Equus_caballus Locus HSP7C_HORSE
snOPY snoRNA Orthological Gene Database
Equus_caballus HSP7C_HORSE
Equus_caballus
HSP7C_HORSE
7
SNORD14, SNORD14, SNORD14
3632..3718, 4055..4140, 4971..5058
6598
CTCGGCGGGCGGTGGAGGCCCGGCGCGAAGAAGCTGGTGTGGCCGTTTATTTCGCTGGG
GGTCCCGACACAGGATCGGGCGTTGGGGGTCAAAAGTCGGACCCGCAAACCTCCGCGGCG
GGGCTGCCGACCTCCAGCCACCACAGTGAACCGAAGGTTCTAGGGGCCTGCCCGGCTCAC
CTGTCCCACCCCACGCAGAAGCGGAGGCGGGGCCCTGCAACGGCCGGGCGACTCCCGCCG
ACCCCAGATCCGGGTATCCGCAGGCGAGATACTCCTAGCTGCACCCTGAGGTCGCAGCCT
TTCGCCCCAGCCGCTCGGGGTCAGCCCTCGCCCAAAGCCATGCTAGCTACGAAATGTGGG
TATGCGGACCCTGGGAGGGCCTAGACCCTGTTCACAATGCTGGGGGACAGCTGAAGGAAG
AGGATGAAGACTCGGGGCGGGGGGGAGGGGCGCAACAACCTTCGCGGCCATTTTGTCCTC
GCTCCACTTCCGTCTTCTCTCCCGGGCCGCCGGCTCCGGTCCCGCCCTCCAGGCGCGGCG
CTCTTCCTCCCCCGATTCCGCACGGATACAGAGCGCGGCTAGAGCTGCTGTCATTGGTTG
GTTCCAACTTCGCCCGCCCCTCTGCCTTCTCCTCCTTCCGTCCCCTCCCGCATGTGCGCT
CGGGCTAGCGCATGCGCAGAGGCGGACGCTCCCGACCCCCGCCGGGGGTGACTGAGGACT
CCCGCGCGCGGGCTCTCTCGGCCCCACCCTCCCTTTCCCCCGGGCCGTTCGGAGAGCGGG
GGCGAGAATGAAAGTTCCAGAACGCTGGGGTGAGTGCGTCATCGCGAGGCGGGGCGGGAT
GGGGCGAGGCCGGAGGTAGAGTCGGTCAGTCATTGGGGCTTGGAGAGGTAGCCGCGCGCT
CATTGGTCGAGGGCGCCATGACGGGCAGCCGGCAGGGGCGGGCCCCTTCTGGAAGGTTCT
GAGGTAGGGTATAAGAGACAGGGTGGCGGCCGGAATCCGGTCTCATTGAACGCGGCTGCA
GCTTTCTAGGTTCGCGTCGTTTTCGCAGCCTGAGCCGGTCTACGCTCAAGGTAAGGCCTC
TGACCTCAAAAGACCTAGTGGGTAGTGAGAAGAGCGTGCGGCCTGGGGCGGCCGGGTGGT
CTGGGGTTCCAGAGCGTGTCTCGTAGGCGGCGTGCGGGGAGCCGTCTGTAAGGTTTATTC
CAGACGTGAGGCGGCCGCTGTGGCTGCTGTCGGGACGAGGACGTGAAGGGCTGGCAGGGC
GGCGCCCGCGGGGACGTGGAGGGAGCCGCATCCGCTTTCGGGGTGCGGGAAGTGGAGCTC
GCGCCTTAGAGCTGTCCGTTTCGGGCTGCTCCAGGCTGCCGCTTTGTAGCTAATCCTTAA
AGGAGGAAACCAGCCTTGGCATGCGCCCAAGGTGGGGGAGGGGGCTTCGGAGCACTGCGA
GGCCGGCGGCGTCCTGGTGCTCCTGGACTGCCGGTGTGGGGAAAGGAGGGATGAGGTTCA
GCTCGGAGCTTGGTACCACGTGCTCCAGAATGTCGCAGACCCTCCGGGCAGGTGCTGGCT
CCAGCCAGGGGCGGGCTCTTCTGCGTTGGCACGGCAACCTCGCTGCAGCATTGCTGCTCG
AACCTTCCCGCGTGGTTATCTTGGACACGGGCAGTGTTTCTGAGGGAGGTGCCAGGTGTA
GTTTTATTTGCCACGGTGATCGTACGTGATAGCCTGACTTGGGTAAACATTTCTGTCGCT
TAATTGGTTTTACAAACCACGGGCTTTTTTTTTCCTCGCCAGCAACCATGTCTAAGGGAC
CTGCAGTTGGCATTGATCTTGGCACCACCTACTCGTGTGTGGGTGTTTTCCAGCATGGAA
AAGTGGAAATAATAGCCAATGATCAAGGAAACCGAACCACCCCGAGCTATGTCGCTTTTA
CTGACACGGAACGATTGATCGGTGATGCCGCAAAGAACCAAGTTGCAATGAACCCGACCA
ACACGGTTTTTGGTGAGCCACTGATTTTAAATACCACAGCATACGTTTCAGGGGTTTAGG
CAGCATGTAATTTGAGAGACTCGGAGAAATTTGTCAAATAAGAGGCAGCCGTGAAATCCC
TGAGAACAGGGAAAGCTAATTTTAAGTCTTGAATGATTATCATCTTGTAACTGTTCAGGA
TAGAAAGCTGAGATATTTAGTAGCAGCGAGAAAAAACTTGGATGAACTTTTGGCTGTATA
GGAGTTAAATCTGTTTACTGCTGTGGAGTGTAAGGTAATTCGAGGTAACAAGCTATTTGC
ATTTGATAACTGTTTACAGATGCCAAACGTCTGATTGGACGTAGATTTGATGATGCTGTT
GTCCAGTCTGATATGAAGCATTGGCCCTTCATGGTGGTGAATGATGCAGGCAGGCCCAAG
GTCCAAGTAGAATACAAGGGAGAGACAAAAAGTTTCTATCCAGAGGAGGTGTCGTCTATG
GTTTTGACAAAGATGAAGGAAATCGCAGAAGCCTACCTTGGGAAGGTGAGTAATGCACAG
TATTAACAGGCAGAGGACATAGCTGGAGGTTGCAACGTTAGGCACCAGGTTCCCTGAGGA
ATAAAGTTGGGGTTTTGGCTGGCAGAGAATACACAGTACTTAGCTGTCAAACTAGGTGAT
AACGTTTTTCAGAACGTTTCCGTAATTTGGTGCTGTAACTTGAGTGCATGCCCAAGTAGA
CAAATGTGATTGTGGGACTATTTTATGAACCAGCTGCAATGTTTTGGCTTTAATCTTTTC
GATTTTTATTCCCAGACTGTTACCAATGCTGTTGTCACAGTACCTGCTTACTTTAATGAC
TCTCAGCGTCAGGCTACCAAAGATGCTGGAACTATTGCTGGTCTCAATGTACTTAGAATC
ATCAATGAGCCAACTGCTGCTGCTATTGCTTACGGTTTAGACAAAAAGGTATGTACTATC
TGTAATACGTGAGTTATTTGAAGATTGATTTGAGCTGTCAGGTTTAGGTAATAAGGTAAT
TTCTGCTTGAACTGCAGGTTGGAGCTGAGAGAAACGTACTGATCTTTGACTTAGGAGGTG
GCACTTTTGATGTGTCAATCCTCACTATTGAAGATGGAATCTTTGAGGTCAAATCTACAG
CTGGAGACACCCACTTAGGTGGAGAAGACTTTGACAACCGAATGGTCAACCATTTTATCG
CAGAATTCAAGCGCAAGCATAAGAAGGACATCAGTGAGAACAAGAGGGCCGTCCGACGCC
TGCGCACTGCTTGTGAACGTGCTAAGCGTACTCTCTCTTCTAGCACCCAGGCCAGTATTG
AGATTGATTCACTCTATGAAGGAATCGACTTCTATACCTCTATTACCCGTGCCCGATTTG
AAGAATTGAATGCTGACCTGTTCCGTGGCACCCTGGACCCTGTAGAGAAAGCCCTTCGGG
ATGCCAAGCTGGACAAGTCCCAGATTCATGATATTGTCCTAGTGGGTGGTTCTACCCGCA
TCCCCAAGATTCAGAAACTTCTACAGGACTTCTTCAATGGAAAAGAACTGAATAAGAGCA
TCAACCCTGATGAGGCTGTTGCTTATGGTGCAGGTAATAACCCTACTATAAATGGTTCAA
ACAGGTGGCCTAAGAGGCCCAAGCTAACTCACTCGCTGTGATGAATGATTCTTAAACATT
CGTAGTTTCCACCAAAAGCTTAGCTAATGATGGCCCAACTTCCTTGGATGTCTGAGCGAT
TGAGATTTCTTAATGAGACGACATGAGTTGTATTGCATTTTTTTTACACTAATGTTTTTT
TAATCTAGCTGTCCAGGCAGCCATCCTATCTGGAGACAAGTCTGAAAATGTTCAAGATTT
GCTGCTGTTGGATGTCACTCCTCTTTCCCTTGGCATTGAAACTGCTGGTGGAGTCATGAC
TGTGCTCATAAAGCGCAACACTACGATTCCTACCAAGCAGACACAAACCTTCACTACCTA
CTCTGACAACCAGCCTGGTGTGCTCATTCAGGTATGTTTCTGTATTTTCTTGGGCTGGCT
TACTGAGATCCTGTAGAACTTGGGGAAGACTTCTCCCGCTGTGATGATGGATTCCAAAAC
CATTCGTAGTTTCCACCAGAAGTCTTGTGTTGGCCAATTCCTTCCTTGGATGTCTGAGCG
ATCAGTCTTCCCTTATTAGTTCTAGATTTGTGTAAGCTAACCTGGAGATCGTTTGTAATT
GCTTAGTAATTTCTGTTCTCTTCTAAGGTTTATGAAGGTGAGCGTGCCATGACCAAGGAT
AACAATCTGCTTGGCAAGTTTGAACTCACAGGCATACCTCCAGCCCCTCGTGGTGTTCCT
CAGATTGAAGTCACTTTTGATATTGATGCCAATGGCATTCTCAATGTCTCTGCTGTGGAC
AAGAGTACAGGGAAAGAAAACAAGATCACCATCACTAACGACAAGGGTAAGTTTGGCACA
TTTGAGTGGCACTGTCATCTGGTCTTAAAGATTTGTGATTTGGTGTAGTAATAACTGTTT
TTCAAGTGTCTCTACTGCCTAAAAGCATTTAATCTAGAGCTCCCTGATCACTCTTAATTG
CTAAAGGAGCTGCAGAGTGGTAATTGGTCACAGACGTGGATAACTCAACGTTCAGTCTTA
AAGCTATGCCTAAAACATGTTGATTGACCTCACAGGTCGTTTGAGCAAGGAAGACATAGA
GCGCATGGTCCAGGAGGCTGAGAAGTACAAGGCTGAAGATGAAAAGCAGCGGGACAAGGT
GTCTTCTAAGAATTCACTTGAGTCCTATGCATTCAACATGAAAGCAACTGTTGAAGATGA
AAAACTTCAAGGCAAGATCAATGACGAGGACAAACAGAAGATTCTTGACAAGTGCAATGA
AATCATCAACTGGCTTGACAAGAACCAGGTTTGTAGTTTGTTGGTAAATTGAGGGTGGTG
TGGATGTAAGGGCTTAGGCACAAGCTTAGATGGGTTTAAAAACTTAAAAGGTCACAGTGA
TGAATGGTCCAAACATTCGCGGTTTCCACCAGAATAACAAATGTTGGCAGCTAGCTTCCT
TCCTTGGATGTCTGAGTGACCCAAGATTTCATATACAGCTAAGTCTTTAATGTGACAGTA
GGCTGCTTCTGTGTCTGGTATCTTTTAACATTAGATTGCGTTAGGCTTAAGGAGTAATAC
TATTTTTTTCTCTCCTCAGACTGCAGAGAAGGAAGAATTTGAACATCAGCAGAAAGAGCT
GGAGAAAGTTTGCAACCCCATCATTACCAAGCTGTACCAGAGTGCAGGAGGCATGCCAGG
AGGAATGCCTGGGGGTTTCCCTGGTGGTGGAGCTCCTCCATCTGGTGGTGCCTCCTCTGG
ACCCACCATTGAAGAGGTGGATTAAGCCAACCCGAGCATAGATTTAGCATTGTTCCACAT
AAAACAATTGAAGGACCCAAATTTGTAGCAAATTCCATGGCAGTTTTAAAGTTGAGCTGC
TATAATAAATAACTGGGCATTCTTGATACTTGAATATGGAATATATGCACAGGGAAAGGA
AAATAACATTGCACTTTATAGGCACTGTATTGTAAGTGGAAAATGCAATGTCTTAAATAA
AACTGTATTTAAAATTGGCACCCTACAGTTGTCTGGCTCCATATTTGCAAGGGCAACAGG
CAACATTGGTTTTAGGGGTTGGATTCCATTTCTTTCTGGCCTAGGTGTTAATGAATCACT
GTATCTAGGTGGTTAAATACAGATTGTTCAACTTCAGGAAAATGTGTAAGGAAGATTTTT
GAATTAGGGTAAGTGGGAGAACTTGGAGTTTTGGCGTTGTGTCAGTAGCTAGGCTCATAA
TTAACTATAGTAACATGTAGTCCAAACTCCTTTTGGAGTTTGTGCTGCAGATACCAGTAA
TCATGCTTTCCAGTGTGGGATAAGCTGTTGATGGGTAAGAAGTGTTGGAAAAATTAGAAG
GGAGAAATCTCAAATATTAGAGTATTTTGTGTGATTCACCAATTCTGAAGTTAACCTTTT
GAGGGCTCAAAGTTAGAGGACAAAGCCAATTTGAACAGGGAGTAGCCAGTGAGAACTGGG
GGGGAAATGGAGTAAAAAGGTGACTGTTGTGGGGTGTCTCTTCTGAAACTGTTTTCTGTG
AGCACAGTTTTTCACTGTTCTCGGCATGAGTCCTAAGGGCTGACAGGTAACTTGGAGAAC
TGGCTGTGAAGTTGACATGGTAAAGGGTCCTTTGCTCACCTTAGAAGCAAAACTTGGAAA
AGGAAGGGCATTGGGCATCTAGTTCTGATCTCATCTGACTGAATCACAGCCTATGTAATC
ATGTGAAAGGCTAGAAAGGCAGAAACTGATTATGAATAGTTCTTTTTAACAAATTTGTTC
TAATTACATAGGACTGCCTTTAGGTAAGCTTGCCTTCAAAGGTCTGTATTTGCTTGAGTG
GGTCTTTGTTCATTGGGTTAGCAATGTGTTAGCAGTGAACTTGAGTTCAGAATCAAGTCT
AAAACACAGGAAATGCTGTTGGGCAACAAGCCAAAAGTATGCCAGCTTAAAATCTGAATC
ATGTAAAATCACTTGTGCGAGTCACATAACCCTGATAGCCCTCTTGTTTCCTCGAGGCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1069, 1782..1991, 2299..2504, 2775..2927, 3017..3572, 3788..3990, 4227..4425, 4655..4887, 5179..5598
1784..1991, 2299..2504, 2775..2927, 3017..3572, 3788..3990, 4227..4425, 4655..4887, 5179..5361
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved