTGCCCTCGCC
CTGCTCCCAGTCTAGTGGGGGAGACAGACAGTTATGAGACAGCGTGGTAAGTGCTGTGCC
GGGGCAGCTCAGGGGCCTGCGGGGAACCAGGGGGTGCCGACCCGGGCTCCGAGGTGGGAG
GGAGGGCAGGCCCCAGGACGGCTGAGAAGGGCCTGGATGTCTGGCTGGATGGCGAGGCCT
TGCAGGGGCCCCATGAGCCACAACGAGGAACCCAGACCTCATGGCTCAGGTGATGGGCGC
CTCTGAATCCCAGGGAGCCCTGCTGATTCCCAGGTTGCCACCCCAAGCCAGGGAGCCCCA
ACTTCCCCTCCCCCTCCAGGAGTACATCCAGAAGCTGATGCCTCCACTGATCCAGAAGTG
GAATGAGCTCAAGGACGAAGACAAGGACCTCTTCCCTCTGCTGGAGGTGAGCGGCTCCAG
GCCCTCCCCCGCGGCCACAGGCCCTCCCCCACGGCCCCGCCCACCTGAGCTCACCCCCTG
CCTTCTCCCTGCCAGTGCCTGTCCTCAGTGGCCACCGCCCTGCAGAGCGGCTTCCTGCCC
TACTGCGAGCCTGTCTACCAGCGCTGTGTCACCCTGGTGCAGAAGACGTTGGCCCAGGCC
ATGGTGAGCGCCCCCCCAATGCCCCCGCCTGCTCTTCTGTTGTTGCCCCAGCGCGGCCCT
GTCCCCTCACCCGCCAGCCTGCCCCAACTGTGCCCAGATGTACACCCAGCACCCCGAGCA
GTACGAGGCACCCGACAAGGACTTCATGATTGTGGCGCTGGACCTGCTCAGTGGCCTGGC
CGAGGGCCTGGGTGGCCACGTGGAACAGCTGGTGGCCCGCAGCAACATCATGACCCTGCT
CTTCCAGTGCATGCAGGTGGGTGCACGCCCCTCCCAGGCCTCTCACTGGACAGCGAGACA
CCCAGCAGCCTGTGTGGGCCGCGCTGGGGGCACTTGGGGCCTTGGTTGTGCCCAAAGGAC
ATCAGGGAAAAGGGGTCCGTAAAAACAGAAAAGAGTGTAATTGTTTAAAAAGCTATTTCA
ATGAGACACAAGTGAAACCTCATTGAAAAAGCAAACTGTAGAAAATGAGGAAGTAGAAAC
AGGAAATGTGAATGTACAAGCTCCCGCAGCGTCCCCCCCCAGTGTATGTGGACTGGCCGC
TGTCCCCCCAGCAGGGGAACCCTGAGCCAGGCTCTCATTCACACGTCCTGAGTGCAGGAT
GCACAGTGCGGCCTGCATCCTGGGCGCTGGCAAGTGGCAGGGTCAGGCCGGGCCCTGGGG
ACTGTTGGCTAGCTGCCTGTGGCTGGTGTGGGGAGGGGAGCCTTGCCCCGCTGACCCTGC
TGTGACCCCCAGGACTCAATGCCCGAGGTCCGGCAGAGCTCCTTCGCCCTCCTGGGAGAC
CTCACCAAAGCCTGCTTCATCCATGTCAAGCCCTGTATCGGTATGACACCTGTTTTTTCC
CCACCCCACCACCCCACCCTGGGCCTCAGGTGATGGAGAAGTGACCGGGGAAGACTGTGA
CCGAAGTGGGATGTATTCGTACTGGCTGATGGGGCCCGCATGGCCAGGTCTGGGAGCTCA
CCCTGGCCGGCCCCCTGCTCAGCACCCCTTTCTCCCCATCAGCTGAGTTCATGCCCATCC
TGGGCACCAACCTGAACCCCGAGTTCATCTCTGTCTGCAACAATGCCACCTGGGCCATCG
GCGAGATCTGCATGCAGATGGGTGAGTGCCTGCAAGTGGGCCAGCCCTGCCTCTCCCTAT
TGGCCTGATCCTGGCCTGGGGGCGGGAGCCCAGCTTGACTGACAGGTCCCCTCAAGCGGG
CCCTGGCTCTCCTTGAAGAAGGTGGCCATTGGTCAGGGGCAAAAGGACACCTCTGAGTGG
TGTCATCAGAGATGGGGCCTGAGCCTGAAAGACCGTCTGTGGTTGGCTTCTGCAAAGAGG
CAGGACAGGAGGCCTGTTCTGACTGGACTGTCTGCCACCTCCCCGTGCCCAAGGCCATTG
GCTGAAAGGCCCACTGGGACTGGTGGGGAGACTGGCGCTGCTCCACCCCCCTTGGTGGTG
TGGTCTTATCCTGGTGCCCAGGGTGCCTGGGGAAGTGTTGGGTGTGGGGGGAGCCTGTGT
GGCGGCACAGGCCCCGGGTGGGGGCAGGGGGAGGGGTATCGTTCCTTCACTGGCTGTCGT
TAGCTAGTGTCTGGATGCAGCTGCGGTCAGCATGGCTGGCGTGGGTCATATGGGCTCTGA
CTGGCTGGTCCCCCAGGGGCAGAGATGCAGCCCTACGTGCAGATGGTCCTCAACAACCTG
GTGGAGATCATTAACCGGCCTAACACACCCAAGACGCTGCTGGAAAACACAGGTGTGCGC
TAGGCCTGGGCCACTGCCGCCCCCCTTGCCTGCCTCCTGGAGTTGGGGTTTCCGTCTGGG
AGGGTTAGTTAGAAGAGGCCTTGGGAAAGAACCGGGGAGGGTATCTGGAGGGACTGGGAA
GGTGGTCCTGGGAGAGACCCAAGTACGGTGGGGAGGAGACTCTGGCTGGACTAGGCTTGC
CCAGGCAGCCAGCAGGAGCTATTCCCTTGGGGCCTGTGGGGCGGAGTGGGGCTGGTGCCT
CCTGCCAGAGGCCCCGCCACGTACCGGGGGCCGCTCGGGGTTGCAGGTCGCCTGACGAGT
CCCTCTGCCATTCCAGCCATCACCATCGGCCGCCTGGGCTACGTGTGCCCGCAGGAGGTG
GCGCCCATGCTGCAGCAGTTCATCCGGCCCTGGTGTGTGCCCCCCCGTGTGAGGCCTGCC
TGACGGTGGGCGGGCTGGTGGGGTGTCTGGGGCAGGCCCGATCCGTCCCTCGCCTGTGCC
AGCCCATGGCTGCATGTCCCAGCCCCACTGCCCGCTGATCCCTGCTGCCCCTGTCCCCTC
GATACGTGGCCCATCCAGCCCCCTGCCCACAACACAGATGCCCAGCCTGCCCCATCCCGC
CTGCTGACTCCCCGCCGCTCACCTTCCACACAGGTGCACGTCGCTCAGGAACATCCGGGA
CAACGAGGAGAAGGACTCGGCCTTCCGCGGCATCTGCATGATGATAGGCGTCAACCCCGG
GGGTGTCGTGCAGGTGGGCGCTGGGCGCAGAGGGTGGGCCCTGGGCTGGGCTGGGCGGCC
CCTCACACGCCCTGTCCTGTCTGTTTCAGGACTTTATTTTCTTCTGCGACGCTGTAGCCT
CCTGGGTGAGCCCGAAGGACGACCTCCGGGACATGTTTTATAAGGTGAGGCTCCCCTGGC
CCTGCCAGGGTCCTGGGAGGCGGTGGGGCGCCCCTCACCCCCTGCCTCCCCGCAGATCCT
CCATGGCTTCAAAGACCAAGTCGGGGAGGAGAACTGGCAGCAGTTCTCGGAGCAGTTCCC
GCCGCTGCTCAAGGAGAGGCTGGCTGCCTTCTACGGGGTCTAGACGAGCATCGTGACAGC
CAGGTAAGGAGGCGGCTTGCGGAGGGGGTGGGGGGGGGTGGCACTGTCATGGGGGCCACA
GGGGCACGTGCCCTGACCGCCCCCTCTCCCGCAGGTCTCTGTCTGCGTCATCATCGCAGG
GGTTGCTGGGGAGCGCGCTGCGTCCAGAAGTCGCCGTGCCCTGGTCGAGGGGGGTTAGGG
AGGAGTGAGTGGGACCCAAATCCAGATGCCTTCCCCGTCCATCTACCTGTGGGGCCGGCG
GCGGGCGGGCAGGTGGGTGGGGCCTCCACGCTCATCCTACAAACGGGGGGGTGGGGTGGG
ACTTCTTGGCGGCAAGGGCCCCTTTGCTCAATCGGGGTCACCTCCGGTGGCCCACTTGGG
CCGGCCACGTGGGAGGGAAGAATCAACACGGCCGACGGGATCCGGCTTAGGATGAGGCGA
GGGAAAGCAGGCAGGGAGGGGGGTCCTTTGTAGAGACACGTACACTCACACGTACACACG
TGGCCACGCGCATGTGCGGAGCTGCAGCCAGCCAGGCTGGGCCAGCCGCCCACCATTTCC
CCGACTGCATGGAGACAGGTAGAATTAGTGGAACCCCTGAGTTAACCCGTAAGCCTGTCC
GGTGTAACCCTGCATCTAGAAGTTTAAGAAGCTTCTGCTGTTTTGCCGGAATTGGCGGTG
ATCGGGGAGGGCTGGGGGGGTTGGGGGCCTCCGCGGGGACCCTGGGCGGGGGGAAGAGGA
TGGCCACCTTGGGGCCACCCCGTCAGCACGCGCACACTTCGGACCTGCTCCGCACACTTC
CTGCCGGCTCTGAGGCAGCCTCGGCCAGTGTGTCCCCCTCCTTGTCTTGTCCCAGCCAGA
AGACTGGGGACCACCAGAGCAGCTGGGGCTGGCCAGAAGTTGTCCTTTCTCCTTGCCCTG
GGCCCCAGCGACTTGAAGATGCTGGGCTGGGATTTTTTTCCCCCAAAGAGAGCTGGGGGC
GGCCACAGCTGCTGCCGCCTGCCCCCCGCATCTCTCCATAAACAAGCCCGTGTCAAGGAC
AGTCCATTTCTCCGTGCTCGCAAGAGCCCTCTTCCCAAGTTCTAGGCCTGAGTTTTAAGA
CAAGGGCTGCGGCCGGGGCATTTAATCGATGGTGACAGAGGATGAAGGTTTATGTTTTGC
CAGCAAGAAGGAAGCTCCGGGCCTGGAAGAGGGGAAAGGTGACGGACCCCCTGACCCCAG
TCTGTGGCCCTCGGGCTTCCCGCTCATCCCAGCACCCAGTGGGCCCCGAAACCCACCAGA
TTGGGGCATGATTCTAGGGTACCTTCTGAGATTGGCTGGGGATGTGGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1197, 1879..1954, 2037..2186, 3904..4010, 4099..4232, 4307..4388, 4463..4585, 4683..4801, 5663..5723, 5815..5980, 6184..6336, 7796..8021, 8208..8379, 8839..8925, 9015..9122, 9217..9375, 9852..9939, 10122..10220, 10756..10851, 11176..11251, 11493..11592, 11669..11743, 11815..11942, 12034..12247
1096..1197, 1879..1954, 2037..2186, 3904..4010, 4099..4232, 4307..4388, 4463..4585, 4683..4801, 5663..5723, 5815..5980, 6184..6336, 7796..8021, 8208..8379, 8839..8925, 9015..9122, 9217..9375, 9852..9939, 10122..10220, 10756..10851, 11176..11251, 11493..11592, 11669..11743, 11815..11919
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved