Equus_caballus Locus ELMOD1
snOPY snoRNA Orthological Gene Database
Equus_caballus ELMOD1
Equus_caballus
ELMOD1
7
SNORD77
1666..1733
30738
AAGAGAAGATGAGTTGAAAATAAGTTCCTGGATGATAAGTCCTCTTTACTTCTATAGCT
TGAGTCATTTTGAGACTCTGAGCAGGACTGTGAAGCAGTAGGCACTCACATATTAAAAAC
TAAAAGTCAGCATAAAACACAAATTCTCATGTGCCAGAGATATCGTGAATAAGTGCATAA
TTGATGACAATATACTTCATAGCTTGTTGAGGTACTATTGGAGTAAGATAGGGTGTGCAA
TAAAGAAAAATTTGTTTGGCAAGAGCCAGGAACAAACTTGTCAAGAGGTAGGAGTTTGGG
GAAGGCTTAAATCAGAGAACGTTGGGGAACCAAAGGTCAATGTGCTTTGTTCAGTGAACT
GAGGGGGAGGCCTCTGGCAAGTCCAAGAAGTGTTGGGATTGGTCAGCAGAGAAGACAGGT
GGCCATACAACCAAGTCCTTAGGGAGGACAACAGTGCCTGAAGGAAAGCAGAGGGAAGGA
GGAAAGAATGGAAACAAGGGAAGAAATAAAATAGTGGCCCAAAAAAAGGCACTGAGGAGG
GGCTGGTAATGAACCAGAGTGAGCTGAGAAGCTGTCCTCAGAGGCAGAAGATGAGAGTTG
CCATAACACGTTCTTTCCCCCATGTCTAAGGGTGAGACAACTCCTAAAACACAAAGATTC
TCTTTTCAAGGTACTGATTTCTTTTCAAAATGTTTTTAGGCAAAGGGAAGAAAAGAGAGG
ATTCCCGTGCTTCATCCTCAGTTTGTTGGAATATCAAATTTGTTAGCACAGGGTATTCTG
GAGTTGCTTGCAGTCATAGTAAGAGCGTCTTCACAGACCTTGGGCTTCCCTCTCAATGAT
GGGTTGTGTAGCTACCAGAAATAAAATAACATGGGATTAGAAAAATGAAATATGCTTGTA
AACCCAGGAGTCTAATGGTTGCTTTTCTTGTGGGGTTCTTTTCTTGCTGGTGGTGGCTGC
TTTCTCTTCCCTTCCAGAGTTCTATTGGAAGGGTGCTGTCTTTTGTTTTTGACAGAATGT
TGATCCAAGTGTGCCTATATTTTTACTGCACATTTTTGTGGCGCTGCCTGAAATTTGTAA
TGAGGAAGCTGACTGGAAGATGTGAACTGCAACGGATCTGTTACAATACCAAGCCTGGAG
CTTCTAGAACCATGAAAATCGGTAAGCGTGAAACAAAGAAGTAAGCAAAATGCAAGCTTG
CTGGGATGGAGGATACAGTGTTATATTTCACTATAGTAATTTTAAACAACTCATAAAGGA
TAATTTTTGCATGACTTTTTTTATTCTCTGTTTTACAGAAACATCACTGAGGGATTCAAA
AAGTAAGGTAAGTGAGATCATTTCTATATTTTTCAGCAACTTTTCACCTAGAGGCTTACC
TCCATCATCAAAAGTAAAAATTTTAAGAAATATACCATTGGCCCTACAAACTGAGAAGAA
AGAAGCGTTTGCCCATCACAAACCACTGTACTTTTGACATGAGAGCAGCCACTGTATGTG
AATTTCTAGGCAGATTTATGAAGCACTTATTACTTCATTGTTGGATTAATCTTCTTTATA
CCTCTTTCCAAATCATAAAATACATATTCCTTGAAAATACATACATCATTAACTCTGGTA
TTTCCTTCAATATCCAAATCATTTAACTTTATACTCAAGATTTTCCATACTATGATGGTT
GCTGAGTTCAGCAGATTGAATCGTGAAGAAATATACCATTTGTCTAATGTATCTGAGAAA
AAAAATATTTTCCAAGAAAACCAAAGAAGCCACCATGCGAGCTTTTATAGCACATAGTTA
AGCATCCACATAAGAAAGAAAATCTGTTTTCTTTTTCAAGATTCTTTATAATTCTATATT
GTTATTTAATTTTAGCATCCTTAAGACTAATCTCCCCTAAGTACTTCACTCTTTAATCAT
ATACATGATGCCCATTAACCATGGAAGTCATATTGTTTGGGAAAAAAGAAAATATTTCAA
CGTAAGTAGCTTGAAACAGATGGAAGAGGTTAGAAAAATCATATGTATTTGTGTTTTTAT
GTTAATTACCTTAATCGGGAAAATTGCACTACCCCCATTGTGAAAATGTCAAATTTACTA
GAATTCCAAAACTAAATCAATTTTTGCTTTTAGTTTAGGTTAGTATCTTCCTATAGAAGC
TTTAACCAAATACTTGAAACCCCTGTCTAAGTAGACCCTGCTTAAGCCACTGGTGCTCGT
GACAAGGGGACTGACTGAAAAATGTTTTCCAGCTGTTGCAGACTTCAGTGAGCGTCCACC
CTGATGCTATTGAAAAAACCATAGACGACATCATGGAACTGAAAAAAATTAACCCCGACA
TAAACCCACAGTAAGAATTTATTTTGTTGAAAATATAGAACACAAGTCACATGGCCACAT
GTGTAGTGGTTCTATAGCACTCATTTGAGTGTGCTCTCAATCTCTTTCTCTCTCTTTCAT
TCTCTCTCCCTCTCCCCAGCTCCCCCTTCCCCCCTAAAACAATCGTCTGCCATGTTTTGA
CTTTCAGATGAAGGATAAAAGAGAAAAGGGGCCTTTTTCATGTTTGTAAATGGCAGCAAC
TCTGTACCTTGGTTGTGATTTATGCAGGTGCTTCTGAGATACAATGAATGCAAGAAATCT
GATGGATGCCCCTGATATCGGAAGATGAAATAAAGGGGAACCATTCATCGACAGTTGCTC
TATGTGCTGCCTATGTTTTACATTAACAGTAAATGTTCAAATCGTAAATGTGCTGGAGCT
GATTCTGCTCCATCAAAAATATTCCTTCGGTTCATGACAGGCTGATAATCTTGGAGACAG
TTCCTACCTGCTTGTCAAGAAGACAGGCATGTGTGTGGGAGAGATGGTTTTTGTACAAGG
ACTTTAGAACTTTGTAATTTAGTCATCTCGTCTTGGAAGTATTAAAATACATTTGGCAAC
GTACATGATGTTTAAAATTTAGCTTTATATTTTCCATTGAGCACAGGAATTTTTCAGTAA
AACTTTGGGCTAAGGATATTGGATAGAATAAATTCTGCATGCAGAGATATTTAGCGACAG
TTTAGGTAGGTAACAATCAAACTGTCTTCTAGATAGATGTGCATACACGGGAATCTCAAA
TGTTGTCGCTGAGAAATGCTTTTAATTGCCGAAGACTGGGAGCCATTGTTGAGGGGAATT
TCAGATTGCACCTTGTATAGGTCTGTCTCTTGGAGAGATTTTAGGGACTAGCTAATTGGG
GCTCATCACAAAACTCCATTTCCACGTGGTTGCCATAGCATCCTTCTGCAGCCACTTCAG
CTAATTAGCTCCCTTTTCCTTATTCAGCCATTGAAGGTTGATTTAATTATGCAATAAATG
TCTTTTTGAAACCTTGTGACATATATTTTACTCCTCTGGGAAGGTGATAAGAAGACAATT
CATTTTAAATTACGTTGAACCAAAAATTTAAGACTACAATTGGGCATGAGGAATATATTA
GTCCTATAATCATATTTACAGATTATGATTTAATAGCACATCTTTTCTATGTCAGTTTTA
TGTTTCATTCAAAAGCATTTCCTCGCTATCTATTTTTTTGATTTCCTTTACGGGGAAAAA
TCCTTGTATGTAGTAAATTGTGTTTTTATATCTCAATATGGATTCTAGTGCTTTTTACCA
GATTAACGTTGACAAAATGTGATTTTTAAAAAATTAAATGATTTTCTGAAAAAGAAACAA
GAAATAGGAGGGAGGGCTGGGGGAAATATTCTATAATTTATCAAGCCATTACTACTATTA
ACCTCACTTTAATTATGTTTTTTTCAATTACAATTAATTACATTTTTTCTCTTCTCAGTC
CTGCGTTGATTTTCCAGGTGGTCAGTGGCACTGTCCCCTTTTCCTAAATTTAAATATCTT
ATTTAGTCCTCTGATGCTATAGTCACAAGTAATTATAAAGGCCATTTATGGAATATTCAG
TTTTATTAAGTTCAGTCTTCTGGATTATTGGACACTGCCCTCTATGTTTGGAATAAGTAT
ACAATCCTAAGACTTGTAATTCTCTATTGTCCCTAACTTTAGATTTCACCTCTATACATC
TCATTCACCCCCAAAAAAGAAGATTATGATGACACCATCATCACGATTATAATGACCACT
GCAACAACAACAAAACTTTAGTGAATAAATTAGGAGTAGGAGTATATTGGACAGTAATTC
TTGGGTTGAATCATGTGAAACTGCTTATGTTCAACCATTTCTGAACCACAAAAGAACTTA
GCGGGAATAAATAAACATGAAATGCCACCTTTAGATTTAAAAATGCCATAACACAAGTAG
AGGAGAGTAATTTACATGACAGTAGTTTATGTGAAAAAGGATCCTGGTGATTATTTACCC
ACCTGTTTAATAAAGTTGTAATGACTGCTGAAAGAGACTCTAGTTTACCTTCTACATTGT
AGGAGAGAAAAAGAGCATTCAGATCACAGGAAGTAATGTGCCAGATTGTTCTCTGTTCTG
GTGATAAGTTTTAAGGGGGCTATTAATCAAACAGTGTACATTCAGAGCAGACTCAGCAAG
ACAGTAAAACATCTGAAAACCGTGTCCCATGAGAGGGAATTGAAGGAATGAGGGATTTTT
TTTTTTTACCCTGGGGATGAGACTAGAAGAAAGAATTGCTATCTTAAAATAAATAGGCAT
GGTAGGGAAAAAATGGAAATAAATTTGCTCAGAGAACAGAATTTGAACCACTTGGTAATA
AGGAAAGCAGATTTTGTTTCAGCCTCAAGAAAAACACTCGGACAACTAGAGCAGTTGGAA
TGAAAAGGAAATTTTGTAAAGTAGTGAGTTCTTTCTCTTGGCAGTGCCTCAGTCTATTAG
GGATGCTCCTAAGCAGAGGTGTTTTTGTTGTCGTTATTGTTTTGTTTTGCTTTGAAAATT
TTTCTTATCCCTAAGCCCCTGAGGGCTTTCTCTCTCTGTCTCTCTCTTTTTTTCTGTCTC
TCTCTTTCTCCTCCTCCCACCCCTGCCACACACACCTCTTTGAGGTGTTTCTAATATACC
CACCTGGGGGGACTAAATGATCCCTTAAGAACCCATTATCACCTTTATTTTCTACATCTT
TCTTTCAAGTTGCCTGCATAATGAGCTCCCTTGTTTTTTTAAACCATATTGTTGCAACTG
GACTTAAGAAAAGGCCAGAATGAGAGGTAAATTTAACCAAGTCCCAGAACTATCCATGTG
GCACTTCAGTAAGAAATTGTGCTTCTGTTAAATAGATCCAATTTGAGCAATTTCCTAAAT
ATTAAATAAAATGAAAAGTCATATTGTGCATACATCAAGTGAACAAACACCAAAGTGTAT
TTTCTGTTTTTCCTCATGTATTTCTCTTTTTGAACACCTTAGGCTGGGAATCTCTCTTCA
GGCTTGCCTTCTGCAAATCGTTGGGTACAGGAACCTTATTGCAGATGTGGAAAAACTACG
CAGAGAACCCTATGATTCTGATAATCCTCAACATGAAGAAATGCTTTTGAAGGTTAGTCC
TTAAGCACAGTTCAGTCCTTCACTTAGGTCAGCTGATGTTTGCCAAGTGCCTACTGTGTG
CTAGGCCCTGCTCTGGACGTGGGGGAACAAAGATGAGTAAGACGTGGGCACTGAACTGTT
GGTAAAGGCTACTTTTCTTGCTGGTTCAACTGTTGGAGGCAAATTCTTCATTAGAAGGTT
CACATGAGAGCTTAAATATAAGTTTTTTAATCTGAAAAAGCGTCAGATTTCTCTGGGCTC
TCACATTTGACTCAAGTTTAGCTTGTTTAACTGTGTTGAAAGCCAATAGGAGTAATAGCA
TTTGTCAAAGACTGACCTGGGATTTCCTTTTATGACTTTTAATAGACATCAAAGAAGATG
AAGTTGGTTTCTGCTTCAGCAATAGCCCTCTTGGGAAATTACCCAAGATCTTAATGCTGA
TTATTTATTTATGTAACTTGGAGAGTATTAGAAGAAGAGGTAAAGGTTTATATCTGGTGT
ATTGAAACCATTGGAAGAATAACATGCAGTTATAAATACTCCTTCCAGCTGTCAAAGCAA
AACCTTAAAAGGCTCGTAGGATCTGATGGTGTATTATGAAACATCAATAAAACTTTACCT
CAAAACACTGAATTTTGAGTTAAAAAAAATTCAGACCAAAAAAATTAAGACCAAGCTTTA
TAACTACTCATCTGAAATATTTTCTAAATTGATTTCTGAAAATAGATGCTTTTTAGGATG
GCGTGCTTCCTTGTCCTTTCCTAGGATTCAAAAAGGCAGAAAGAAAATTGGAAGAAAACA
TTTGTTTGGCTGCCTTAACTTTATTTTATTGAAAAATATCAATAGAGGGTGTAATTTTAA
CAATGTAGCCCGTTATATTTTTGTGTGAAGGAGTGTGTGTTTTTGTGTATGTAAGTACTT
AAGCAGATGACTCATTTGTCACTACTAATTAGTGCTAGATCTTTGTGAATCATTAAAAAT
TAAAGGAGCCTCATTCATAGCAATAGTTTTTCTTCTTCCCTCTCGCCTCTGCTTAACTTT
AGCCAACCTGCTGGCTGAGCTTCATCTCCTTTTATTGCCTTCTATTTTCTGTTTTCTGAT
AGAGGTAGTCAAACTCAATGCAATGACCTCAAGATGGGAAATAAGAGGTGAATAAAAGAG
AAAAGTGGTATAATGAACAGACTGGCCCCAAGGGCCTGAACAATCCTTTAGAATGGCTCA
GATGCCCTCTGAATCAATGACATTTGGGTACCTGCATTGCACCATCTTAACTGATCTGTT
GAATGTGTGCTGGCACATAGTGGGTTTTCAACAAGTGTGGGCGAATACATGAATTATAGT
AGTTCATTAGATACATGTCAAGAACTTTTATGACATGGCTTTTATCTGTGGTCATGATTT
GAGTATGTATGTGTTATCATTTTTTATTGTCACAGCTATAAGAGGGGGGCAAGATGATGG
TTGTTATCTTTAGTTTAGAGGTGTGCAAACTACAAGCATTTTAGTACAGGCTCTGATTCA
CACAGCTAGTAAATGATAAAGCCAGGACTGTCGACCACTGCCTTAGGCCCTTTGAGGAAA
GGCATCTTTTCCACCTGCAAGTGGCTTGCAATCTGATTGGGGAGATACTCTGCATCTACA
AACATCACTGAATCTTACCCATAGAGCCCCCCCCAAAATACCTCTCGTATGTTTTCCATG
CCTACTACCTTATTCTAACCATCATCTCCAACTTGAGCTATTAAAATAGCCTTTTAATTC
CACCACTAACCATTAGCTTCCTCCCTTCCATCTTCTCAAACACTGCTGGAGGGACTACCT
AGTCATGTTATTAGTCTCTAGATTAAAAACTTCAGGGTCCCTAATGTCTGATTGTAGGAA
GCCCACGCAGCTTAGCCTGCATTTTGGACCCTTTCCAATTTATTCCTTTAGACTCTGTCT
CCTGGACCTCCATTACGTATAGCACATTTCCACCATGCTGTCATTCATCCTGACCCAGAA
TAGGCCATGCCATCCCCTAGGCCCAGGTATTTGCTCCTGCTCATCGCTCTGTTAGCACTA
TTCTCACAGCAGAAGCTGGCTCACTTTTTTGAATCCTTATTCATTGAATTTTGAAATCTT
CTACTAGTCTCCCCAAGCAAACTTAGGAACTTAAGAGTGGGGTCTTGATTCTCCTCTTCA
GTTTATTCAAAGTCCAAGTATGATAATAATAAAATCAGTAGTAATGAAACATTCATTGAA
TGTTTAATATGTGCCAATCATCACAGTAAGTATTTTATAGCATTATTTCATTTGTTGTCA
CAAGAACCTTGAGGTGAGACTTTGGCATTATTCCCACTTTTCAGATGAGGAAACTGAGGC
TGGGCAGTTAAATGACTGCCCAGGTGATTAGAAAGGGCTCTGACCTGGTGCCCTGCACTA
CCTCATGTCTTGCTCACATTTGTGTTTCCAGGGGCTGGCCCGTGGTTTGTTTAACTGCCT
CAGCTTAGGCTGCTTCATCTTTAAAATGGGTAATAACACTCTTGGTACCACTGACTTCAT
AAAAATGTTTAGAGCAAGGGTCAGCAAACTAAAACCTGTGGTCCCAATCTGGCCAGGACC
CATTTTTGTAAGCAAAGTTTTGTTGGACACATCCATTCATTCATTTAGGTATTGTTTGTG
GCTGTTTTTGTACTACGATGGCAAAATTAAATAGTTGCAGTAATGACTGTATGGCCACCA
AAGCCTAAATATTTACTATCTGGCCCTTTACAAAGTCTGCCGACTCTTGGTTTAGAGGCT
TGGGTAATATATTGCCACATTGTTTAAGTGCTTTGATTTATAGTTTATATAAATAAATAT
ATGTTTATTTTTATATTTTATACAAAAAGTCTATAATTTATAGAAACACAGGATCAGTGT
TTCTACTTAAAGTCTTAGAGGATAAAAAATCTGGATTTTTTTCTTTTAATTTTTTCTTCT
TCTCCCCAAAACCGCCCCCATACCTAGTTGTATATTCTAGTTGTGGGTCCTTTTAGTTGT
GGCATGTGGGACAGCACCTCAGCATGGCTTGATGAGCGGTTCTAGGTCTGCACCCAGGTT
CTGAACCAGTGAAACCCTGGGCCGCCAAAGCCAAGTGCGCAAACGTAACCACTTGGCCAC
GAGGCTGGCCCCAAAAATCTGGATTTTATAATCATTTAAATATAGACTGGGATGAAACTG
TATAACATGTAGCACTGTCCATATGAGTTATTCAAATGCACATTTCTATTAAATGTTTCT
AACCAAATTAATAATAAAGGCAAAATTTTAGGTGGATTCATACACTTAATAGAAAAAATA
TAACCCAGAATTATAAAGTCTTCTCCTGATAGGAAGAGACAGTTCCATGGTGGCCTCAGA
GAGAAACTGCTTCTCCTCGAATGAATGATAGACAGATGGCCTTGCCCGTTCTGTTCTGCT
ACAGACCTGAGGCAAGGCAAATAAGCTTGTGGTAAAGACTGAGTGCAAAGAGAAGAGAAT
TGCACAGAGAGCACAGGCCATGATGGGTGATAGACTGACTCAGAGTGCAGCTTCCACACA
TGTACCTTGTCATCTACCACAGGAATCACCCTTCCTAGCTTTGGTCTCCTGCACTTGGCT
GGTGGCTTTGCCATAACTCTGCTCCCAGTAGCACAGTCTTACATGGCTGCACTCCTGAGA
GCCCCTCCACCAGAGGCCTGCCACTTTAGTTCAGATTTCCAGTCAGCTTCCTACATGCAA
GAAATGACCTCACCCTTCAGGGACACCTGCTTCCCACCCTCTTCCTCCTTTTCAGGAAAG
AGCCTGCCTATCAGAAGAGAATCCAGCGGCTCAAGCGTTCTTACAGGACATAGACACATG
GTGTACTTCATAGAAGTATTTTAGCATAATCGACTTTCATTTTCCAGGAAAGAGACCCTT
ATTAAAGAAGAAAGGATTAAGGATTTAATTAAGAACATGTTTTATCCATTAGTCTAGTCT
GTCATCATACATGAAATTATTAAAATGGAGGGGTTTTTTAAAGCATTTTATTATTCAAAC
TTTTTACCCCACAAACAAAGTATTCCCCTGATGAATGAGGCTTGTAACTTTACCTGTAGA
AATAAAATGCTTGCTTTTGCCATTTTACTCCACTCACTCATGAAACTAGGTATTTTTAAA
CTGTGTAGGACCCTGAGATTACTTAAAAATGTTATTTAAATGAATGTGATGAGCTTTACA
ATCTGTTTCCTTTTGTTTCTTTTTTTTTTTCCATTGTAGCAGTAACCAGATCAGTTCCTA
AAGGATTTTTTAAGTGACCTTTTCTCACATCTTTTAGTACTTTTCTGATGAACTCAGAAA
TTTTCTGTTTCGAGGAATGCAGAGCACTGGCAAATTCTTCTATAAATAATATAAAAAAAA
TTTCTTATACCATTGTTTGATATTTTGCTTTCGCACATGATAGATTTACTTTCTTTCCTC
TGAAATTTTTTCTCACTCTTTAGATTGAATTTACCTGTTGTGAAACTAACATAAAATATT
GTATCATTTGAATAATAGGTAATTTTGGATTAATGCCTAAAATAACTTTCATGAATTACA
ACTCTTTTTTGATTAGTATTTCCTGTCGTTGAACATTATTTTATACTTGTCAGAAATGTG
GCAATTCACTATAAAGCAAGATGTTTGCGTACTACTGTTCTGTTTAAGCTTTGAAATCGT
ATAACATAGAATAAGCACTTTAAAATTTGGATAATGTCTGAAATAGAAACAGGGACATTT
TATGTTTGTATTTGTCAATAATGAAGATATAATATAAAATATTATTTATAGGCTAAAAAG
TAAATTTGCTTTCATGCTTATCATTGTTTATTAGACAGAACTAATGGTTCCAGCATTACG
TATTTATACAACTGTGTGTCTCAACCTTTCTCTCTCTCTCAAGTAATTATATGTGCAGAA
TCTCTCTTCCTGTAGAAAACTTAGAAAAAATAGAACCAGTTTCTTAAGCAGTGAACAGCA
CAGTGTTTAGAATTTATATTTGTAAATTAATATATATAATTGATTGTAATTGAAGTTTTT
TTAGGTAACTCTTAAAGATGATAATATATTTTGAGGTTTATTCATGACCATTATTGCTCT
CACCCCTGGTATAGGTGAGAAATGAAACTCAAGTCAGTTTACTCTTCTTTTTGTTAACAA
TGTTGCTAAAGGTTTTCCTATGTAAGTAGAAAAGCATGTTCTGAGAATTTGAATAACACA
TAGCCTCAATATTTTCTCTTAAAAATATTCTCTTAGGGCCGGCCCAGTGGCGTGGTGGTT
AAGTTCACACGTGCTCTGCTTCAGCAGCCCGGAATTTGTGGGTTTGGATCTCAGGCATGG
ATCTAGCATGGCTCGTCAAGCCACGCTATGGTGGCATCCCACATAAAGTAGAGGAAGATT
GGCACAGATGTTAGCTCAGTGACAATTTTCCTCAAGCAAAAAGAGGAAGATTGACAACAG
ATGTTAGCTCAGGGCCAATCTTCCTCACCAAAAATAAATTCTCTTAAATATTTTTGAGAA
CTCCAAAGAGCTTTTATGGGAGATAATATATATATATATATATTTCTGAGTGGAAATTAA
AACAGAAAGATGTAAAACACCAAAATAGTGCATAGTCCATTGCCTTCAGAGTGATGACAT
CATCACATCATACAGCCTCCAGAAAATTCCACTATATGCTCAACAAGAAGATGAGAATAA
AAAGGCAAATAATATCTTAATTTTATTATGAAACTGTTTTTACCTCACAGACCCTCAGAA
AAGGTCTTAGGGTCCTTCCAAGGAGTCTTCAGACCATACATTGCGAACTGATGTCTTACA
TAATTGAAAGATGATCAAATCTTTAATTGTAATGTATTTACATATATCAGCTTTGCAGAT
CTCCTCTAATAATGTAAAGGAGGAGATTTTTGAGCCAGTAGGAAAGAGTATTTGTGTGTT
TATATCAACAGGCTAATTTTCTTTCTTATCTCCAGTTATGGAAATTCCTGAAGCCCAATA
CTCCTTTGGAATCTCGGATTTCCAAGCAATGGTGTGAAATTGGTTTCCAAGGTGATGATC
CTAAGACAGATTTTCGAGGAATGGGACTCCTGGGACTGTACAACTTGCAGTAAGTAAAAT
GAAGCATGGTTGAGCGTTAAAGTGACGTTCTGGTCTCCTCATATGGAAATGGCAAAGTTG
AGTTATTAGGTCAAAAAGCCACTTCCCAGAGGACTCCAAGAAAATGCTCCAGTCCTCTGA
GAGAGAACTCAGGTTTGCAGAATTAAAAAGCTACTACCATCTTTCCTTTCTTTGACAAAC
ATCATGATTTTTTAAAGCAAATCGCAAATGGTTTTATTTTTCATTTTTTATTATGAAAAA
TTTCAAGTTCTTCAAATAAAGAGGGAAGATTGTAAAGAACTCTCCTTATACTGATCGCCC
AGATTCAGTCATTATTGAGGTTTTGAAATACCTGCAATGCTCGTTTTTTTTGGCGGGTGT
GTTAATGAAAATCCTATACTATTTGTCATTTCACCCTCATATTTCAATATGTGGCTCTAA
AAAAAATCAGTATTACCTTACATTAACCACAATGCCATTATCACATCTGACAAAATTAAC
AATGATTCCTTGGTGTCATGTATATCCAGTCCATGTGAAAATTTCCCAGTTCTCTCAAAA
ATGTCTTTTTATAGCTTTTTTGTTCTAATTCAGTTCCATACAAGATCTACACGTTGCAGT
TAGTTATTGTGTCTCTCCCCTCTGCCCTGACCTTTTGTCCCCTCCCCAGTGTCATTAACC
TGTGCAAGATTCCAGGTCAGCTGTCCTCTAAAGTGCCCCATGGTCTGGATTTTCTGTTTG
CATTTGTACCCATTCCCTGTATGTCCTGAAAATTGGAGGTATTTGGAAAGGCTTGAGTAG
GTTCAGGTTGACATCACGGGGGGAGGCCTGTGGTGTCCCCACTCCCAGTCCTACGCTGAG
ATGGATCAGAGGATCCACAGCCTGTAAAATCCGTTGCAAAATCCCCCATCAGCCTTTTAT
CTAATCATTTCGTCCTTCTATGATCTTCATTCAACCAATTAATTAATTATGCGAAAAGTG
CCCTTCTAATTCTGTTATTCTTCCCACAACTTTTGGCTGGAATTCTGTAAAGACTCATTT
TCCTTCATCAACTATGGTAATTTGGTTTCTCTAAAATATAGGCAGGACAGATGCTCAATT
TTTCTATTTAGTTGCCAGTTTTCAGAGTGAGGAATTGGTGTCCTAGTTCCCTTGTTAGTG
ACCAAAAAAACCTTTTTTTGCTTTATGTCTGTATTTTTTAAATATCATTTGTAACTACTG
GTTTTTATATGCTGGTTGTGATTCAACTAATTGTGCTTCTTATTTTCTTCACACTTAAGT
TGAGTCACATGTAGCTATTATTTTTCAAGCCAAAGGGAGTCCTTTTAAGTTGCTTCTTGT
GTCCTTTAACATCATCCTATTAGTGAGGATAGTGGTGTATTTTTAAAAGAAATTAAGCCT
TACTCAGTCATTTTTGATGGCACCCCATTTTTTCCATGTATCTATGCCTTTATTTTAAAT
TTAGGAAGTTTAATCTTTTATGAAATGTTTTAAATGCCACATTATTAAGTAATGTGAATG
AATAAAAAGTAAATTTTGATAACAGATGTGGTGTTACAAATAAGTGGGTAAAGGATGAGC
TTCTGAATATGTAGAACTGGGACACTTGGCCTTCCATTTAGAAAAAAATAAAATTAAATC
TGCACCTCACCTCAATTCGCAAATTGAATGTCAAAAACAAGTCTTTACAACTTTTAGGAG
ACAATCTTTCAGATATGTGTATAAAGAGGTCTCTCTTAAAGACGGACCAAAAAAAGCATA
AACTAGAAAAATCAATAAATTTCACACATTAAAATAGAAAACTTTTGTAGGATAAGCCAC
CATAAACAAAGTGAAAAGATAAGCCAAGACTTGCACTAATATAAATGATAAAGGATCCAT
ATCCAGGATATTATTCTCTATCTGGTTATTTATCTCATTTATTTGAGACATTTTTAGATA
CACTGGACCAAGAAATTTGAACAGACAAGATATAAAAGAGGAAACCAGGATGACCAACAG
CAGTACGAAAATAGACTCAATTTTATTAATAATCATGGACATATGTGTTCAAATTGCTGA
CTTTGGTTTGAGATTTTCTGAGAGAAAATTCAAGAGCTTGTTTATGGTTTAGATTTATGC
AAGAAATTTATATACATCAAGTTAAGTAATATATGCTATAATTTTACTTTATAATTCTTT
ATGAAGCACTTTTTACGATGTGTTTTTGAGAGTATGTAAGCTTTTTGTGTTTATTAGGAA
GCTTCACTGTGCCTTTCTCCCCAGAACAGAATTTTATTTTTAACATCCCTAAACTTTATA
AGATATTTTCCGTTGATGCAGAATTCAAATACTGGATGGATATGCTCAAAGAAAAATGCA
TTTGAAACGCATCCTCTCTCTCTTCCTCTAATCTCTTTGGCTCTCGGCAACTTGGGCTGT
CACAGCCCCTCACCATGTCCCTTTCATCCAGGCTTCTGCCTTCAGAGGGGCCTCAACGAC
CCCCCCATCTATATCCCTTCTTTTTTTTTTTAATTTTATTGAGGTCATATTGGCTTATAA
CATTGTGTAATTTCGGATGTACATTATTATATTTCAGTTTCTGTATAGACTGCATTGTGC
TCACCACCAATAGTCTAGTTTTTATCTGTCACCATACATATGTGCCCCTTTACCCGATCG
ACCCACCCCCCAGCACGTTCTTCACTGTGTCCCTCTTGCCTGTCTGCTCTCTAGATGGGA
CCAGAACTCCGCTGAGCTGGCAGATTCTAGAGTTATATTTTAGGCCGCCATTCTTGCTTT
GACCCCAAGGCCAGAGACGGGCTGTTCCTCATAGCACCTGAGTGAGTGATTGTGGCATCA
GAAATCACTTGCTTTCTCATAGACCTCAAGGATGGGACTGTTCCTCCCAAGATTCTGTTA
TTTTCAATAGTCCATGCGAAAAGGTCTCTCTCATCTGGGCTAGTGGGACTAGTATATAGA
AGTAGTCTCTTTTTGATGTTCGTCTCTAAAATTTGGTACCCAGGAAATCCTTCCCCTTAG
AATGTCATGCAGGCGCATGTTCACTTTTATTAAGCATGCCCACTGATTGAGAGATTNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCTTTCTTTGCT
TTGTGTTTTGTACTTTTATTTTATTTAGAATAAGTGTGAGTAAAAATTTTTAAATAAATA
TAAATTCATGAAAAAGTTTCAAAAAGCAACATTTCCCCAACTTTTTATATGATATAGTTT
TATTATATTTGGGCTGTGTTTTAGTGAAGGAAAAATCAGATTAGACCAACCTGATAGAAA
ATGTCAGAGTCTTTCTACAGCCTTAACTATGCTGGTTGGAGACACATTTTGAACACTTCA
CCTAAAGGCTGATCCCTCATCACGCGTGCTGTGACCCCACCTACTCGCCAGAGAGGGACA
TTTTATTTGGGAAATTTGTTGCACAGAGCAAATTTGCTCTTCTATTAATATATTTCTAAT
TTTATTATTATAAATAGTAGTTATTATATATATACTTTACTCTTATTATAAGGAGTTCTA
CTATTTGCAGTCGTGGTTTTGTCTCACTTTTTTCTCCTCAGCATAGCAAGTTCCTTGTTA
GCACTCATGTTTGCTAAATAAGTCCAAAATTTCATACACTGTTGTTGAAATTCAGAAACA
GGTTGACTTTGGGGCCCCCTCCCACCTTGCTATTTTACTTATTCTAGTTGCTATTGGCTA
AGGTTCATTAAATCATACTATATGTCCCAAATTTGTATTTGTAATCTTTTATAAGATTAA
ATTTTCATTTTCTTTACCTTTTATTTACTTTTTGAAAAACACTAAGACCATTTAGCTCTT
TCTTGACATATTACATGGTTAAAATCAATTTTAATTTTTTAAATTTATTTTATTTATTAA
CGACATTTTCTGAATTGCATATTTCTGTAACATAATCCCTCTAAAATTGGCTGAGTCGTC
TGTGTGCACTGACAAGTGGCATTTCCTGGAGGAGCACCAGCCAGAGGACAGGAATCCTCC
ATGGTCCTCGGGAAGTGACAATAAGCTTCAAATATTTTTTGATTGACCATTGGAGGGAGG
TTAATTTTGTCTATGAGCCGTTCTCCAAAAAAGGCTTTATAGTTTTATCTCCTGTGTGAG
CTATCAGAGAGGAGGTATTTCAGGGTTTGTGTGATTGCTCTTATTTAAGGAGAGCCTAGC
ATTTGTGTGTGTGTGTGTGTTTGTGTGTGTGTAGGCATGTAGATAAAACTACCAGGCTTT
GTCCCTCAAGCTACAATAAAATTGACTAGATGAAGTTCAAGTACTCATCACTTCAAATTC
ATGGTAAATGTCTCTGAATACAAATCAAAATGTTTTGAAAATGCTACTGTCCTTCATCAT
TGTCTGAAAGAAGTGTATGTTGACTGATTGCCATATCAACGTAGTTTCTGTCAGGCCCTG
AATATTTCAGGGGTTCAACACGGAGAAGCCAATATATAGTAAAGAAAGTTCTTTCCTGTC
TATTCTTCAGCAAGCATATGTGATTGCTCTTGTGAACATCCATCCATTGAGTCCTGAAGT
AACTTGAGGGATAAAAGTAGATTGAAGTTTAAGAGGAAAATTTTGACTATTAAGTTTTTG
TTTGTTTTTTTGTTGTGTGTGTGTGTGTTTCCTGAAGGGAGGGATTCCTTCTCTTTGGGC
CAGGATATCCTATAAATAATCACATGAGTGGAGGTCTTTTGGCCTTTTCTTATATTTCCA
ATGCAGATAGAGATTTCACTTAACAAATACAGAGACACTATATATTTATGATTTGTTGAA
GAGAAAATAGGTGCTTATAGGGGCTGGCCCCGTGGCCGAGTGGTTAAGTTCACGTGCTCC
GCTGCAGGCAGCCCAGTGTTTCGTTGGTTCGAATCCTGGGCGCGGACATGGCACTGCTCC
TCAAACCACGCTGAGGCGGCGTCCCACATGCCACAACTTGAAGGACCCACAACGAAGAAT
ATACAACTATGTACTGGGGGGCTTTGGGGAGAAAAAGGAAAAATAAAATCTTTAAAAAAA
AAAACAAATAGGTGCTTATAAATTCATTTACATAAACTTTCCTAAATTTCACACCTAACT
CATTTTAGTTTGGTTATAAGTCTTTTTAGATAAAAATCTCCTGATGCCTCTTTGACTGGT
TGGTTGGTTAGTTGGCAGTTACACTTTAAAAAGAGGTGACTGGGCCGGCCTGGTGGTGTA
GTGGTCAAGTTCACACACTTTGCTTTGGCGGAGTTCATGGGTTCAGATCCCAAGGTGTGG
ATCTACACACTGGTCATCAAGCCATGCTGTGGCAGTGTCCACATACAAAATAGAGAAAGG
TTGGCACAGATGTAACTCACCAAACAATCTTCCTCAAGCAAAAAGAGGAGGATTGGCAAT
AGATGTTAACTCAGGGCCAATCTTCTTCACCAAAAACAAACAAACGAAAGAGGTGGCATA
TTTTAACATGAACTAAAGTAAAGGCAGTTACTTTGAATTATAATGAGTCATGTACTGAGT
AGAAAGTACATATATTTCGCATCATGTTTTTGTGGTCTTGCGCTGTGTGTATTACATGTA
TCTTTTAATGTAGTGTTTGCAGTGTATTATGAGAACTCTCTCTTTTCCTACTTAGATGAA
AACTAAATGTTCATAACAACTCTAGTTTTAAAATTTTATTTAGTTTAAATGCTAATCACA
TTTTTTAGTGTAAAACAACGAATGAAAGTTAAATTAGCCACAAAGAAGTGTGGAGCATGG
CTCCTGCCTATAAGACATTGGCAGCATGGAGGGGGTGAGAATGGGGGGGATAAACAAGTG
CACAAAGTAATGGAAGGCAAGGCAGTATTTTCCGAGTGCTTCTGTGACAGAATGCTCTCT
TCAAACAGTCTTATTCAGAAGCTCAAATTCTGAAGTGGATTAAAATGGAACTGCTATGTT
TTAGCTGTCTTAGCTTAGCTGGAGGAAATGCCATAGCACTTGTTGGAATTTTTAAAACCT
AGATATCCTCCTTCCCTTTCTTCTTTCCTCCTCTCCCTCCTTCCTTCCTTTCTTTCTGTC
TTTCACTAACTGAATCTATAAACGTTTACTTGGCATCTACTGTGTGCCAGACATTGCAAA
TAGGGCTGAGTAGGATAAATACCCTGAGATAAACCAAATGAGGTGCAATGGGAAATCATG
AGAGCGGAGGTAGCATCTAGTTAGAGGAGAGAGAGAGGCCAGGCGAGGTTTCATGGAGGA
AGTGTTGTGTTTGATAATTACTGATAGTGTGAAAGAGTATTTTAATATTGGCCTTTAGGG
CTGTCTCCCACTACTGTACTAAAGTGAATGCGGGATAAGTAGCATGGCTTTAAATAATTC
CATTCCTGAGCTCCATATAAATTGTATTGTGGCTTTTTAATAGATGACATTGAAGTTGAT
TAGTTTTGATAACCAAGTTACAGATCTCTGCATCTAGTTAACTGTTTTAACGTAAACATT
AAGGGAACAAGTACCAATTAGAAATTAAATCTTATTTATTTATTTGTTCATTCATCCATT
CAGCAAATTCAGCAAAGCAGACTGGGAGAAGAAAAGGATGGATAAAGCAATTGGGTGAGT
TGGGGATTTCGTATATGAAGGGTGTCAGTCTGAACCAGAACCAGAGCAAAGACGTCCTAA
GGGCACTGTGAAAGATGACAAGGATGAAGACCCACTTGTCCTGATGGAAATCTACAATCC
AGTTGAATTTTTAAAAGGACCTGCTTATATGTTTTTGGCTTTATTTATATGATTACATGA
TACTACATTGCCTGTGACCAACTGACAAGGTTTAGAAAATGATAACTATATAGAAATGAT
TTTCAGAAATTATCATTTAGAAGTATATTTGGTAATTTTCTTTTAAGAACTTCTATCAAG
TATCAGATAAAAACTTACTTTAGAAGTTTTTTTTGATAATTCCCCATTTCATCCAAAAAT
ATTTCTGAAAAGAGAACTTTTTTTTAATGTGTTGGATTTATATTACCAGAGAGGACTTAA
GAACTCAGTTCCATTTCATTTTTGACAGATATGTAGAAAAAGGACTAGAAAATGTACCTT
GAGTGTTAAGATACTTATTTAAGTGTTTCCTAATTTTAAGAGTATTATATAATTTATCAT
AGAACATTTAGAAAATATAGGAAAGTAGGGGCCGGCCCCATGGCTGAGTGGTTAAGTGCG
CTCTGCTTCAGCGGCCCAGGGTTTCACTGGTTTGGATCCTGGGCACAGACATGGCAACGC
TCATTAGGCCATGCTGAGATGGCATCCCACATGCCAAAACTAGAAGGAACCACAACTGAA
ATATACAGCTATGTACTGGGGGCATTTGGGGAGAAAAAACAGCCAAAAAAAAAATGATTG
GCAACGGTTGTTAGCTCTGGTGCCAATCTTTAAAAAAAAAAAAGAAAATATAGGAAAGTA
AATAGAAAAAAAAAATCACCCCAATCTTACTACTCTAACACACAAATATTAGTATTTTGT
AGCATTTCATTTTAGCCTGTTTTCTGTGCACGTTTGTGTGTATATAATAAAACTTGGCCT
ATTCTCTACATGTTTTATATCCTGCTTAAATAATCTCTAGAAATATAGTTTTTATTGGCT
ATAGTATGTTACATGAGATTACCATCATTTATTTCACCAATCATTTTTTTAGAATATTTT
AATAGTTTCCATGCCATTGCCATCATAAATAATGCTGCAGTGAATATCCTTGCATATAAA
GCTTTGTCACTTTCTGATTTTTTTCTCTCATATATTTGGGAATAGAATTACCAAGTCAAA
GCATATGAACTCTCAATTCTCTTGGTACATATTACTCGAATTTTCTGGTAAATTACAAAA
TTCAGGGTTTTGATCGAGAGGGAAGGGTAACCTGCCATTCTAATAATTTAATAGTAATTT
AATAATCAGATTATCATATTTTTAAATGCTTCTTTCCCATATGTGACACACAGTTGGTTT
TGTGGTTTATGCTTTACAGGTACTCATTTGCAATTGTGGGCATCAATATAACTGATCTGG
CATATAATCTACTGGTGAGTGGAGCTCTAAAAACTCATTTCTACAACATCGCCCCAGAAG
CTCCAACATTGTCTCACTTCCAACAAACATTCTGTAAGTGTCCTGTTGCTTAATTATCAA
TGTAGGTTTCTATAGAACACTCGACCAGGATCAAAGCTGAGAGATCCCGGTGATTTGGCT
GCTCTGGGGCCTTTGAACTTCTTCCTTCAGTTTAGATCGTTTGTTGGTTTTCTCATTAAA
AAACCCACACTTATATTTTCAGGCATGGTGGATTTTTCCTCTTTCCCAGCCCTTGCATAA
TAGCCAATGAATCACTTCTGGTCTGACTTAAAGACATTATGGGTGTCTCTCTCTCCCTTT
GACCCAGCATGGCATAGCACTTAAGAATGCAGGCTCTCAAGACAGCCTGAGATCTCACTA
AGCCTCAGTTATCTCATCTATAAAAGGAATCCTTTCCTTATAGAGGTGCTATGAAGATAG
AATGAAATGATAGATCAAAAGTTGTTATAAGCCAGCCCCGTAGTTAGTGCTCAGTGAATA
TTAGAAAGAAGAGGTGTTGGTTTAGTGGGTGATATTGATGGTGGTAGATTTGTCATTGGT
ATTACTTTTACTACTAACACTACCATTGCTACCCTCTAAGAGTAGGTGCTAGTAGAGGGA
AGTATTGGTGGCCTTGAACCAGAGCCTTATGTTGTGCTTGACTGAGGGGTATCCTTCGGG
GCTGCAGCTGTGCTGAGGTTTCAGAAGATAAAGACTGAGACTGTATGGTAGAGCCCTGGG
ATGCTAGTCTCCATTCCTGGAGGCAGAATCCTAAAATCCAGCTGTATGTCATTATGATCC
TGTGGGCCTGACGCAAGCTGGTTTGGAGGAAATGGAAAGCTAGTCCACCAAGTTGTCCAG
CAACCTAGGCAAATTAAAGGAGAAACGTCACTTAAACCATGCCTGCCACCCTGAGGGCCT
TGGACCTAGGCTTTCTTAGCAAGAAAATTTCAGTTTTTCTTCTCCTTCTCTTTCTTTCAG
ATTTTTTTTGCTGTTAATTTGCTAAACAGTTCTGCCACTCTTTCTAAGTATGATTGAGAC
ACAGTTGTTTCACCTCAAATCCACCACAGGGCAGTACTGTTCTCCAGTTCATTTTTAAAA
TGTGATAACATCACGAGTTAATAGCAATTTATTTTATCTAAGTTCCTAAATTAATAGTGA
TTATATTATCTAGGGTCTTGTCTTCTTTTGTATCTGATTAATCAGGACTTCTGGTTAAAG
AGAGCATGCGTTATGCTCCCTTCTGAAACTTCATTAAAGTTAATATAAAGGAATTTTTCA
AAGAAAACATAAATCCACAAGGACAGGAAAAATCAGAAACAAGGCAAGAAAAACCTTATT
TTGAAAGCAGAGAAACAGATTAGGTAGTAACTGATTTAGTAGTCCTGAGAGAGCAAATCC
CAAACAGGTAGTGTGGAAAGTTAAGAAGCAACTTAATTTATTCCATAGGACTCCCCAGAA
GGTTCAAGAATTGGCAGCATTAGGTATCTCTGGAAATAGGGGTGAAGGTAGGACCAAAAA
CAGCAAGGTTGCTTGAAAGTATGATGAGAAGCTCTTAGAGACCCAAACCTCCTCCCTTTC
CCCTTCCCCAGCAGAAGCTGGTGGATTATTCTCCAGGGAGAGACAAATAAAGGATCTCTA
GTCTGATGAGTATCAGGTACAGTTAACAGCAAACCATACCGAAAGTGTTGTGAAAGCTGA
GACGCCCAGACTCCTTCTCCCACCCAGTTCCTGTCACTTTGGCAGCCAGTCAAGAGATTG
ACAGGGCCTTCTCTTCTCTGGGGAATCTGAGCAGCCCAAGAGAAAAGAGCTCAAGATGTT
GACCTCTGGAGCTCCCCAGTGAAACAGCCCAGCCATATCACTCTATAGTCATGCTCCCAG
TAAACAAGCCCTGTCTAAATGCTCAGAGCTTTCAATCAGCTCTTAGTCCAACTGGCTGTT
CAGTTCAACTGTGAAAATATTCAGAGACAACCAAGGATTATCAGATGTCTGAGTGTGATG
GTTAAACACATGTCCTCAAATTTTTTGACACTCCTCCCACTGAGAGGTAAGGTTTATTTG
TCCCTCTCACTGCTTGAATCCGGGCTGGCTGGTTAGTTGACCAATAGCGTATAGCAGAAT
TGACACTACGTGACTTCCAAGGCTAGATCAGAAAAGGCTTTTGCCTGGTTCTCTGGGACT
GAGCTGCCTTTGGAAGCATGAGCCACATGTAAGGGATCTGATGTCTCCGTGTTGTGAGGA
AGTCCAGGACACATGCAGCAGCCATATGTAGGTGACCTGACTGACAGCTTTAGATGAGGA
CCCAACAGCCAGTATCTACCATCAAACATGTGAGTGAAGATGCCTCCAAATGATTCCTGC
CAGCAGCTGTCAAGTCACCCCAAACTTCAGGTCTTCCCAGTTGAGACCCCAGACATTGTG
AACCATCCACCCAATGCCCTTTCTGAATTCCTAACCCACTGAATTCATGAGTATATTAAA
ATAGTTGTTTTAAGCCACTGGATTTTAGAATAACTTCTTAAGCAGCACTAGATAACAAGA
ACAGTAAGAAAAGCCTAAAGCATGAAAGCCTCAAGCAAGAGTCTAAAACAAGCAGAAATA
AAGTCACTAGAAGAGGAAATAGAAACTATGCAGGGAGAAGAAGACTTTAAAAATATGTGT
CATTAATATCTCCAAAGACAAAAGAAATGCAACTATGAAACGAGAGCAAGGTGCCATCGA
AAGAGCATTCAGAGAACAGAAGAGTGCTCTTAGAAATTAAAAATCAGATAACAGAAAAGA
AATCTCTAAGACAGATTAGAAGATAAAGCTGAAAACTCTCCCAGAAAGTAGAACAAAAAG
TATAGATGAAAAATAGAAAATAAAGGTTGAGAAATTAAAGGACCAATCTAGAAAGTCATC
TTATATCTGAATAATAGGAGTACCAGAAAAAGAACAGTGAAACTAAGGGGAGAGAATCAA
AGAAATAAATCAAGAAAAATATTCAGAACTGAAGAATGAGTTTTCATATTTAAACTAGTA
AGCACCAGCATAATAGATTAAAATAGATTCACACCAAGGTCTACATCATCATGAAATTTT
ATGACACAGGAAAGAGATGATTCTAAAAACGTCCAAAGCTTTCACATAAAGATTTGGGAG
TTAAGATGACATTGAACTTCTCAGCAGCAAAAAGAAGACAGTAGAATAATGCCTTCAAAA
ATTTAAGAGAATGTTTTTTAAATCTAAGGGAATATGATTTCCAATTTAGAATTCTCTACT
CAGTCTAATTTACCTGTTAAGTGTGGGAATAGAATAAAGACTTAAATGCAAGGTCTTAAA
TGTTTAACCTCCTTGTACCTTTATCAGGAAGGTTCCTAAAGGATGCATTTCCACAAAATA
AGAGAGTAATCCTAAAAGGAATAAATGGAGTCCAGAAAGCAGGAAATCTATTACAGGAGA
GAAGAGAAGAGAATCTTCAGGATGAAGGTGAAGGGAAAGCCCAAGATGATATCTATGCAA
TAGGCCAAGAGAAATAAACCCAGATTTTAGCAGGTCAGAGTGCTCTGGGAGAGACTATTT
GAAGAATGTGACATTGATGGAATATCTACCATGTTGAACACGTTGGCATACTTAGAGAAT
AGTTTAGAGTTAAATTAAATAAGTAGAAACTAAGCAAATAAAAAGAGGGCAGTTAATAAA
AGTAGATAAAGAAAATTTTTAGAAAATATGTGATAATGTGATTGGAATGAGTGAAAGGGA
GCCAAATCTTCATCTTCTATAGAGGGAAGTGAAAACAAGCAAGCAATGGAAAGTGTTAGT
TAGAGCTATGCAGGTCAATAATCAAAAGCTTCAGCTGAAAGAGTTGAAATGTTGCTTCAG
GGAAGCAGAATTAGGGCAGGGGTTGCTGCTGGGTTTTTGTTTGCTTTTTGTAACAAGCCT
TGTTAAACTCTTTGTCTCTAAATTATGTGTGTGTATAAATTAGGTAAAAATAAAAAGCAA
ATTTTAAAATATATACACCTTATGACTTATTAATGGAAAATGAAAGTCCCTTCAATATGT
GATTACTGCTCCTACTTTGACAACTAGATGATTATATTTACTCTTTTAACAACTCTGACC
ATTTCTGACAAATATTGTTGAAGTTTTACTACAGATTAGGTTCTGTGCTGAGGAAGGCAG
ACATCTGAACAAATAATGAGAATGTGGCGGGAAGAATTGAGGAATTGTGATTGAGGAATA
AAGATATTGTTTTTAAAAATGGAAAAGGCCTATGACTGGCATAGCTCACTCGGTCTGGGA
GTTGGAGAAAACTTCCCAAGCAAATGCCCTTTTCCACGAGACCTAAAGGGTGAATAGAGG
GAAATAGAGCAGCCGTGGGCGAGTGGTCTAGACAGAGGGAGGGAGTGGCGTGGGCAAAGG
CACAAGACGCAGAGCATGGTGAATTCAAGGAACAGAGCAGAGGGTCTGAGAAGAGGGGTG
ACTAGAGATGACAGTAGGAAAAGCAGGGGTGGGGATGGGGGTGCATATCTTGAAGAGCTT
CGTCAGCCATTTGCAAGAACATAAGCATGTAGATAAATAAAACCCCTTGCTCTGTCTCCT
GCCCCTTGTACTTACCCTATTTCTATATATATACCATGCTCCTTAGGGAAGCCAGGGAAG
CAGTTTTGAGGGAAAATAGTATGAGTTTAGTTTTAAGCATGCTAGGAGTGAGTTCTTTTA
AAGAAACCCACAAGGAGATGAATAGTGGGCATTCTAATGTAAAATTCTGGTGGTCTGAAG
AATTGCAAGGGCAGATTTGGGATTCTTCAGCATGAGGAGAATGCAGGGCCACGCAGTGGG
GGAGCTCTTGCAAGAGAGAATCAAAGTTAGAATCATAGGAATTGACGTTTAAGGACAGGA
ATGTTTGTTTTGTCCCCTGCTGTATACTCAGCACAGAGCCTGGTACAGAGAAGGTGCTCA
GTAACTATTTGTTGGATGGATGGATGGATGGATGGATGATGGATGGGAGGCTAAAATATT
GGATGATGTCCTTTGCCAGAGAAAAGGAGTCTAGTTTCTCTGGAAAAATTTAGCCTTGGC
CTGAATTGATATGCTTCCAAGAGAACCCTAGCCCTGGTGAGAAAGCATGCAATAGGATTA
TTTCTTTCTCAAGGCTCTCACCAGGTTTTAGACACAGCAGCAATCCCACTATGGATTGGG
GTGTAGGCAGAGGGTCTCAGCCCTCTCTAGAGGAAGCAAACTGTGCTCTGAATTCCTTGT
TCCTCCATCGGACATGATCAGTTCCTCGCTTCTCCTCTGTAATATTCTTGCAATTACCTG
TGTCCTTGCATATGTCTCTACTGTCTACTAACTGAATGCAATGAAGCAAAACCAAGACAC
ATTCAAGCAACAGCAAATATGCTGCAGGCTTGGACTGGAAAGCCAAATTAGTATTCAAAG
CAGGTATTTCATCTAGGTGAAAGAATATAAGAATATAATAGCCACATCATTCTGACTTCA
CAGTATTATTCAGTGAACACTGCACTGCCAAGGCAGTATGCTACAAAAATTGCATTCAAT
TTAAAGCTCCACTCAACATACAGCTCCATTGAAATGAAGTAAGGTTAGGTGTAGTGAGCA
GAAGGAAAGCACAATGGCCAGAAGAGGAGAAAGAATTATCTTTACTTTGACCTTCAAAAG
AAGGAACTATTCAGTAGGAAGAGCCTGAGGAAGAGACTACACTGGAAAAGACTGCTAGTA
CGGTGGGAAGTCAGCTGATTTCAGGTCCTGGCTTCCAGCTTCAAGCTGTAATTGTGCAAC
TGTACACCATTCAAGTATCTTTTCTAAGCCCACTGTTCTCGACTGTAAAATGAAGATATA
TCTGCATTACCTACTCCACAAAGCTGTTATAAGAATTAAATAAGAGATTGTAAGCAATAG
CCTGGCCACTGTTTCCTTCCTCTACTTTCCATGCCATTTTATTGGCTTCCTTAGCTAAGA
AATCATCATCTGAAATCATCTACCTGGGTCCCTGTCACTGAGAGACCAAGAATTGAGGAG
CATAGGAACTCTACCTTCTTTTGTATCTGTTGCATATTGTTAATTGGTAGGTGGGCCAAT
TGACCAATTGACCAAATGGATTTTTGAACACTCTGTAATGTTACATAAATGAGTGGAGTT
TTATAATTATAATATGCACCCTGGAAGCCAAGCAACTATTTCTGCATTTTGATTAAAATC
ACATTATGCAGTCTCTATTTTCCTGATGGGATAAAGAAAGAGAGTCTCAAGTCTTTACAG
CTTGACTGCTATAGCCTTAAGAGGAAGGATCCTGAGAATGGTTGAGAAGATGAACCACCC
CCACCTCTACTCTTATCCTAGCCTGTCTTTTAAACCTTTCAAAATGTTTTTCTATAATTG
CGTGTAAGGTAGAAAAATGGGGAAACCAAATGGATCTGCATTCTCCTAAAATTCTGCTAT
ACTCGATCACCTTTGGAGTGAGTTGCCAATATACCTGCACGTTGTAGAAGAGTGAATATT
TTTATCTACATTGTGGAAAAATGAATTCTTCATTGAAAGATTGTTTTTTTACAGTTCCTA
TTTATTACTGTCAATAGGAGTAAAGACTTTGTCGTTCATGAGATACTAATGAGATGCTTT
TCATTCATCATGGATTATTTTAATTCATAGAATAGGAAACTTGACTCTAGATATGAACAG
CTCAGTTGTGTTTATTTAAGCTCAGAGGCCAAGTCAGGAAAATTATGTGTGTATTTTATA
CAGCAAGGGAAGAAGAATTTATAAATGATCATAGATTTCATTTAGAACCATAAAAATTAC
AATATTTAGAAAGAAGCCAAGGGAACTTAAAAAGAGAGCATCTCCTAGAGACCATCGTCT
AGACTAAAGGCCATCACAAACTTAGTGATGTAAGGTTCCTCTTACTGACTGCGATATCTG
GTTGAATCTGGAAGGGTCTGTGTTTTTAGAGAGTTCCCCATACCATTCTTTGGGTACCTT
AGGAGTTTGCCCAGTCACTAGATGGATAGATGGTTGAATTCTTTGGGTTGAATAAGATAC
TGAGAGTAGAGGAAACAAGTTTCTGTTAGCGTTTCACTGAAATGACCAGGATGATAAACA
GCTCCAAGTTATGGCATGCAAGAAATGGTGAAGAGAAATAGGGATGCTTAACTTGGAAAA
GAGAGACACCCAGTGCATGAAGGGCACTTCAAATATTTGAGTTGGAGAAGGATTGAATTT
GTTCCGAGAAATACAGGGCAACATATTTTGGCCCCGTGTGATGAAGAACCTTTTAAGAAT
CAGGTTCTTCATCTTGGAACAGGCTAATGTCAGTGTTGTTTACCAGAAGAGTTCAAGGCT
GGATGCCACCTTGGGGAATCCAAGTACAGAATAGAGCAGAGACAGATGGGATGGCTCCTG
GGGTCGCTGATGCTCTGGTCTGGGGCTTCTCTGAGGTCGTCAGGTTCCATGACAGCGGTA
GTGAGCCCTGGCTTGTGTAGCCCAGAAGCTGTTCGGGTGAGGGTTGGTGTGTGTCCCCGT
CAGAGTTGTTAAAAGCAGTCACATCAGTTACTGTGTGTGGAGGGTCCAAAGACAGTCCAG
TCCTAAAAGAAATGGAACCATCAACCACCCCCAAAAAAGTAAAATAAATTCCCTCTTTCC
TTACTACCCTTCCTCCTGTAGTTGTAGAGAGACCAAATACTTAAAGATGTACAAGCATAC
TTAACAATGTAATGAGATGAGTAATTGGAGGTGAGTTTGTGGAAGTGGACCAGCCTCTGG
CAGTGTGTTGGGAGTGGGAGGGAAGGTCACTTCTAATTTTGTATTGTAGCGAGAGATGAA
TAAAGATTTTTAAAAATCTGTTTTATGGAGCTATGCTGAAGGTTTTCCCATAAGCAGCCA
GTTACCAGACAAACAAAAGCTGTTGATTTTTTTTTTACTATTAGAATTGAGTACGTTTGT
TCCAAAATTCTCTTCCTATGCCTCCTACTATCTCTGCTGCTCACTCCTTCCCCATGAAGC
TGAAAGAGCTAGGATTCAAATCAGGTTTCTGGCTCCAAACTCCTTACTCCCAACTATTTT
CTATTGCCTTCCAATGTTAAGACAAAGAAAAGCCAGTTTAATGTTTGGTTTTCTTTTTTT
TAACTAGGATTATTTCCTTAAATACTTTTTTCTAATATATATGGGGACATTTGAGCTTGC
AATTGATTTACTATACACAAATGTCTTTTATTCTCTTTTTAAAAAGCTATTCACATTTCA
ATTCTAAATGTGGTGGAGGGAGGGGGCACAATGGGAAAACAGAATACAATGAATAGGTTC
TCATATCAAATACTTCATGTTTATTCCCCAAATTTTCCCAATCTGGATCATTTTTTTGAG
ACACAGAAGTATTTGAATATGAAATTATGTTTCAGAGCAAGGAAGGCTTATTAACAATTT
CATGTAGTTAAATGACCAGTCTGTGTTGTTCAGAGTTGATTTACATTTTTTATTGTCTCA
TAATAGGTTGTCAGAATGCATTTGTTTGATTTGTCAGGGTAATTTAAAACTTTACTCAAA
TCGAATATCAAGGAAAAAAAGGCTGAGTGGAGTAATTTTGGAAAATCAGACCATTATGCT
AATTTAATTAGGAGGGGAAGGATGAAGTAGTCACTGTCAGCCTTTCAGAGTATGTTCCAG
AAGTGATTCGTATTCAAGAGATGGCAGAATTGATTTTTCTTCCTGCTTGAGAAGAGTGAG
AGTAATTCTAAGACCAATTGCAAAAATCTTGCATCTTGGTAGCTTCTACTGCACCGATTT
TAAAGAATAATTTTTAACAGCAATATTTGCTGTATTTTGATCTTTTCTTTGAGCTCTGTG
GTTGCTGTTATTTGGTCTGACATCTCTTCCAGCATTCAGGCTGATTTTGAATGTGATTAA
GGACTTTTTTTTTTCTCCAGGGCTCTTATCACTGTCTTATCTCTAACAGGCTATTTGATG
CACGAGTTTCATAAGTTTTGGATTGAAGAGGACCCCATGGACATAATGGAATTTAATCGT
GTGCGGGAGAAATTCCGCAAGAGGATCATAAAACAGCTGCAGAACCCAGACATGGCATTG
TGCCCACACTTTGCTGCCTCGGAAGGTTTAATCAACATGTAGTCACCCACGCTGGTTTTA
ATGGATGCCCCGGAACACTGCCTCATTGTCGTGTTAGTTCTCTGCTTAGATCCCAGCTCA
CACACTGAATGCACAGTAATTGTATGCATGCCTTTTGGTACAGTATTTTCATCTCTTGGT
CATAATTACCAGATCCCCCGATACCACTGTTTCTGGAGAATCTGTCATCCAGTGACTGCT
CATATTGTGGCATTATGCAGTGTTACATCTTGCCTTGACACCCAGGTATGGAGAGAGTTT
TCTATTTTTTTAGATTGTTTTCCTCCCCCTCATAATTCAGCATTGAAGAATTGTATTTCT
CTAGCTGTGTTTTGTATGTCAGAGATTTAGCTGAGTCTTATTCTGTGAAAGCCTTTTAAT
TTATTGATATGTTTCATGACTACTGCTGCTAGCTTTTCAAGCTGGGTTCATGCTTGGACC
TCATTCTAATAAAGTATGACTTTAAAATAATACAGACAGACAGACACATGATAAGCCAAA
CCATTCCTGCAAACATAGCTGTGCTTCATGAAAATCTACCAAGGCTTACAAGAAGCAATT
TTAGGTAGGTGCTGTTTTTGTTTGAAGTACCGCGGAATTATATCGTAACTTACACCCAGT
CGCAATTCTGTCATAGTCATCTGGCTATCAAATTATTTTATTCCCATAATTTCATTGGCT
TGGATCCCTACATATGTTTGTGATGCTTGGAGCCTCAGAAAAGAAGTATGCATATTTCAA
AAGCTGCAAAAGGTTTTTCACTGCCGGCCTTTTGTTGAACTCAGAGTTACACCCTGGCGC
TGTTCTGATCCAAGAATCCAAGCTTAGGGAACCGAGTGCTGACTGGTTTGTTTTCTATGT
CAAGAGGCAATATTAAAAAACAGTTTGCAAGAAAATGCATTACAAGAGAGAAACCCGAGC
TATGTTGTTCTGCAATATTTCTTGAAAATAATGACCTTGTCTTACATCAGTAGAAGAAGT
ATATTGCTTGGAAGGGGGGAAAAAATCAAACCATTCCAAAACTGCTAAAAATCATTTTAA
AAACCATGATTTAGTTTGGAATTATGATTGTAGTCTGTTGAATAGTACTTACCATGGCAT
TTCATACCCATGGTATTTTATACCTTCTGACTATCAATTTTAGTATTATTAGACATTTGT
GTAATCACTTGCTTATTTAAATGAATTTTCAGTACTGCCTAACTGTCGGTTATATGAATA
AATTACATGTCATTCTACTGTAATGTATAGTGGATTTCATTTTTAATAGTTTTATGCTCA
TACAGCTTCTGAATATGCAAATATGTGAGTGAGTAAAATGTCACAGACCTGGCGCCAAAT
AGAAGTCATGTGATCATTCAGAGTAACCAGGTGTAAATTAGTGTGTCATGTCTCAGGGAC
TTCTTTTATTTAACTAATCTTGAGGCCTGGTGGTGCTTTAATGAAAGAGTAAGATCCGGC
TTTTCTTTGCACCTTCCTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1160, 1298..1326, 2252..2349, 5382..5511, 11495..11628, 16510..16578, 18603..18653, 20059..20192, 29089..29738
1001..1160, 1298..1326, 2252..2349, 5382..5511, 11495..11628, 16510..16578, 18603..18653, 20059..20192, 29089..29258
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved