Equus_caballus Locus ENSECAG00000022652
snOPY snoRNA Orthological Gene Database
Equus_caballus ENSECAG00000022652
Equus_caballus
ENSECAG00000022652
7
SNORD37
119131..119195
176364
ATTATGATATTCAACGTCACGTACCTAAACACACAAGTCTCGTATCTATAAATTCCAGC
ATCTAGTTCAGGGCACGTGGGAACCGCTTCCTGACTCTTTGCGGAGTGGAGATTGCAAAC
TCTTCCAGATTCCAGCTCAAACAAGTGGAGTTAAAAGTCAGAAAAGGCTGAAAAAAAAAT
CAAATTTGAGAACTCTTAAAATCGGGAAAATGCTCCCCATTTCCTCTGCTGCCTGGAGCC
GGGTCTGTGGGAGGTGGTGAGAAGAACTCAGGGTTTGGAGCCACAGGGACGTGTGTGTCA
AGTCTACCCTTCCTCCCTCCAGGTGTCCTGTGGGACCCGGGGGAGGCCTTCACTCCAAGG
CTCCTCTTTCCACGTCTACACAGCAGGCCTGCTGGGGAGGCCAAGCTACAAGGAGCGTAG
GTTTGGGCTGCTGGCCTTCGTGACCCCGTCACAGAATAAGCCGCCTGAGCCCGCCCAGAA
CACGGCAGAGCCGACAGAGAGTGGCCAGTCCCAGACAACTGGGTCTGAGGTCCTGGATCC
AGCCATGCCTGCAGTCCACCCTTTGGCTTCAGACACATGGCAACAATGGGAGCCAAGGAA
TCCCCTTTTTGGTTTAAAATTTTTGAACCGAGTTTCTGATCCTCGCCCTGAAAACAAGGC
GGGGGGCTAACTGTTTACCTCCCCTGGTGAATTCCGCCCCGGGAGCTCTCTCCCACCCAA
ACTTCACACTTGAATGTGGACCATAGAGACGCGCATTTAACCTCCTCTCCTTAAGCGTTT
GCCAGTTGGTCCCGCCTCTCTGTCCCGTCCTTTCACGACTAGACTGAGTCCCTGGAGGAC
AGGTCTTATCTCCCTGGACACCTACTCGGGGTGCAGCGGGTCCCCAAGGATGTTCCAATG
GTTTTGCGTGTGATTATTACAATCCGTCCTCAAGTCGTGACAGCTCTGCCCTCCCCCCCT
GTACAGTCTACTTTCCTTATCTCGACTCAGAAGGCCCTACAGGGGCTGCGCCCTCCCCCT
TACCGACCCCTCCCACGGCTTTCCCTCTCCCTCCCTCCATGCTGGCCTCACATACACCAG
TCATTGTCCTGCCTCAGGTCCATTGCACTTGCTGTCCTCTCTTTCTAGAACCCCCTTCCG
TACTTCCCCTTGTGGTTCACTCCTTTGACCTTGTATCTCTGCTCAAATTCACCTCCTCCG
TGAAGCCCCCCGACCACCTTCTTTAAAATTGCAATCCCCCGCCGTCTCCATCCCTCATCC
TGCTTTATATTTCTCCCCAGAAACTTACTATCATCTGACACACCATATATTTTATTTATT
TACGGTGGCGTGTGTTCATTCAACAAACATTTATTGCGCTTCTATTCTGGGCCAGGCAGA
GGGGCGCATCCTAGGGGACATGAATATTCATTAATTATTCCATTCAACAAAAAATACCCT
TCGCTGCTTCCCTGCGTCATCAGTCCAGGTGCTTCACTGGTCGGAGAGAGAGAGGGGTGT
GGGGTGGGGAGCTAGAAAGTCTCCAGCTACGATTCGTCTCCCAAATAGGGACAATCATTA
TGACGAGACCTACTGTGCGCTGTGTCCCCAGTGCCTGGCACGCAGTGGTCGCCCGATCAT
AGTTGTAGATGGAACGGCCGAACGTGTATGGACGTAACTCTGGAATTTAGTGCAGGGCTG
GCAGGCTGCAGCCCGGGGGCCACTTCCGGCCCTCAGCTTGTCTTTGTCAATAAAGCTTTA
TTGGCACTCGGCCACACCCATTCATTTCCCCGCTGCCACGGCAGAGGTGGGTGATTGTGA
CAGGGACCCCCACGGCCTGCAAAGCCCCAAATTATTCACGGTCGGGCCCTTTCCAGAAGT
TTCCTGTGATCTGCAGGATCAGCAGGTTAGATCTTGTCTACCCGATACTGGAGCCACGGG
ACCTGGGTGACTACCGAGCGCTTGAAATGCAAAGAATGTGAGGAGGAAGTGGATTTTCAA
TTTTATTTTGTTTTTATTAATTTAAATTTAAAAACTGATACTCGATTCAGTTAACAGACC
ACTTTTTTGTTGTTGTTGAGGAAGATTGGCCCTGAGCTAACACTTTATACATGGGATGCC
TACCACAGCTTCAGAGATTTTATAGAATAGCAAATACTCAATTATTTCCTTGATCTGTAA
AATGGGGGGTAAAGGACCTTCCTCACAGAGTTGTCGGGAGGATTCAATAAATTAAAACTT
GTGAAATGCTTAGAAGGAATCTCCACATATTTAGGCCTCCAAATCTGGTTGTCTTGGGGC
CGGCCTGGTGGCCCAGTGGTTAAGTGCACGTGTTTCACTTTGGCGGCCCCGGGTTCTCAG
TTCTGGATCCCAGGTGTGGACCTAGCACCACGTGTCACCCCACCTAAAATAGAGGAGGAT
TGGAACGGATGTTAGCTCAGTGACAATCTTCTTCAAGGAAAAAGAGGAAGATCGGCAACA
GATGTTGGCTAAGGGCCCAATCTTCCTCAGCACAAAAAAAAAAATAAAAAAGCTGGGTGT
CTTTATGGTTATTATTATCGCTAGATGCATATCTGTAAGAAATACGCCGCGTCCTCATCC
TGAAATGCTCGGCGGGCGCCCGCCTGTCACTTTCCGGTCACCTCAGCCCTTTGGTCTCAG
CCCACATCTGGTCCTAATGAAGGCCCAGTCGGGCACAGGAGGATGGAGGGGCTGGAAGGG
GGGGTGATTCACCGTGACCTCCCCATGAGTCAGCCTCAGTCGAGACCACGCCCAGGTGCC
CTGCTCCAGACGGGGGCTCACCCCTTGTCACCGTGTCACCTCCCCGTCCCTCTGTCCTCT
CACCCGAGGGGTCTCCCCACTCGCCCCTTTGAGGTCAGTTTGGGGGGAAGAGGGGAGGGG
GTCCGGGAGCCGGCGCCCTTTGACCCACTCCTGCCCGTCCCCCAACTCCTCCTCCTCGGG
GACCCTCCCTGGGGTCAGGCCGGGCCAGGCAGTGAGTAAAGCCCTCGTGACGTGGGTGTG
GCGGGGGCACCGGGGGACTCTGATCTGCCTCCGGGACAGGCCAGCCGATCAGCATCCGGT
CCTGCAGGCTGCCCGTCGTGTGCTCAGGTGCATCTAGAAGGTTCCGGTCTCCTGAGGTGG
GGTGAAGACAGGAGGTTTGAGCCAGGGGGTCCAAATACGAGGGGAGGACAGCTCGGTGGG
GGTGGGCTCCCCCTGCCCTTCTTAAAGCATGAGGGACGTCACGCCGGAGAGTTCATTCAT
TCATTCATTCCTGAGAATTCATTCATTCATTCATTCATTCAGTCTTGGGACCACTATTTC
TTGAGCGCCTGCTGTGTGCCAGGCATTGGGGAAACAGCAGAGTGATGCTAAATAAGTTTA
TTTGTCCAGGGGCCAGCCCGGTGGCACAGCGGTTAAGTTCACACGTTCCACTTCAGCAGC
CCGGGGTTCGCCGGTTCGGATCCCGGGTGCGGACATGGCACCGCTTGGCAAGCCATGCTG
TGGCAGGCGTCCCACGTATAAAGTAGAGGAAGATGGGCACGGCTGTTAGCTCAGGGCCAG
TCTTCCTCAGCAAAAAGAGGAGGATTGGCAGCAGATGTTAGCTCAGGGCTAATCTTCCTC
AAAAAAAAAATTTATTTGTCCAGAAGCAAGAAAATAAATAAAATGAAGAGACCACATACA
GAAGAATGAAGCAGGAAGGATATGAGGAGTGAGTGGGGACGACTTGTAGTTTTACGTCTG
GTCGGGGAGGCCTCACCACAAAATCCAGAGGAGGGGAAGGACCAGATCAGGTGGGAAGAG
GGTTCAGAGCGGCGACGACAGCCCGTGCAAAGGATCTGAGGTGGGAGGAACAGCAAGGAG
GCTCACAGGACTGGAGTGGAGTCAGCAAGGGGCAGGGGAGGGGAGGGAGGTGACCGAGGG
CCGTGTTCCGGGGTGAGAAGGCTGATGGTCAGTCCTGTGACGGCTCTAGAAGTTTCCACA
TGGGGCTGGGTGGGACATGTGCATGGACAGGGCTGGGAGGCCCAGTGTGTCAGGGACACG
GTTCTCCAAGCTGGCGTCCAGGGCTCGCTCTTAGCCGGGAAGGTGGTCCCCCAGCTTTGG
GAGAACAGGGGCCCCTGGGGCCGTGCCCCGTGGTGGCCTTGAGCCTGGACCAGCAGACAG
AGATGTCCCCACTCGTCTCCGGGTCCCCGCCTCTCCCTCTGCGTCTGGCCACCATCTCGT
CCCGGTGATTGCTTTACGGCCCGCGGGTCCAAGGGTCGCAGAGGACGCTCCGGCCGGGAC
AAGGAGGCCTCCAGGGGCTGCGGATGTGGTCCTCTCAGCTTCCTTCCCGCGGTGGGGGCC
GAGGGGGTTCTGGAAAGAGCCACGGGTGGGGGGGCGCAGGCATTCCTGGGTCCCCAGATC
CGGAATTCGTCCCAGCCCTTCATCCCTCACGCCCTACAAATGAGTTTGCCTGGGCCACCA
AAAAGAAAGTCCCCCAGGCTGGGCGGCTGAGACAGGAGAAATCTGTCCTCTCTGGTTCTG
GAGGCTGGAAGTCCAAGACCAGGTGTCGGCAGGGCTGGTTCCTTCCTCCCTCTCTGTGCC
TTGCAGGGGCCGTCTTCTCCCTGTGTCTCTGACCCCAGACATCCCCTTTTGTTGTGTTTT
TTTTTTTTTTTTTTTTGAGGAAGATCAGCCCTGAGCTAACTACTGCCAATATGCCCCCCC
CTTTTTTTTTTTTTGCTGAGGAAGACTGGCCCTGAGCGCACATCCATGCCCATCTTCCTC
TACTTTATATGTGGGACGCCGACCACAGCGTGGCTTTTTGCCAAGTGGTGCCACGTCCGC
ACCCGGGATGCGAACCAGCGAACCCCAGGCTGCTGAATCGGAACATGTGAACTTAACCAC
TGCACCACCAGGCCAGCCCCAGATGTCTCCTTTTTATAAGGACATCAGTCACACGGATCA
GGGGATGAGGGTCCACCCTAATGACCTCATTTTAACCTCCTCAGCTCTCTAAAGACCCTG
TCTCCACAGACGGTCACACTCTGAGGTCCTGGGGTCAGGACACCAACTTGTGAATTGGGG
GCCGGGGTGGGCTTGGGGGCAGGGACACCATCCAACCCACAACGCCTCCTCAAAGCACTT
ACAAAACCCGAGCCTGGTGGTCTCAGCTCCATGGCCACCTCCTCCAGGAAGGCACCCTGG
CTGCACCAGCCAAAGTCCCCCCGCTCTGGTCCCCAGCATAGCGCCTTTGGGGGGACTCTG
TTTGTGAGTTTCTCCCTCTCTTTGGGGGGAGCGTGGCCCTCTCCGTGTTGGTCACTGAAG
CCCCCCCAGGCCCGAGAACAGCCCATCTGCCATCAAGTGGCTTCAAACGTGTTTGTGGAG
TGGATCCCGTGACTCAACGTGCCCCGTGGGTCCCAAGAGGGAGGGACCCGCTCTCGGGCG
CGGTGATACGTCCGCCCCGTGTCTCATCAGCTCGTGACTTTCCCTTTTGGGGCACAACGG
CTTTCTGGACAGGGCGCCACCCTCGGCTCAGCAACAAACCGGCTATGACATCACAAAGTC
CCTTCTTCTCCCCGCTGAGACTCGGTTTTCCCGTCTGTGAAACGTGACGGTTGATGGAAA
GGTTACAGACGGCCCCCGCCAGGTCAAACATCGGGTTAATGTTCAACCCCAGGGGAACGC
TGGCCCGGAGTGGCGTCTGGTTGGAGTCGAGGCCCAAGACGCGGCCAGCCGCGGAGACGC
CCACCGGGTAGGGGGCCGCCCCCTCCGCACGGCAGAGAGGTCGGGCCGTGCTGAGCGAGA
GTCCAGACAGCACCGAGCCTCGGTTCTCCTCAGCGGGACCATGACTCTGTTCTAGAATTT
CCTTCTTGCAGCGGCCAGAACACCTCCGAACCCTCGGATCTCCAGCAGAATCTCCAGGTT
AGCAAATGCTTGAGGTCCCCTAGACCCGTGTATGACAACCTTTGGCAGAATTTAACATTT
CTTTTTCCATGGTCTTCTTCTTCTTCTTTTTTTTTTTTTTTTGCTGAGGAAGATTCTCCA
CTTTTTTTTTTGCCCATCTTTCTCCCACTTTATATGTGGGTCGCCACCACAGCATGGCTG
ACGAGTGGTGTAGGTCTGCATCCAGGAGCCGAACCCACAAACCCAGACCACTGAAACAGA
GCGTGCAGAACTTAACCACCATGCCACCGGGCCGGCCCTTACATTGCTTTTCTTTTTTAT
AATTACCTTCTACTGGGGCATCTGAGGCTGGTCTCCATGGACCATCCCGTTAGAAAGCAT
CTTCCTAAAATAAATTTATTGAAGAAAAGTAGCAAAGTTGACAATAATGCCAAAGATGGA
GCTGAACTTTTTTCCTTCCAGAAATGTATCTTAAAAGGAAACGTTGTAACACTGGGGTAA
ATGGAAAAACAGCAACAGTATCGGGTGCCCCAAACTGATACAAAGGAAAATAAACAATGT
TACTAAATTCGGGGCGCGCCTGTGGCCCGTGGAAGAGCCCGGATTAGGTGACTCTTAATA
AGAGATTAGTGAACAGGCGGTAAAGACACGGCAGCACCCAATCCGAGTGTTTCTAAATGG
AACCAGAAGGTTGAAAAGAGGGTTGAAAAGGAAGTAATTTGTCCCTTTCATGGGGTTGTG
TTTTTATATGCAATTTGCAAGCACGCGTGGGGAGCTCACTCTGGGCATGAAATCCACTCG
ATGGCCCCGTTCTCTCCGACCTTCTTTCTTCCAGAAAAACAACCCCACTGCCCTGGGCCC
AGCTTCCGGGTCTAAGCGAGTCTGATCAGAACCAGAGCTAGCTATTGTATTATCTGCTTT
TTTTTTTTTTTTTTCCTGAGGAAGATTAGCCCTCAGCTAACATCTGCTGCCAATCGTCCT
CTTTTTTTTTTGCTGAGGAAGACTGGCCCTGAGCTCAAATCCATGCCCACCTTTTTCCAC
CTTATGTGTGGGACGCCCACCACAGCATGGCTTGATGAGCGGTGCCATGTCCACACCTGG
GATCCGAACCTGCAAATCCCGGGCCTCCGAATCGGAACATGCAAACTTAACCGCCGTGCC
ACCGGGCCGGCCTCTATTACTTGCTTTTTTATTATTACCGTATAAAGGCAATTTTGAACA
ATGTTAGGGACAAAATCCTTTTCCCCTAAGAAATCTTTCACTGGCCTAAACCAGGGGGTC
AGCAAACTTTTCCCACAAGGGGACAGACGGTAAATATTTTCAGGTCCGCGGGCCAGAGCT
GCATGAAAGCTGCCACAGATGGTTCGTCAATGAATTTGCGTGGCTGCGTGCCCGTAAATC
TCCTTTTATGCACACTGCAATTTGAATCCTATATACGTTGCACGTGTCACGAAATGTTCT
TCTCTTTGTGATTTTTTTCCCCAACCAGTTAAAAAAAAAAAAAAGCAAAAAAAAAATCTT
TCGCTTCTACCAAAATGGGCCCGGGGCTGGGTTTGGCGGGCAAGCTGTCCTTTGTCAACT
CTTCGTCTGGACGATGGTCGCAGGTCCAGCGGACGTTTCATCATTGGAAGTTTTGAATTA
GCACCTTTTTTTAGGAGTGATCCTTTCATAAACATCGACTCGTCCACGGAAGCGAGTTTG
GAGAAGCTCAGGCCGTCTATGCAGCCGGGAGGCACAGACTCCGCTCCCCACATTCCTCCT
GAGAGTTAGTTCTTAATAATTTTACACGTTTTCAGTTTTCTTTGGACACAATTCATTTTT
TCCCAATAGCAGGTTTGAAATCCAGTCCCGCACCGCAGAACGACATTCCGGTCAAGGACG
GGCCGCGTAGACGGCGCTGGTGCCCTAAGTTGCAGCCCGAGCGCGGGGTCGGCGGCGCCG
TCTCTGCTCGTGTCCGCGCGCTGCGGTGTTCGCGCAACGACGAAACCGCCTAACGACGCG
TTTCTCACAACGTGTGCACGTCGTCAGGCAACACCCGACTGCAAACGAGGTCAACCCGAG
GGGTTTGAAGCGCGAAGAAATAGATTTGGAGCCGCTTTGCTCCCTTTATTTTATCTGACC
GCTTGGAGGTCCTATTTTTGCTTAAAATTTTAAACAGCGGGCTCAGCGGCAAATTATCCT
ATTTTTATTTGGTCAGCTCAAATGTTAATTCAAAGACGGAATATCTTGACTGAATTTGAA
CCGCATCTTCAAAGCGGAAATGTCTTTCTCTCTCTCTCTCTTTTTTTTTTTTTGAGGAAG
ATTAGCCCTGAGCGAACATCTGCTGCCAATCCTTTTTTTTTTCTTTTTTTTTGCTGAGGA
AGACTGGCCCTGAGCTCACATCCGTGCCCATCTTCCTCTACTTTCTATGTGGGACGCCCA
CCACAGCATGGCTGCCAAGCAGTGCCATGTCCACACCCGGGACCTGAACCAGCGAACTCC
GGGCCGCCGAAGCGGAACGTGCGCACTTAACCACTGCGCCACCGGGCAGGCCCCTTAAAT
AGTCATTCTTATTTGATTATTTACTTGTTATGAAGCTGTAATGCTGTTATTTATTACTGC
GACAGACCAGTATGTAAAGATAAGGTTTTCTTTTCAAAAAAATTTATTAGTGGAGTTAAA
AAGTATTCATTTGTGACTTTTCTTCCTCTTTTGGACTTTCACATTTATTTTATGCATGTT
ACTGGCGTGATTATATGTGGCGTGCAATGAAAGAAAAAAATTCACTCTATATTTCTTTTC
TGGGTATTACCATGATTTGTTGTTTTTCATAACTATTATTGAAACTTTTCGTCATATACA
GGGGGAGTGTTACAACAAGACCTACTGTGGGTAGACAAGCCACTGCATTTCCTCTCTTCA
TACCTGGTACCTAGCAAGTGTCAAATAAATATTTATCCCCATCAATACCGCAGTGACAAG
CTCCGCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNAAGCTAGGAGTCTGAATCCCTGACACGGTTGAACATCGTA
CTGGCCCTGCAGTTCGACAAGAGAGAGAAATAAATGTCTATCTTGGCTACGTCACTATTG
TTTTCAGGATTTTCTGTTTCTCACAATTAAACCTAATCCTAACCAATACATACAGCATTC
CTGGTGGCCCCTCGGCGTCCCCCCTGAGGCTGGACCTGAGGCGGGTGGTGGGGGGGGGGG
GGGGGGGGGAGGGGGGGGCGGACTGAGGCCGACTTTCCAGTCCCTGGTGCCCCCTTGTGG
ACCCCACGAGCAACTGCCACCTCCACCTCAACCTCCTCCTAGGAAGTAGGAAGTCATCTG
TGTGGCCCCTCCTTGCCCTGACTTTGCCCCCTGCCCCCTGCCAACGTCCCCAGGGCCTCC
CCCTCCCGGGGCCACACTCCCACTGCGCCACCATGGTTTACATGCCTGAAGGGCTCTCCG
CGAATTAAAAATCCCTCTGAGAGGCCGGCCCGGTGGCACAGTGGTTAAGTGCACACGTTT
TGCTTTGGCGGCCCAGGGTTCCCTGGTTTGGATCCCGGGTGCAGACATGGCACCGCTTGG
CAAGCCATGCTGTGGTAGGCGTCCCACATATAAAGTAGAGGAAGATGGGCACGGATATGA
GCTCAGGGCCAGTCTTCCTCAGCAAAAAAAAAAAAAAAGAGGATTGGCAGCAGATGTTAG
CTCAGGGCCAATCTTCCTCAAAAAAAAAAAAAAAGAGAAGAGAAAGAAAACGAAATCCCT
CTGAGCTGGCGTCAGAGATGTCAACACATTTGAACAGCGTCGTCTCTTTCCAAAGCCCAT
CCTGCATCTATTACAACTCTTCATCTGTGCTTTGATCTGCGTGCACACCTCGCGTCGGTG
TAGCCCCCCTGCTCTACGTTCGCGAGAAGTATTTCGAACTGCAGCGTTGCACATGGCATC
TGCAGGAGCTGGCTGGTATTTCACAGGAAAGAAACAGAAGGACAGAGGAGGAAAGTGACA
GCTCTGCTCAGGCTAACAGAGACTGCGGGGGCCCGGAACAGAGACAACTCGGCGGTGCGC
CGGAGCGGCCGGGTGGGCTCTTGCTGGCGAGATCCAGGCACGCACATCCCTGTCTGACTC
CGGGTTCGATGACATCGAGCGGGTAGCTTGAAATTGGCCACATTGGGGGCATTTACACCA
CAGGAATTGGCAGATGCGACAGATTAGGGGTTTGCATCCTCTGAAGAGCTGTCTACACGT
CCAGCAGCCCACCCCCCAGACTCAGCCCACCTCAAGGCATCTGATTCTGCGGCCAGCGCC
GGCGAATGCTCTTCTCTCCACATTGCATCTCAGAAGGACGGTTCTCCTGGGAGGAGGCGT
CCACGCCAGCTGCACCCAGGGGCACTGGAAGGTAAATTACGCCCCTGAAGAGACTTCATT
CATTCACTCATTCATTCATTCACCCCCTCAAATATTTATCGAGCATCTAACATAATAAGC
CTTTATGGATTCCTTCTCCCAGGAGAGCGATGCTTGCACCTCTGTCCCCGAAAACAGGAC
GCAGCGATCGTTTACAAGCTCGGCGCTCTCTCTCCAAGACGTCAGCCAGGAGCTGTTGGA
TCCACGGTGAACACTCTCGGTTCCCGCAGCAAACGCAGCGAGGCATCCCGCTCCGGCCGC
CATTTGGAGAAGTCTGGCCTTGTTTCTGCAGTTGATGGCTGAAGGCTTGAAAATGGCTTG
TCTATCCAACTGCCCTTCCGATGGTTCCACGTGGGGGTCTCGAAAGCATCTCAGACTCAA
CGTGGCCGACTGAGCTCCTGCTCTTCCCTCAAACCTGCTCCTCCTGCGGTTTCACTAAAC
GGAGGCTCCATCCTTCCAGGTGCTCAGGTCAAAATGTTGGCTTGTCCCTGAGTTTTCTCT
TCCTCTCTCAGCCCCACATCCCTCCATTGGCAGTCTTGTCGACTCTGTCTCGCTCACTCC
GTTCCAGCCACCCGGGCCTCCTCACGCTGTTCCTCTAATATGCCAGCCACAGTCCTGCCC
CAGGGCCTTTGCACGATCTGTTTTCACTGCCACAACTCTTCCCCGACACATCCAAAGGCA
GACGTGAGTAGTTGCGACAGACGCTGCCTGGCCCTCAAAGCAGAAAATATTTACAATCTG
GTCCTTTACAGAAAAAGTTCGCAGAGCCCTGCTCTAGTGCCAAAGGAGGAAATCATGTCA
CCAGAGGGGAAACTGAGGCCCAGAGGGTCAAAATGAGTTTTCCAAGGCCCCGTGTTTCTG
AGGGGCTCCTCATTTGTCAAATTGTCTAAACAGCATCTCACGAGCTTCAGAGGAAACAGC
AATCACACTGACCAACGTCTCCATAAGTTGAAGGCCACCTGGGTGTGCAGAGCTTGGAGA
GAAGTCTGTGCACACCCATCTGATCTGGCCAAGCCCAGGAGATTTTTAATTGCCGCTGTA
AAAAAAAAAAAAAAAAAGGCATTGCTTTTTCTAGAAACCTTGAGTTTGGGACTTTGATCG
GAGCATTACGACATGGCAGCGAAACCCCATTTTGACTTCCTCTCTTCTGGAGGCGTTTTC
CCGGCACAGTCGGAGGGGGGTGGCAAAACGCACCCCGCATCCTCAGAGACAGAAAGCAGA
GCCCTGGTTTCCAGGGGCCGAGGAAGGAGGGGAATTGGGACCGAGTGCTAATGGGCGTGG
GGTTGCTTTTGGGAATGATGGAAAATGTTCTGGAATGAGATGGTGGTGATGGTTGCACAG
CACCGTGAATACGCTAGAACCCACTGAACTGTGCGCTTTAAAAGGATACATTCTACATTC
CGTACAGTACGTCTCGATAAAAAAAAAAAAATTTAAAAAGACGACGCCCTTCTGTTTGTT
ATTAAATAACAGTGCTGTGAAATAAACTAATAATGGGAAAGCGAAAAAATAAATCTCGCC
TATGACCCTCCCCTCCACTAGTCAAATTCCCTTTGTTTTCCCGCATCCCTTCCCAGTTCT
TGTTCATCCGGATGGATCCCTTTTTGCGCAGCTATAACCATCCATGGGTCAGGATGCAGC
ACAAAATTATTTTTAAAAACTAAATGTTTGTAACTCTGCAGCGATGGATCTTATCTAGAC
TTACTGTGGTCATTTTGCAATCTATGCATAAGTTGGATCATTATGTTGTACCCTTGAAAC
TAATATAATGTTGTATGTCAATTATATCTTAATAAAAAAATAAAAGCAATTAAGAAAAAA
AAGAAAGCCTGGGCATGGCGCCCCCGATGGAGCTCTGTGCGTTTGCGCATCTCCTCTCGG
AGCCCTTCCTCTCTCTGACTAGCAAAGGACTGGGACCAATGTTGACACAGAGAGCATCAC
AAGACATTTTTGTTGAATGCAATAATTAGTAAATATCCACATCCTCTAGGACCCATCTTT
CTGCCTGGCAGAGAGCAGATACTCAATAAATGTCAGCTGAATGAATGCATGCCCCCTGGA
CCACGGAATATCTCGACTCTCCAATGTATAAAGGTAGTGGTGTGCTGGTCAAGGTTTAAC
AACCGGTTCTCTGGGAGGGGAATTTCTATATGTCCATATCGCTCATATATCAGGTATATT
GCACATATGTAATATACATCATTATACAATGCGTATCTATATTTATTGTAACTGTTACCG
ACGTAAAGGATGTGTAGCATGCAATTCACAAATAATAATAAAATATGCAATACTCCATTC
TAAGTTCCATACAGCCACTTGATTCTCAAAGGATACTTTTGTTGATTTTTGCCGAACCCT
TGTGTCCGTAGCCAACTTACGGTTGCAAATAACGGCACGAGGGTAGTTCTGACTTGAATG
CCGGCAATATTTTCACTTACGTTAATAAGTAACATGAAAGTGAAGAGACGTATGAGCGAA
TTTCACTTGTTCACCAAGAAGGAGAATGCCATCTTCGATAAATCAGATAACAGCTTGTGA
ATACTGGAAAAATATTTCCTCTTCTCGGTGTGTGTGCTATTCTATAGACTATAGACGGGA
CACATTTTAAAGTTTAATCTGCACTATTCACTTTTCTCCATCACTTTTTTAAAGCCTAAA
CCGGGGGTCGGGACCCTACGGCCCTCTGCTTGTTTGTGTCGATAAAGTTTTATTGGCACA
CAGCCGTGACCATTTAGTTGGTTTTGTCCATGGCCGCTTTCTCACTACAACCACTGAGGT
GAGTTGTTGCAACAGAGTCTGGAGGGCCCACACGGTAGAAAATATTTACCATTTGATCCT
TCACCAAATAAGTTTTCTGACCCTTGATCTAAACTATCAAAACACAACAAATCAAGCCCT
CACTTGGGGCGTTTGCCAATCTCCGGAGTGTACATACTCTCACCACGGCCCATTTGAAGC
TGCCCATGTGACGCCAATGGTGCAAAGTTGAAAAGATACACAGTGGTTCCGCATCATATC
CTATTTCTGCCAAACAGATACAATAACAAAAATAGATGAAAATAAAATTAAAAGGATACA
TAATAGCAAAATATGATATAATCAGGAAGGAATGTTTTGAGTATTTATTACCTTGTTAAA
AAATTGAGGTTTGGGGGCCGGCCACGTGGCTGAGTGGTTGAGTTCGCACACTCCACTTCA
GAAGCCCTGGGTTTCGTTGGTTCGAATCCTGGGCACGGACATGGCACCGCTCATCAAACC
ACGCTGAGGCGGCGTCCCACATGCCACAACCAGAAGGACCCACAACTAGAATATACAACT
CTGTACGGGGGGTTTTGGGGAGAAGAGGGAGAAAAAAATATACATTAGTAACAGACGTTA
GCTCAGGTGCCAACCTTTTTTAAAAAATGGAGGTGAAATTCACTGACACAAAATTAACCA
TTTCAAAGTGAACAAGAAAGCTGCATTTAGTAAATTCACAATGTTTTGTGACCACCGGCT
CTATCTGGTTTCAAAACATTGTCATCACCCCAAAAGGAAACCTAGTCTCCATTAAGTAAT
TGTTCCCCACGCCACTTCCCCAGTCCCCGGCCCCACCATCTACTTTCTGTCTCTATAGAT
GTGACCCCTATAGCGACCTCCTGTGGGTGGAATCACACAGTAATTGTCCTTTTTTGTCGG
GCTTATTTCACTGAACATAATGTTCTCAAGGTTCATCCATGTCATAGCAGGTGTCAAGAT
TTCCTTCCTTTTCAGGGCTGAATAATATTCCACAATCCGGATGGACATATTGTGCTTATC
CATCAACCATCAATGGGCACTTGAGTTGCTCCCCCCTTTTGGCTGCTGTGAATAAAGCTG
CTGTGAACATGAGTGTACGAGTGTCTGTTTGAGCCCCTGCTTTCAATTCTCTTGGGTATA
TGCCCAGAAGTGGAATTCCTGGGTCATATGATCCGTTTTTAATTTTTTTGAGGAACCGCC
ATATTGTCCTTCTTGGGGTTTTTTTTGCTTGCTTGTTTGTTTGTTTGTTTACCTCTTTAC
TTTGAAATAATTTTAGGTTCACACAAAAGTTGTGAAAAATAGTACAGAGAATTTCTCTGT
ACCCTTCACCCAGCTTCCCCCAAGAATAACACCCTATATAACCATAGAACACCACCAAAA
CAGGGAATTCACACTGGCACCATAGACATTATTCTGGTTTCACCAGCTCTTATATGTGCT
CATTCTTTTGGTACATGGATAGCTCTGTCAAAACTTGTCACATGTTTAGATTTGTGTAAT
CATCACCATAATCAGAATACAGACCATTGCCATCACCACAAGGAAAATCCCTCATAGTCA
CAATCTTCCCCAAATCCTGACCCCTGGCAATCTCTGATCTGTTCTCCTTTACTACAATTT
TGTCATTAAAAAGATGTCGTATGAAGGAACCATGAACTATGTAACTTTTTGAGACTTCTT
GTTTCAGCCAACACAATGCATTTGAGGTTTACCCAAGATGATGTGTGTATCCAATTTGTC
CTTTTTTATTACTGAGTAGTATTCCACTGTGTGGAATTAGTCCACCTTTTTTTTTTTTTT
TTTTCCGCTGAGGAAGATTTGCCCAAGCTGACCTCTGTGCCAATCTTCCTCTGTGTTGTA
TGTGGGTTGCCACCACAGCATGGCCGCCAATGAGTGGTTTGGGTCTGTGCCTGGGAACCA
AACCTGGGCCGCCAAAGTGGACTGTGCTGAACTTAACCACTAAGCCACAGGGCTGGCCCC
ATAATTGTTCTTATTCATTCAACCCAAAACTCATTTATCAATTCCCCCAGTGAAAGACAT
TTGGGTTGTATCCAGCTTTGGGTCTACGACAGATAAAGGTTTTATGAACATTTGTGTTCA
GGTTTTGGGGTGAACATAAGAGTTCATTTCTCTTGGGTAAACACCCAGGAGTGGACAGCT
GGGTCGTACGGTAAGTGTACATTTAACTTTGTAAGAAAGTGCCAACTATTTTCCACCTGG
CATTCCCACCAGCAACATATGATAGTCCCAGTTGCCCTGCATCTTCGTCAACACTTGGTA
TTGTCAGCCTTTTAAATTTTAGCCACTGTAACAGGCATATGGGAGTATCTCACTGTGGTT
TTAATTTGCATTTCCCCAACGACTAATGATGCTGCACCATTTTCATTTTATAAAAATGGT
GTCATAGAAAGCCTTCTGTAATTTTATGTTTCTAAGGCTTTTTTACATTGTTGTCATTTG
TGTGTTTTCTGCTGCCTGGTACGTCCTTGTGGATACTAGAATATGGTTTTCCATTCTATC
ATCCGTGGGTATTTGTGTAGTTTCCAGATTTTCGCCATTGGGAATATCAGTGTCTGTGCC
TCCTAGTTATACAACAGCAAGAGTTTCCCAGGTTGTACGCCCAGGTGTTGAATTCCTAGG
TAGTAGGATACTCAAGACAGTGCCCAATTGCTTTCCCAGGGGGAAAGGTCCGCGGCTCCT
TCAGTTAACCCATTGCACAGGTGGGAGAGAGAAATTTCAGGGTGCAATGGGAGATAGGAG
CAGAGCGCACATGTGACATTCATAGTGGGTTGTGCCAATGCAAGACAAACGTCACCTCAG
ATTGAATCTCTCAACAAAGCTATTAGAGATTTATTTCTCGGTGGAAGGGAAGTGGTTAAG
GAGACACCAAAGTATCTGGATCAGAGAACAGACGTGCGAAGAAAGCGGGGATTGGAACCA
ACAATCAGCAGGGAGCTATGTAGCAGGGAGAGGCCGCAGGGCCAAAGGTGCTCACCAGTC
AAGACAGAGAAGGAGTGGAGGACGGAGCCTGTACTGTGACCTCGATAATAAAAGCTCATG
TTCCATGACAAGCGTGAAGAATCAGGTGACTAGCAGGAAATTTACATCTCTGAGGACAGG
AACCCTCCTTTCATTCATTCAAGGAGCCTATAAGGAAGAAATATCAGCTAGACCCCAGGA
GCTGATCTGGGAGAGAAGGAGACAAATTCAACATCTTCCTCGCCTTGCAAATATTTAGAA
CTAGTGGGGGAGGCATCGTGAAACAGCCGTGACATGAATCAGAAGGCAGCAAGAGCGGCC
AACCAGAAATCAACGGGGTGCGTTGGGAATCGCAACAAGTAGGAAGCTGGCAGAAGATGG
GAGAATCAGACTTTGCAGAAAATGTGGCATGTGAGCGGCGCCCCCACATAAGAACCGAGG
AGAACTGAACATGCCGATCATCAGAAAAGACTTGATCTCTTTACCCTCCTTGAGGAGGTA
ATCTACAAAATATGCACCACGGAATATCATACAGCACGGAAAAAGGATAAATGCCTGTTA
CATGCGACGCCACCCACGTGTGAATTGCAGAAACGTGTGCTGAGCGAGAGAAGTCAGACA
CAAACAGAGTACGTAGCGTACAATTCCATTTCTGTGAAGCGCTCGAACATGCAAAATGAA
TCTGTGGGGATGGAAATCAGAATCTAGGGTGTCTCTGGCTAGTGGTGGGCTGCAGCCAGC
TTGCCTCGGTCCATGGGTGCCTACTGTTCGCATTTCCAGCTTCGTGGGAACTGAAAATCA
GCCATGGTGAGAATATTGACACCACAGAAATGGGCAAATGCTGCACATTATAAGTCAGCT
TCCCCGTGCCCCCTCCCTTCCTTATTTCAAAAGCCCGCTGTTAAATATTTACCAGGATGC
CACTGCTGGCTGATTGGGGTGACAGGGCTTAACCGAATAGGGCACTAAGGAAACTCTCTG
GAGTGACAGAAATGGTCTACACCTTGTTCCTGGGAAGGGCTGCGTGTGTATATACAACCG
TAAAAGCTCAAGGCCTTAACACAGGAGACCTGTGTATTTATGACACGTAACGTACAGCTC
AATAAAAAAGACTGTGTGTATAGATATAGCCTAAAATAAAATTAAATGATGAAGAGATCA
CTTTGCAGAACGGAAAGAAAGAGGAAACACCCAGAGCTGGGAAAGGTCATGGCATGATCT
GAAGCCAGATAATGCATTCCCCCGAATTTGGGGTGAGTGGGTGGGAGCAATGAGAGGCAA
AACTGAAAAGGCTCAGCCGTGGAAGCGGAGGGGCGGCCCGTCTGGGAGCAGTTTCAATCA
GAGGAGAGCGGTGGTTACACCTTTGCATTTTTAGAGCACTCACATTTTGCAATTATGTAT
ACGTATATTATGTATTTATTTTTAAACATTGTATCTCTGGACCCCAGCGCAGTGTCATTC
ACAGAAATAGCATTGCAAATTAATTGTTACAAGAACGATTGAGGGGCAGCTGGACAGGAT
GTGGGCAGGACTGAGCCAGGGAGACGAGGGGACCCGGCTGGCCCCTGGAAGAGAGTGCTG
ACCTCCCCTCTGTGTTTATTCCCACGTGGTTTCCAAAGGGGCGCCCCACCGTGAAATGTA
CACACGTGCTCAGAGATGCAACAAAAAGAAAAGCGACGGGGGAGTTTTTCATGAAGTCAA
CTTTCTCCCGTTGAAATGACTGTCCTTTACCCTATGCCACCTACTTCCTCCTTTTTGTTT
TTTTCTTTTTATTGGTGTTAAAATGACCTTTCTCATAAAGCGGTGTAGCCGCTGTCGAAA
CGGTTTGGCGGTTCCTCAAAAAATTAAACATAGAGTTACCATAGGATCCAACAATTCCTC
TTCGGGGTAGCTATCCCAAAGAATTGAAAGCAGGACTTGCAACAGATATTTGTACACCCA
GGTTCTCAGCAGCATAATTCACAACAGTCAAAAGGCGGAAACAACCCAAATGTCCATCAG
TGAATGAATGGATAAACAAAATATGGTCCATCCACATAATGGGATATTATTCAACCTCAG
ACAGCAAGGAGATCCTGACTCCTGCTCCGCACANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTGTTTTAGAGGTGACGTCGGTCTC
CGGGTACCCCGCCAATTCCAGGATTTAAAAACCCGTCGAAGCATACAATTTCTTAGGGCC
TTGCTGCGCCTCTTTTTATTAACAGAACAGGGCGCCGGCTCTCTGGTCGATGGGGAAGTC
CAATTCAAACCGCCGCGATATGCCGCCACAGCATGCCAGGATGGCTAAAGTTAAAACGCT
TCCAATCCGCCCGTATGGGGAAGCGGCTGAGCGACTCCGCCGGACATAGAGTCCCGGTGC
GAGTCCCCAGGAAGAACGATAGCTGGCGGCTCTCTTCATAAATAAATATATCCTTGAGGT
CCCGTCCCACCTGCAGCGAGGGCGGTGTTTAGTGAAGGCAGCGGAATCGCTCATGCCTGG
GCGGGCACGGTGCGGAGAATCCTCGGTGAAGGCCTTGTAAGTGGATGGGGACGAGCTTCC
CGGACATAGGACGGGTAGGGGATGGGGACGGGGTCCCGGGGAAGGAATGAGGACGAGGGT
CCCGAGGAGGGAATGGGATGGGGATGAGGACGAGGGGCCCAGGGAGGAGACGGGAAGGCG
ATGGGAACGGGGAGGGGGTCCTGGGCAGGGGATTGGGAACCCGGAGACGGGGGATCTCAG
AGGGAGGGGCCGGCCCCCCAAGGGAGGGTACTGGGAGAGGGGGCCCTGAGTGGAGAGGGA
AGGGGAGGGGGTCCCCCGAGAGGAAAGGACAAGGGGAGGGGAGGTCCCGGAGTGAGGAGG
TGGTGGGAGGGTCCCTGCGTCAAAAGGTCAGGTAAGAGATCTCTCGAGTAGATGTCAGGA
AGCGGGAGCCCATAGCAGTGGAGTGGGAGAGGATCGCCGAGTGGAAAACGATGCAGTGGG
TGGTCCCTGACTAGTGAGGTCAGGGGGAGGGGGCCCAAAGAGGAAGGGAGGGGGGTCCTC
GGCAGAAGATGGACAGAGGGGTCCCTGAGTGGCGAGGATGAGGGGAGGGGGTCCCCGAGT
GGTGGAATCAGGTTGAGGGCGGGTTCTTGTGGGGAGAGGACCGGCTAAGGGGCCTCTGAG
TAGTGAATCAGGGCAAGGGGGGTTCCCTGCGGGGAAAAGATGGGGTGTGGGACCCCTAAG
TAGAGAGATCAGAGCTAGGAGGGTCCCTGAGTCGTGAATCCAGGGTGATGGGGGGAATTC
CTGATGGGAGAGGATGGGTGGGGGGTCCCAGGCAGTGGAATCGGAGTAAGGGGGGGCGTC
CCTGAGTAGTGAGGTCAGAGTGCAGGATCCTGATGGGGAGGAGTGTATCTGAGTGGTGCG
GGACAGGTTGAGAGGTCTTGGAGCAGGGGAACCCCTGTGGGGAGAGGACAGGGTGAGGGG
GGTCCCTGAGAGTGAGGATGGGAGCGAGGAGGGTGCCTGGGCGTGAGGATGGGGCGAGGA
GGGTGCCTGGGCGTGAGGATGGGACGAGGAGGGGCCCCCGGGAGTGAGGATGGGACGAGG
AGGTCTGTAGAAGACGAGGAAAAGGGGAAGGGTGGGGATCAGAGGGATCCCTGAAGGGGT
TAATGGGGGGAACCTGAGGGAGTGAAAGGACAAGGAGAAGATCCTGCTAGTGGGGGAGGG
CCCCCCCCCCGGAAGAGGAGAGAGAGATGAGGAGGCTGGGGAAGCCGGGAGTGAGGCGGG
TTTGGAGGGGGGGGGGTGGGGAGATGTGGGAGTGGGGGACCTGCTGGGACCCCTGAGAGC
AGATAAGCACGGACTCTGACTCGAACGGATTAGCAGAGCCTCTGGGGCGGCTGGGGAGGT
GCAGGCGGTTCCGGACTTGGGGGAGGGGTCGGAGAAAGGACCACGGGGTGGTGGGCTGTG
GGATGGTGGCATCGCACTGTGTGAGGTCTCTCCAGGGTGACGCCGCGGCCCCAGAAGTCC
CTGTGACCGCCCCGCTCTGTTCTCCATGTTGACCAGAGCGAGCCGGTCCCAGAGGCCCCT
GGCCGGGGTCGCTGGCTGTGCTTGTGCTGTGACCTCGCGAGAACCAGGTGTGACCGGCGA
ATGGTCCTGTCTGGCAGTGTGGCCTTAGCCCGGATGAAGGATGAGGATCTTGGCGGTGTG
TGCGCGAGCTGGCATCTTTCTCCGTCTCCGCGCGCACAGCTCCACGCAGGGACGTTTTCT
CCTTTCCACAAATCCACTGCTCACCCTCCTACGGGAGAGTTCTTTCCTCATCTGCTCTGC
TCTGTCTTTGATGTGGTTTCTGATTTCCATCCCTTCCAGAATTCCCCCAGCAGAGGAAGC
CAGCCGTTGGAATTCCAGGGTTTTTTTTTTATAACCACAGTTGAGTTGCCATTAAATTTG
AAATGGATTAATCAGCTGACCCCAGGTTGCATCTTAGATGTCATCAGGGCAGGGCTGCAG
ACCTTGCAGAGTCTGGCCTCAAAGGCCACCTCGTCAGGCCCACGGGGCAGGACCCTGGGC
CCATCCGTTCATTCTTCTGCTTTCCCTCTGGCGTCCGTCAGGGTCCTCCTCCTTTCTTCT
TTGTTGGGTCTTTGTTTACCAGGCATTCACTGAGCACAGGCTTTGCAGTCGACAAGGACC
CAGGTTGGAGTCCAGGCGTGCATTGTGACCCTCCGGCAAGTTACTCAGCCACTCTGAGCT
GTTCCCTCCTGCGTGGGCTGGGGTACAAGCGCCCACCCCCCGGGACGGTCGAGAGACTTC
AACGAGATGGTGGTGTTTGCAAAGCTCTGGGAGTGGCACCAGCTCCCTGCCTTCCAGCCA
CCTCTTTGCAATACTAGCTCACTGGCATCGCCCGGTGACCGTCATCTCGCCGGCCCCCCC
CCCCCCCCCCGCCTGTGCGCCCTTTGCTGTCACCTCTTTAAGTTGGAGGTGAGTTGTGGC
TGAACTTGGGCATTCGAAGGTCCCCGAGAGAACCCCCAGCTCCCGGCTTCATCCCCTGCT
TGAGTCCCTCACCCTAAACCCCCTCAGGAGTTGGTGGCTGAGGACCACCCGAGGGCGCCC
ATTCTCCCTCAGACACTCTCCTTAGCTGCACACGCTGTCTGCTCCACCAGCCCCCCCCCC
GTCCGCAGCCAGCACTTGAAGTGTGTCTTGTCCAAATTCTGGGGAGCTGCTGGTCGTATA
AGATGCGGCCCGGGTTTCAAAGACCTAAAATGAAAACAGGTAAAAATGGGTATTCATTAA
TTTGTTTATATCGATTACCTGTTGCAAATTATATTTTCGATGGGTTAGATCAAATACATT
AAAATTAGTTTCACCTGATATGTGTGTTTTTGACGCGGCTGAGAGATTCTGAATTGCACA
CGTGGCTTACGCTGGGTTAGTTCTCGTGTGCACTGAGCTGGGGTCGGCCTGCCTACCCCA
GGGAGCTGCTCCCTGCTCCAGGATGTGGTTCAAAGTCAAGGCATTAGTGAAAATGGCTTA
TTGTCAAAATTTCCTTTGAAGATTCCTGGAATCACCCAATAAAGTGCTATATACGTGGTT
GGTCTTTAAATGCCGCGTGCAGGAATGTGCGTGCGGATGAATGTCGAACGTGCCGTGATG
CCCCGGATATGGGAGCGTGCACCTGGCCGGGAATGCTCTGGAATTGTCTGCAGTGTTGAA
ATTCCGCGCCTCTCCTTCTCCCCCTCCGGTGCCTGTGTGCTGTCCCTGTAAATTGAAGTC
ACTGATGCTGCCACCTCCGTCGTCTGCCCATCGGTTCTCGTTCTGTGCCCTGAAGCCACT
CAGAACAAGTCTGCTCCTGCTTCCTGGCCTGGGCCTTCCCTCGCCCGACCCCCCGTCTTG
TCTCCCCAGTTCCCTCGTCTCCTCCCGACGGGGTCTGGAGCCCTTGTCTCGGGAAGGATC
CTGGGTCTGAGAGCAGAGCTGGTCCTCTGGGTGCAAGGTCCCTCCTGACCTTTGTGTGCA
GGGAGGGGGCGGCCTTGGCTTTGGGTCAGCCATGCGTCTGTGGGTGGTCTCGCTCTCCTG
CTGGGTCGCGGGCCCCTGGAGCGCGGAGTCAGGTCCGATCGCTCCCTGCGTCCTGCCCGC
CGCCAGCCCGGGGCTGGCACACAGCAGCCACCCGGCGCCCCGGGCTGCCATTGGGTCGTC
TCCGCGGCTCGCGGCCCCGCCGCTCACCCTTTGCCCTTGGGTCTCTGCAGAGCGAACCTG
GTGGACCTGCAGAAGAAGCTCGAGGAGCTCGAGCTCGACGAGCAGCAGAAGAGCGGCTGG
AAGCCTTCCTCACCCAGAAGGCCAAGGTCGGGGAGCTCAAGGACGATGACTTTGAGAGGC
TCTCCGAGCTGGGAGCCGGCAACGGCGGGGTGGTCACCAAAGTCCAGCACAGGCCTTCGG
GCCTCATCATGGCCAGGAAGGTGAGCGGCGGCGGGTGGGCGGGCGGGCATCTGTCCCCTG
CGAGGGGTCCGTGGTGGTGGGGGAGGGCCACATTCCCAGAAACGTCCTGCTCGTGGACTG
GCTCAAGAAAGGCGGCGGGTGGAGTTTTCTGGAAGAAAGGAGGCAGATCGGGTCCCCATA
GCACGGGCATCACACTGACTCCACAACCGAGGTAAGCTCCGCGGGCCCGAGACGGGCTCT
GCCGCCATGGTCACGTCGGGGGGGGGGCGGTCCCTTGGCGATGGGGCAACCAAACTACGT
GTACTAGTCAGAGTTCTCCAGGAAGACAGAACCACTGGGGCGTGTGTGCGTGTGAAGAGA
GAGGGAGATTTTAAGGAATCAGCTCACACAATCGCGAGGGTGAAAGTCTGCAGGGCGGGC
TGGGGGCCGGAGGCCAGGGAAGAGCTGAGGTTGCAGGTTGAGTCCAAGCCAGTCAGGAGG
CAGAATTCCCTCTTCGTTCAGGGCGCTGCCGTCTTTTCTCTTGAGGCCGTCACCTGATTA
GTCGAGGCCCACCCACTCACGGAGGGTCACCTCCTTTTCTCAAAGTCTGATGATTCCCAT
ATTAAATCACATCTGAAAAATACCTTCATAGTGACCTCTAGACGGGTATGGGACCCAGCC
CTTGGGCGCCGTGGCCTAGCCAAGTGGGCGCAGGAAATCACCATCACCCCACCCTTGGAG
CAGCCCCTGGCGCTGAGCCTCTCTCTTCTGGGCTCCCCCGCCACAAGGCAGCCTCGCGCT
CAGCGTGCGGGAACCGTCCCTGGGAGACGCAGGGGGTTAGAAGGGAAGGATGTGACCATT
TGGGGACAGTGGCTCCTAAACACGCTGACGGGGGCCTTCGTGTGGACAGGTTGTTTTGCA
CATGCAGGCGTGTTCTTTGAGACATCAAAAGCCGCCTCTTTCTAGAAGCCCATCCCCCCT
CTAGTTCCCAAATTGTGTTCTTGGACACCTGCCCACCCCGTGCCCGGGCGGGGCCCGCCT
TTGGCTCCTGAGCACAGGCTTGGTTTCTGTCGGGATCCAGCACTGCCTGCTGCTGTGTCT
CCTGCTGCTGGAGCGCCGCCCACCCCCAAAATCTCCCCCCAGGCAGCCTCTGCCCAACCA
GAGCCGCCTGGAGTTCACCCACGGCTTTGTGACACCCTGGGAAGCCGCAGTGAGGAGTTT
AAAACTGCAGAGGCCAGGGGCCGGCCCGGTGGCGCAGCGACTAAGTGCATGCGTTTGCTT
CGGCGGCCCGGGGTTCGCCGGTTCAGATCCTGGGTGCGGACATGGCACCGCTTGGCAAGC
CATGCTGTGGCAGGCGTCCCACATATAAAGTAGAGGAAGATGGGCACGGATGTGAGCTCA
GGGCCAGTCTTCCTCAGCAAAAAAGAGGAGGATTGGTAGCAGATGTTAGCTCAGGGCTAA
TCTTCCTCAAAAGAAAAAACCAGAGAGGCCAGATGAGTCCCGCCATCCAGTGGGCCACGC
CGTCCCCAGTCAGTTTCCTGGTTTGGTACTGTCCTTCTGTCATAGATGTCACCATCGGGG
GACGCTGGGTGAAGGGTACACGGGGACCCTCTCTGTTGTTTTTACAACTTCCCGTGCTTC
AATAATTCTTTCAAAATGAGGAGTTAAAAATAACAGGTGCAAAAGAACGCAGGGCGGAGG
ACCTCAGATTTTGTTCCCTGTTGATCGTCACCTCCTGTGGTTGCCACAGTGTTGAAACCA
GGCGCCCATGTCCATTTGGTGAACGCACTGAAGGACAAGGCCGGCTCCCTGGCCGTCGTG
TGGCTCGGGACTGTCACTCCCCGGGGGCCCGGGGCCCTCGGCCAGCCTGGGGGGTCACGG
GCTCCTTGCGGTCCCTCTGGAATGCCGGTTCACCCGGGAGCCTGGTCTGCCGGATAAAGC
TGAGGGCAGACTCAGTTTTGAAGTAACAAACTGGTCCAGGAGTCAGTGGCCTCAGTCCTT
CCCCCACCATCCGGGCTGGACTGGGCTGGGCGCTTCTGGAAGGCCATGGGGATCCCGCGG
TGCGGCCAGCGTCCTTTGGTGCCAGCATCCCTCCGGCCCCTTGGATTGGCAGAGGATTGT
CCTAGCCAGAGTGACACACCAGGAAGGTGACGAGCCCAGCTACCTAGGAGCTGAGGAAAC
CGGTCTTGACTTAGACACTCGTGCTTGTTCAGAGACGCTTTCTCGACTCAGGCCTAGTGC
TCTGGCTCCTCCTGCATCCCTCTGAGGGGCCCAGGAACCGAACTTGGCCTTGCCAGGGCC
GGGGGAAATCCGCGAAGAGTTCAGCCTGTTGGTTACACTGACGGGGCTCCCCTCCCTCGC
CTTCCCTGTCCCCATGGCAAGGGAACGTTTCTCCGCCTTGCGTTCAGCTGCGCCTGCTTG
CTTCCAGAAAGGACATTCTGGGGCCGCCCGGCGGCACAGCGGTTAAGCGCGCGTGTTCCG
CTTCGGCGGCCCGGGGTTCGCCGGTTCGGATCCCGGGTGCAGACCTGGCACCGCTTGGCA
TGCCATGCGGTCATAGGCGTCCCGCATACAAAGCAGAGGAAGGTGGACACGGATGTGAGC
TCAGGGCCAGTCTTCCTCAGCAAAAAGAGGAGGATTGGCAGCAGTTAGCTCAGAGCTAGT
CTTCCTCCAAAAAAAAAAAGAAAGGAGGTTCTGTGACCTGCCCAAAGCCACATAATAGCA
CCAGCTGCCATCTTTCCCCCCAGCTCTGCCCACCCTCCTCTGCTTCTCTAGAGCCAAGCG
GGGTCTCGCTCCTCCGCTCCTCGTTCCTCTGTGGCTCCCTTGAGGTTCTTGCTCGGGCGC
TGCGCCGTCCACGACAGGAGCCTCTGAAACGCGGTGGCTCCCAACCGAGGCCACCGTCCA
CGTGGGAAAGCTCCAGGTTTCAAGGGCTCCACGTGGAAAAAACCTCATTAACATTTTTAC
GTGGATCACGTCGGAATGGCAATTTTTTGATAAAATATGTGAAAAATCCGTTTCACCTAT
TTCTTTTGACTCTATTAACTCGGCGGCTAGAGGATTTAAAATTCAGTGCACGGCCCGTGT
TGCGTTTCCGTTGGCCAGCGTTGGCCTCTGTCCCCCTCTCTGCCCTTCGTCAGCCTCGCC
ACACCCGTCCTTTCTCGGCTTTCTGAGCGGACCTCCCGCCCTCCGCACGGCTTCACCTTC
ACGCCCAGCTTCTCGCCCCTTCAAAGCGGATCTGTGTGTGCATTTTGGGTGTCACCCCAT
GGATGCAGTCCCGCGGGTGGGAAGAGCATCCTGGCGTCTGGGGTGACCCCGCTGTCCTAA
AGGAGTGCCGTGTCCTGGCGTCTGCAGCTGACCTGGGTGGAGAACCTTCAGCTAGAGGCC
TGGAGCTTTGCCTGGAGAACTTGCTGCTGGAACCTTCCGCAGTTCTCAAGGTCGTGAGGG
TCATCGGCTGGGGCTGTGAGCAGCTGGCACGCCCCACACGTGCCCTGTGCCCCTCGACCC
CGGCACTCCCCCCTTCATGCCTTGGTGCCTTCGAACAGGCGGCCCTTGGTCCATTTGGCT
GGCTCCTGCCCGTCCTCCGAGGCCGGCCCCCGTGTCACCTGAGCCCCCATCAGCTTCCTG
GGGTTCCTCTGCCGGGGGCACCTCCACTGTACCGAGACAGCTCCACCGGCCTCTCTTGCC
CGGGTGGCGTCTCCTCCGAGCGGGGCGTCTTTGTCGTCTCTTTCTCCTGTCACCGGCCCC
ATGTGCGGTCAAGTCTATGCAAAAGTCTGTTGAATTGATGGCATCGTTTTTAGATGCCTG
TGGTCTGGCTCTGTGTCTCTGACAAGGGGCGGAAGTCACCCTGTTCTTGTCGTATCGCGA
TGGCCGGGGTGTCCAGGATTCCAAGTGGCCGGGCTGTGGCCCGATGGCCCCAGCTCTTTC
TTGGCTCGCTGGGGGTCTGCAGTCGGGCGTCGCTCCTGGCATCTCGTCGGCTGTCTTTTC
TGCCTCTCTCCAGACCATCCTTTGCTTTCTCAGCTTTCGAAACGCCGTGGGGAGTTTGGT
GACGTCCCCTCTGCCGACTTGAACTCACGGAAGGGGAGCTGGGCCCCCACGATGGCGATG
GCGACCAGAGCCGCTCTGCCTTGTCTCTGGCCTGGGGGCGGGAGGGGCTGCGGGGAAACC
CACCCTGCCCGAGAGGGCGCAGGGGAAGCACTCGCCCCTTGGGGGGCATCGCACCGGCTC
CTGGGAGAGGCTGGATCTTTCTGTGATTGGGTGGGAAGAAAGCTGCTCTTCACAGAGCCG
CCTGGAGCTGGGTGAGACATGTTTGCTCCAGCGATTTTTTTTTAACAGGTTTATTGAGAT
GTAATTCACGTACCGTACAATTTATCCTTTGAGAGTATAGCGTTCACTGGTTGTAGTGTG
GTCACAGCGCTGTGCGGCCGTTGCCACCATCAATTTTAGAACATTCTGTCGCCCCAAATA
GAAGCCCCGTCCCCATCAGCATCACCCTCAGCCCCTCCCCAGCCCCTGGCCCCCACGAGC
CTGTGCTCTGTCTGTGGATCAGCCTGTTCTGGACGTTTCCCGTCCATGGGGTCACACGCC
GTGTGTCCTTCTGTGTCTGCTTCTCTCCGTGAGCGTCGTGTGTGCAGGTCCGTCCACGTG
CAGCCATGTCAGGGCCTTGCTCCTCTTCATGGCCATGTAATATTCCAGCGTGTGGCTGGA
CCCCGCTGTGTGTGTCCATTTGCCACTGAGGACACTTGGTTGCCTCCACCTTTTGGCTGG
TGTGAGTCGTGTTGCCGTGAACACACGTGTGCAAGCTGGTGCGTGGCCGTGTGTTTTCGG
TTCTTAGGTGGATGCGCACCTGGAGCGCACTGTAGGCTGGCCTTCGCTGTCACAGCACCT
CCGGGCAGACGCCCCGGGCCCCCCTCCGCCAGCGCCCCTCTGCCGGCTGGTCTTGACCCG
CTTCGCCTTCCTTTGCAGCTGATCCACCTGGAGATCAAGCCGGCCATCCGGAACCAGATC
ATCCGCGAGCTGCAGGTACTTCACGAGTGCAACTCGCCCTACATCGTCGGCTTCTACGGG
GCCTTCTACAGCGACGGCGAGATCAGCATCTGCATGGAGCACATGGTGAGCACAGGCGGG
CGGGACAGGGCCGAGGGTGCCCGGCGAGAGGAGCCCGCCCTGCCTGTGTCCCTCCAGGCC
ATCCTCGGAGGCCCCAGCACAGCCACCTCCAAGGGGGTCTTTTGGGGGCGGTCGGTGCCC
ACATCAGCATGTGTGCACGTGGCGCCTCTGTTTCTTAAACACCAACACCGTCTTCCCACC
TTGCCTTTCCACCTGACGCGTGCCGGAACTCCTTCCCTGTCGGCGTGTAGAGAGCCGGCT
CTGGCTTTTGCCCTACCTTCTGCCCAGACGCGGATGGTCATGGACGAGTCCTCCAGTGTG
ATGGCTGGGCCAGGTCCACGTGGTTAAGCGTTTGCCCAGGAGAAAGTGGCGGTCCGGGGA
GCCTCTTGCAAGCCGGGCCCGGCACGCAGCGGCTCAGAGCTGTGGAATCAGGCCCCGGGG
TGGAGGGTGGCACCCGTCTTTTTTTAAACCGCCACGGTTGCTTCTGATGTGTCTCCTTGT
TAGGAAATGCTGGTCTTGAAGCTCAGAAATGGGTGGGATGGGGTGTCTGAAAGCAGAAGT
GGTCAGAGCTGAGGGCCGGGGGAGGAAACGCTGCCGACCCTCTGCCAAGTGCGCCGGTCA
CGGATGACGCTGCCTGCCGCCCAGTGTCCGGCTCAGGCCCACCGGGGCCCTTGCAAAACC
AGGATGCGGCGGGGCTGGAGGCCGCGCGCCTTCGGTTACGCCTTCCCAACGCGCCGTCCC
CTCCGACGGTTTTGTAACGAAGGCAGGAAGCGCATTTGAGCAAGCGCCGGGCGGCCTCGA
GGAGGCATTGTGAGCGGGCGGGCAGGTGGCGAAACAGCTTCAGAGGGAGTGCCAAGGGGG
TGCTCCCCGCCTGGAGCCCCCTCCTCACCTGGGGGAGGGAGACCATGTCTGCCCACCCAC
TTGGCAGAGGCACCGTGCAGACGGGGCATCAAGGGGCACAAAAGGGCACGAAGTCACTTG
GTAGTCTGAGGGAGCCACCTCTGTGCTGTAGCTGCCCCTCCCCCCTCGGCAGACCTTTCC
AGAACAAGAACCCGAGTGAGGGGGGACAGTGACCAGGATCGCGATGGGAGGGAGAAATGC
AGCGGGGACAGAGCACGTGCGCCGGGACACGCAGGCTCTTGGAAAATGGGGAAGAGCTGA
CGGGCTGAAGGCCCGGAGCGTGACGTCCAAACGGCCCTGGAAGGACTTACGGACATGTAC
GAGCGAGTCCCCACGAAGGAGTTGGCCATGGAGTCGATGAGCTGCCCGCTCACCCCGAAA
TCGCACAGCTTGATCTCCCCTCTGGAGTTGACCAGGATGTTGGACGGCTTCACGTCTGGA
GCAGAGTTGGCGGGTGAGGGGTCGCTCGCAGCACGCCCGCCGCCCTGCTCCGCTCTACCC
GGGAAGGTGTCCGTCCGTCCGTCCCGTCCGTCCATCCGTCCGTCCGTCTCATCTCGGTGC
ATGATCTGGTAGCTTCCTCCCGGAGATACGCCAGGCCCCGGGAGCACCTGCGGGAANNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNGAAGGGCAAGTTAAGGGTTGTACCTCCAAGAAAGGGGCAACCTGGGTGAGGAA
AGCCACGCGGAGAACCAAAGTGACAAGTAATTCGACGGAGCGGGAGGGCGGCCTCGAGCA
TGGAGAGCTCCTGTGTTGAGGGTGTCTCTGCCTTCCTTCACGCGCTGCTTCGTATGCCCT
GGGGGCCCAGGAGCGGTGGCAATGGCGCCCTGGAGTCGGGCCTCAGCTTGGGATCAGAGG
GCCTGCCTCCCGGGCCCGGGCATGCCGAACACCGGGTGAGGACCCGCCGTCGCTCCGCCG
TTTCCCCGTGTGTCGCGTGAGCTTCGCTTCCCTTCCCGTCGCCATCATGACACGCCTGGT
CGGCCTCCCTGGTGAGGACCAGGCCTCGTCCGTGGGTTCCCGTGCAAGTCGGCTCCTGTT
TCCAGTTGGGAGATTCCAGCTCCAGCGTCGGAGACAAGACGTCGTTGGTGACGGGCAGCC
CCAGTCAGCACGGGAGGTTCCCCCGCCCGCAGCAGGACTGGCGCCCGGGACCCAGAAACT
GCAGGGCTGGCGCGGCCCCGGAGGCCCAAACCCGCTCCCGGGAGCGCCCCGGGCATGGCC
GCAGCGGACGGTGGGCGTCTTCGGGCCGGGTGGCTGGGACCCAGCCGCTGACCTGTGCAC
CCCGTTGTCCTGTGACAGCGAACAACACGACATGTGCAGTGGGGGTGACACCAGGCCACC
TTGCGGAGGAGAAGCGAAGTCAGCGTGTGGGCGGACGAGGGGACCCGGGAGGGAGAGGCG
GGCGCGAGCCCGCCTGTGTGTGTGACTCAAGCGCTGTGTTCCCTCTGCGCATGGGTGAGC
CAATGCACAGAAGCGTCTGGAAGAATATAAGTCACACTTCAGGGAGGCGAGTGGACTCCC
GGGGCGTCAGAGTGCTGTTTACCTGCATTTGAAGTTCGATAAGAAAAACGTGCTCACCCA
CCACCTGCTTTACAAAGTATGGCTTCAGGAACACAGAAGCGCACACGAAATGAAAGTGTC
TAGTCACGCTTGAAGAGTGAGGTTCGGGGTCAGAGAGACCTACGTGCGCTGTCTCCTGCG
CCACATCCTGTCCACGTGACCCGAGCGAGTGGCTCACTTCACTCTCCTGGCTGTGGACCA
GGGTCTCACCTGCGGGTGGTCCTGCCCCCGGGGGACACTGGCCATGTCTGGGGACATTGG
TGGGTGTCACACTGGGGGGGCTCCTGACATGAGGTGGGTGGGGCCAGGGATGCTGCCCAA
CCCCAGACAGCCCCTCAGAGATGACTGGGCCCCCGTCGCCATGCCAGGTGGGGGCACCCT
GCCGTGAGAGCGTGGTCCTGTCCCCGTGCTGCGGGCCGCCGTGGCCTCTCTCAGGTGTTC
TCCAGAACATTCTCACTCGGCACACATGTACCCAGCCCCGTGAGAAGTCAAGAATGAAAG
GGGCTGCGTTGGGGAGCAGGGATCACAATTAAAAAGCAGGTTTTTTTTTTTAACTTAAAT
TCTTTTAAGGTTGATTGATAAAACAGAAAACGAAAAGGCATTCCTGTCTGGCCCTGTGGG
CAGAGCGGGCCCGGGCGGGCACCCTGGCCAGACCAGGCTCACCAGAGCGCCGGCCATGGG
TGCCTCGGCCACACCCACCCTCTGCGCCCGCAGCGTGGAGCTGGTCGAGAGTCATGCGAA
AGTTCAGACTGAGTTGAGTTTTCTAGAACTCCACTCGGCCTTTCTCCCGAGCACGGGTAG
GGCGGGTGCCAGGACAGGAGACCAGGCCTAGAGTCGCACAGCGGAGGGAACCCGGCTCTG
GGCTGCCCATCCGTGACTTCAGGTTCTGGCCCCAACTTCATCCCCTGCGTGCCTGGCCAT
TGTCCCCTCGGGGGCGTGCAGGGCGAGCACGGCAGGCTCTGGCCAGTGGTCAGGACCCAG
CCGTGTCCTCAGAGCCCCGCCCCTCAGAGGCACCTTGGGCTGGAACCGGTGACACGCTGG
GCTTTGGTCTCCAGGTTTGCTGTCGGGCGACCTTGCACGAGATGCTTGATTTCTGTCGTC
TCCTCATTATCAGTGGATTTGGGGCCCCACCCGGGGTGGAGGGATCGACTGGGGTGACCC
ATGTCAGGTCCTTTGTCGGACGCTCAGTGCACAGCAGTGTGGAGCCAGTGACAAGCTGAG
GGAGAGGGCGGAGCTGTCACTTCATCCTGGAGCCCCTTCCTGGCGGGGCCAGGTCGTGGA
GAGGAGGGGCAGTGGGCTCGGCCTCTCCTGCACCACTTCCAGGTGTCACTCCCCTCCACC
CCGACTCGGGCTGCAGCGCCCGCTGGGAGGGGACCCTGGCCGCAGATGCTGGCGGGTCTG
GCTTGGGTGTCCTCACAACCACTCCGGTTGCAGGCCTGGCAGCCACGCGGCCCTTGCCTC
CGTGGCTCTCCCCGCCGGCTGCTGCCGTGGCCACCTCGAAGCTGAGTCACCACCAACCAC
GGGCCCTGGTCCCAGGAAGGCCGGGCCGCCTGCAGAGCGCCCGGCACCCCTCTCCTCCCC
CTTGTGGGGCGCACCCTGAGGCCCAGAGGCGGAGGCGCCAAAGGAGGCCTGCGCTCGGCC
GTCTCCTGGGGGGGAGGGGGTGGAGCTGCAGCGCCCGGGGATGGGGGTGCCCATGTCCTG
CCACCGTGGCGGCCCGGCTGGCCGATGGCTCAGAGCGGCCTGCTCTCTCCTGTGCCACCC
CCAGGACGGCGGCTCTCTGGACCAGGTGTTGAAAGAAGCCAAGAGAATCCCCGAGGAGAT
TCTGGGGAAGGTCAGCATCGCGGTAAGTGTGTGGCCCGCCCCCGGCCTCCGCAGCCCTGG
GCGCTCACAGGAGCCTGCGGGGGGCAGGTGCCTGAGCCCCCAGCACGGGACCTCATGGCC
GTGGCTTCACTGCTCTGCACACTCGCCCCGGAAGCAGGTCCCTGAGCTTGTCCCAGATGC
GGGGGCCACTCAGGTCGTGCCCGTGGGCCTGTCCGGAGAGGAGGCCCCCCCCCCCGTGCT
GCCCTGCTGACCCGCCCCCGTGGCTCCCCGCAGGTGCTCCGGGGCCTGGCGTATCTCCGG
GAGAAGCACCAGATCATGCACCGAGGTGAGACGGACGGACGGATGGACGGACGGACGGAC
GGACGGACACCTTCCCGGGTGGGGCGGGGCAGGGCGGCGGGCGGGCTGCGAGCGACCCCT
CACCCGCCAACTCTGCTCCAGACGTGAAGCCGTCCAACATCCTGGTCAACTCCAGAGGGG
AGATCAAGCTGTGCGATTTCGGGGTGAGCGGGCAGCTCATCGACTCCATGGCCAACTCCT
TCGTGGGGACTCGCTCGTACATGTCCGTAAGTCCTTCCAGGGCCGTTTGGACGTCACGCT
CCGGGCCTTCAGCCCGTCAGCTCTTCCCCATTTTCCAAGAGCCTGCGTGTCCCGGCGCAC
GTGCTCTGTCCCCGCTGCATTTCTCCCTCCCATCGCGATCCTGGTCACTGTCCCCCCTCA
CTCGGGTTCTTGTTCTGGAAAGGTCTGCCGGTTCCCTCCACTGGCAGCACAAGTCGGGGG
ATGGGGGCAGCCGTCAGTTAACCCTGAGCCCTCGAGTATCTCAGGAGACGTGCGAGGGTC
CTCACAGCAGACTGAGAAGCCAGTCTGGGGGCTGTTGTGGAGGACAGCAGATGGCGCGTC
TTTATGGGGCCGCTGTGGGCGCCAGCTAGTGGCTTCTCCATCCCAAGGCGGGCCAGGGAG
GCGGCACTGCTTCCTTTCCGTTGGGGGTCTCTCGGGGCGTGGCGGGGCTGCAGGGGGAGC
ATCAGGGAGTCCGACGCCCCCTGGTCCTGGTGCGCTCGGGGTCCCAGCCACCAGCCGTGC
CCTCCAGGCGTCGCCGTTCTCTGTGTCGCCCGACAGCCCGAGCGCCTGCAGGGCACGCAC
TACTCCGTGCAGTCGGACATCTGGAGCATGGGCCTGTCCCTGGTGGAGCTGTCCGTCGGC
AGGTACCCCATCCCGCCGCCCGACGCCAAGGAGCTCGAGGCCATCTTCGGCCGGCCCGTG
GTTGACGGGGCGGAAGACGAGCCCCCCAGCACCTCGCCGCGGCCCAGGCCCCCCGGACGC
GCCATCAGTGGTATGCACACATCCAGACTCTGGTGAGAGCGGTGGTGGCCACGGGCACGC
GGGCCCTCGGCCCCACCCGTACCCCGGGGCCGTGCCCACTGTGGTTAGCCGTCCTCGGCC
GGTCCTGAGGCTTCTGGGGACAATGCTGGAAGCAGCGCCCCAAAGCTGTTGCGGCCGGGC
AGCTGCACCTGTCGGCGCCAGCTGGCGGCTCCACAAGGCGGCTCCCCGGCCAAGCCCACG
GCTGCTGGGTTTTTCCAACATTTTCTGCAAAGCTGTTCAGACAGACAGAAGAGCGGGAAG
GGTGGCCCCACGAGCACCCTCCTCCCCCCGCCCACATGCTGCCTTTCGGGGAGCCCCAGA
CGGGACTTGACTTGGACATCCCCTGGGTGGCTGGTCGGATCCAGCCCCGACCCATGGCTT
GGCGTGGGGGACAGGAGGCTCGGGGCGCCGGAGACGGCTCTCGGTTCCTAGGGCGGCCGC
CGGGGAGGTTGGGTCCCGAGTGCCAGTGGGCGTCAGGCCACCATGTCAGCCAGTTCCGGG
GGTGGCAAGGGGGCAGGTCACAGCTGAGGTGGCCTAACTAGGAAGCAGCACGTAGGGCTC
TGTGTGTGTGTGTCTTTAAAGGACGGGAAAAGAGTTGAGTTAAACGGGAGTCCAAAGGAA
CATTCCGTGTACTGTAGTTGGTCTCTGTTTGGTGACAGCTTTATTGAGATGGAACTGACA
CCGTAGGATTCACTTATTTAAGGCGTACGATTCAGTGGATTTGGGTATCTTCACAAGGTT
CTGCAACCATCACCACAATATAGTTCCAGAACATTCCATCACCCCAAAAAGAAGTCCACT
CCCCATCAGCAGTCACCCCCCCAACGCCTGGCCCCCACGAGCCCTCTCTCTGTCTGTGGA
TCTCCCTGTTCTGGACGTTTCACGTCCGTGGGATCACACGCTGTGTGTCCTTCTGTGTCT
GCTTCTCTCTCTCAGCGTTGTGTGTGCAGGTCCGTCCACGTGCAGCTGTGTCAGGGCCTC
GCTCCTCTTCACGGCCACGTAATAGTCCAGTGTGTGGGTGGACACGCTATGTGTCCGTTC
ACCGCTGACGGACGCTTGGGTTGCCAGCTGGTGATTTTACCAGTTTTTTCAAGCCCAGAC
CCTCCCCTTTTCTGCTGCCACACTCAGAGTGCTAGGGGGTCTTGCTTTTCTCCAGGAGGG
AGCCCCCTACCCCCAATCTGTGTCCTGAGGTCCCCGCTCCGCCCCTCCAAGCTCCCAGAT
GGCACAGTGGGCGTCCCACCGTGACCCCTTCCTTGTGGGGAGGACCGCTGGGCTGTGCCC
GCCCGCCTCGGCCCGCCAGCACCTGCCCCGGCCCACGTGCCCATTTGAGGACAGAGGACA
GAAGGCGAAAGTCCAGCTGCCAAACCCGGACCTGGCCAGCTGGGTCTAGGACAGGGGTCA
GCCGCCCCCGGCCGCCCGCCCGCGCTCAGCGGCATGTGGGGCCTGCTGCCGTGTCCGTGC
AAGGTCACACTGCCGTCCTTGCTCTCGGTCAGCTCCCCCACGCCCACCTGCGTGCCAGAA
AGCAGGGGTGGTGGCCTGGGCCCGGCCTGGCCGCAGCACGGGGCTGAATGTGTGACTTCT
CCAAAAGCGCCCCTGTGCATTGTGGCGTGTTGTTTTGTTTTAATTCGCCAGAGGCTCAGA
AAGCAGTGACCATCCCAGGAAGGCGGTGCGGGAGCATGGCCGCCCGGCTAGCGGGGGCCC
CCAGCTCAGGCGGTGTGGGGAGGAGGGCGCCGGCCACGTCCACACGACCCAGAAGCCGGT
GGGCGCGGGGCCACCTGCCTGCCTCACCGCTGTCTCTCTCCCCCCGGGCAGGTCACGGGA
TGGACAGCCGGCCGGCCATGGCCATCTTCGAATTGCTGGACTATATTGTGAATGAGGTGT
GTATGCGCAGCCCCCTCGGCACGTCTTCACAGCGACGGAACTAGGCCGTTCCTGCCAGGA
TACGGCGCTGAGAAGGAGAGAATGCCACGCGTAGACGTGGGTCTCGATGGGGAGGGAGAG
GGGTGTCCGTGTCACTAGGAGGGTGTCAGCCATACCCATAGGTGACTGTCCTCCCTCCAC
AACCCAGATCCGTGCTCCCCAAGGGACGTCTTGTTGTTTGTGCAAAACTGAGCCCAGAAT
TCCCACGGTGGCCGCTCCGAGGCCTGTGGCCGGGTGCTGGGCTGGGAGCCTGGCCCTCCC
TGGAGCTCGGACACCCAGAGCATCTTGGAGCCCTGGCACAGGGAGCCGTAAATGATCCCG
CCCCCCTGGGAAGGTGCAGGCCCGGGCGCCCCTGGAGAGGAGGCGCGGAGGCCTGCGGGC
CGGCCGTGAGCGGGTGGTGCAAATGTTCCCCGTGAACAGACTAGTAAACTGAGGCATAAA
GAGGGAAGCTGCCCCTTCGCGGCCTGACCCCACAGCCCGCCTGCCCTCGGCACACCTGCC
CGCTCCCTGGGCCTTCTGGGGGCTGCCGGATGTTTTCCGCGGCCCTTCAGAGTCCAGGAG
AAGTGCGGCCCAGGGCTGGGTGTTGAGGTGAGTGGGTCAGAGCAGGGCGCCGTGGCTCTG
GTGACAGCTCTCCCTGCACCTCCAGCAGCGCCTGGCCCAGCAGTCCTCCAGAGGCCACCA
GCCCTCCCAGCCCTGAGCTGGAAGGTGGGCCCAGGACTTGGGGACACAGAGAGTGGAGGA
GGGGTAGGCACTGTGGGTGTCACTGGGACAGTCTCTTCCCCCCGCCATCCCTGATGGGCC
TGTCCCCACCCCGGGACATGTGCCGGGCCAGCCCCTTGGGGTCCTCAGCATTCGGGCCAA
GACCTGGAGCTGGCTGCCCTCTGTGTGGTCCAGGCCCACTGCTCCTTCCCCGGGGCCCAC
CGAGGTGGGTAGCATGACAGGGTGACCACCCTTGTCTGTAAGGTGAGGGTGGCCCTGCCC
TCCTTCCCTCCTTCCCAAACGAGAGCTTTCGAAAGCAAGGCCCGGAAGAGTCCGAGCCAG
CCGGGAGGGGCGGCGGGGCCTGCGGGAGGCTGCTGTGCGGAGCGGGGAGGCGCATCCTGA
GGGTCCCTGGAAGGTGCCATCCCCTCCGTGGTTCTGGAGCCACTCTGAGCGCCTGACCCC
CCCCATCTGTTCTCTCCCACAGCCTCCTCACAAGCTGCCCCACGGCGCCTTCACGCAGGA
CTTCCAGGAGTTTGTAAATAAATGGTAAGGTGCCAGGCCTTCAACGGGCTCGGGCGGGCC
ACGGCAGGTGCCAACCGGCACAGGCCCCGCCCGCCTCAGGGATGGCCGCCCACACCCCAC
CGTCCTCCCAGGCCAGGCAGCGGGCAGTGGCTGGCGGATCCCGGGGCTCACCGGACACCC
AGGTTCCCTCTCCCAGGCTGCTGAGCTACAGGCCTGGCTGCCGCCCCCAGCTCGCCCCAG
CCCTGGTGAACCAGGGTCTTGGGCTCTGGAAACCACATTGCTCCCGCCTTGCCTTCAGCT
GGCAGGCACCCCCACGTCCTAATCTCTTGGCCTTCAGCCCCCCAGGCTCCAAGCCTTCGA
GCATGCTCTGGGAAGTGGCCTGCGGACAGGGACAAGGGTGGGCGGGCTGTGGACCGAGAA
GGAGGGACCAGGCTGCCCTACTTGCCTTTGGGGCCACCCTGCATGTCAGGACAAGCAGAT
GCTGCCGCCCCAGGGGCTGCCTGACTCACAGCAGCAAATGTGCTCTTTGTGGTGAAGGCG
CCACCGGCCCTTTGCACGACCTCTGGCCAGCACAATATGTTGCGAATCCAGTTGCTGGTC
GTGTGAACGTTTTTATACTCATGCAGGAGGTTTCGTGACGTGTGGAGAGCTGGCGCTCGG
CCCCAGGCTGCTTCAGGCAGCTGCCTTTAGGCAGTTCTGCTTTTTTGAAGGAAAAAGTTC
CACTTGACATTTGGACTCCCGAACTTGGGGTTTTTATTAGAAATGTAGCTGCAGTGGCTG
CCGGGCCTCTGACCGAGCGGCAGCCAGGGGTTTTCCCACCTTCTTTCCCTTTCCCTGGTG
TCCGGGTCACAGAGCCTTGCCCTTCCCCCACCCGGGGGCGTCCTGCCCTGACACCACGGG
TGCCAGGTGGCGGGGGACAGTGGGATGGGTCCTGCGCCTCGCTGCATCCCCGGGCACAGG
CTGGCACAGGCTGCCGGGTCACAGCTCGGACGCCAGTCCCCCAGCTACGACTAACCGCCC
GGTCTTGTCTCCCCCGGCGCCGCCCCGTGGAACCGCAGCCTCATTAAGAACCCAGCCGAG
CGAGCGGATCTGAAGATGCTCATGGTGAGTGACGTCGCGGGTTCGGGGGTCACGGGGCGC
AGGTGCCACCCAGCCGCCCCCTCCTCCTCGGGAGAGGGGACCCCGCCAGGCCCGAGCCGA
CCCTGCTGTCCAGAGCGTGGGGCGTGGAGAACTGGCTCTCCCTGGCCCGCTCGGGGAAGG
ATCCAGAGCCGCGACGTCCCCGAGCTCCGTGCGGGGGGTCGGGCTGTGTCTCTTGGGCCA
CCAAGCTGTGAGCTTCCAGCCACTCCCGCCTCGGGCTTGTCGGGGGGCCGCGGGCTGCTG
GCCTTTCTCTAAACCCACAGCATTCAGCATCCTCAAACCAGGGCGGTCACACAAACTCGC
CTTCCCTGGCATGGATGGGGACCGGCCACGAAGTGGGGCTGACCCCTGGCCTCTAGCAGG
CCGTCACGGCGCCCCCGTGTTATGTCCACCATCGGCGACATTCCAGCGCCCTCCTAGGAA
GCCCGTTGTTTATGTGACCCTGGAAGAAAGCAGGGCCAGCTTCAATCGGAGGATGTCACC
GTCTCAGGTGTCCGAACGTGAGCAAAGGGGACTCTGATCCCTGGTGGATGGCGGCATTGT
AAACAATCGAGCGGTGCCCCTCAGTGGGTCCTGGTAGCCCGCCCGAGGACCAGACCCCGC
TGCCTGGCCGCCTCCGCCCGCCCCCCATCCTCCCCGTCCTCCAGCCCGCCTCCCTGCCAC
GCTCCACCTCAGGGCCTTTGCACAGGATGCTCCTGCTCCCCGTCTGCAGGTCTCCACTCT
GGCGCCTCCTCCCAGAAGGCCCCAGCATCCTGTCCCACCCCACCTCCCTCTGTTGCTTGT
GGCGATTGTCCCAGTTGTGCCACCACTTGCCGTGCTCGGGATAGAAAGCCAAGCCTGGAG
CGCCGTGTGCGCAGGGCTCTGCCTGACTTTCTGGAAACTCCTCGTTGTGTCTGACATAGA
GGTTTTCCAGAAACGCGGGTTAAGAGAATGGGTGACGTAGAAAATACGTGTTTCTTGTAA
AATGTGCACATATACGGGGTGGAGAAACCGCTGCACGGCCCCAGCTCCCACGGCCACACG
GTGCAGGGGACCCGCCGGGTCTCGTCCTGAGGAGAGCCACCGGCTGCTTGGCTGGCTTTG
TCACTGCTCCTCCTCCAGGAAGACGAGAGCCGCCTCCCGGCCCTTCCCAGGACCACCTAG
CGCTCTGCTGTCACCGTCCTATGGGGACAGCCGGCCACATGCGGCCGAGTTCCTTAAAAT
GACCTGGAACGCACAGTTCTGTCCTTCAGCCACCAGAGCCGAGTTTCGGGGCCCAGGAGC
TCGTGTGGCCCGTGGCCGCCACCAGACGGGACACCTAGGGGAGTGGTCATCACAGAGAGT
CCTGTCCTTCAGATCCGACGTCCCCACCCAAGGCAGCTCTGCCCCAGGGGGCACTGGCCA
TGGCTGGGGACGTCTGTGGCTGTCACACTGGGGGTCTCCTGGCATCGAGTGGGTGGGGCC
AGGGATGCTGCTCGACCCCCCACACCGCCCAGGACGGCCCCCAGGGAGTGACCCGGCCCC
CATGTCATGGTGCCTTTGGGTCTGGTCCCTGCCCGTCCTGAGGGCGTCCTCCGGGGCCGT
GGCCTCTTCTCTCGGGGGGTCACCTCTGGGCCCGGCGGGCCCCGCGGTGGCAGCTCACGG
CCTCCTCCCTTCCAGAACCACGCCTTCATCAAGCGGTCGGAGGTGGAAGAAGTGGATTTT
GCCGGCTGGCTGTGTAAGACGCTGCGGCTGAACCAGCCCAGCACGCCCACGCGCACGGCC
GTGTGACCGCTGGGCTCCGTCCGCCGGGGACACGTCCCCTGCCCCGTCCGCGCCCGCCCT
TCTCGCCAGGACCGGCCGCCTCCCGCTCCCGCCCGCCCACCCTCCGGGGCGACGCTCCAG
CCGCCGGCCTCCAACTTCCTCCCCACGTGCCACAGCCACCGGCCAGGGTGGCCTCTGGTC
CCCGGGACGCGGGATGCCGCTCGCCTTGTCTTCTCAGAACCTGCTCACTTAGGTTTAAGA
AAACCAACAAATCGGGGAAAGAAAAGCAAACGGAGCATCGTACTCCTTGTCCCATTCACT
CTTGGGCGTCAGCTCCGGTCCCGCCGGGGGGCGCTACCCGCGCCAGGTAGGGCCACGAGA
GGGACCCCCAGACGCTGGCGCCTTTCCCCAGGGGAGGAAACTGCTACTGCCCCGCGTCTG
TGTCACCCCCTCGCCCGCCATCTGCCCCTCGGGGGCTCCCCAGCAGAGCTGTCATGGGGT
CCTCTCCCTGCCCGGCCACACCGGCCTCTTGTCATGCGGCGAGCCGGCCTGTCCAGGCGG
AGCGGGCCCTGTGCCCCCGAGGAACCTTCTGGTCCTGCCCAGAGCCCCTGGGCAGAGCCT
GACTCCACAGCGGCCGCCACGCTGACGCTCGCCCGGCGGGAAGGAAGTGATGGTTTCCAG
GCTGCCGGTGCGGTTGTCACCCAGCAGATCCCCAGATAAGGCCGGGTCCCCCGCCTGCAG
GCCCACGGGCGGGGGCAGGCGGCTCTGTCACTTCTGCGCGCGCCTGGCAAGGCACACGGG
ACCCCCGGCTGCGTCTCTTTCGGGCTGGACCGTTCAGCCACAGCCCCTCAGAAATGAGCC
GGCAGGAGAGACACTGTCCTGGTGGCCGCGTCCACTGGGGTGGCCAGCCAGGCCCGGCCT
CCCTGCCTTCTGGGCTGTGCCGCCGCAGACGGCGAGGGCCGCCCCTGGGCCACCGGCAGT
AGGAAGTGGCAGAGGGCAGGGCCACTCCTCCGCCAGGCCCTGAAGATGTCGGAGCTGGGA
GCCACTCCCGGTGCTTCTGAAGGCTAGAAACCCGCTGATGCCGGTTTGTGACGAGTTGCC
GGCGACGGGATCCCCCCGCGCGGGAGGCACGGCCGGAACCTGGTCGGGCCGAGCCGGCCC
TGGGTTTCAGAGGAGGCTTGTGGCCCTGTAGGAACTGCGGGATCCTTCTCTTCTTAGGGA
GACCCTTCTCGTCTCCTGTGTTTTTTTTTTGTGGACACAGAGGAGACAAGGTGGCGGCTC
CTTCAACCAGCTGTCCGGGTTTCTGCCACTTCAGAGTTTGCCCCCAAAGCCTCACCTGAT
TCAGCAAAGAATAAAAAGGATAACTAAAAGTGGCGCAGGTGTCGCTCTGTGGGTCCCCGG
CTCCCTCGGGAGCATCCTCAGGGGGAGGCAGGTCTCAGGTGTGAACCGTGCTCCTCGCCC
TGGTCCACGGGGCCTGGTGCTGGTGGTCAGGGGGGCCGCGTCTTCGGGCCCGTCCTGAGC
GCGTCACCGCTCAGGGCCAGGCTGACCCCTCTTAGCAGCGCTGGCTGCCGTTGCGAGGGC
TAAAAGACCACGACGACCGGGTCCTAGGGGAGCGGGAGAATTCTGGATGGGCGGGGTGCG
GCCGCCAGGGTGGGGGTGGGGAGGTGGCTCGGAAACGGGGCGCCCCCAGGAGCAGCCGGT
GGGGAGGTCAGCCCAGCACAGGCCGCTGTCTGCATTCTGGACTGTTCTCACAGCCCGTTG
CCAGGTGTCCCCTTCCTCCTGCCCCCGTTCCTGTGGACACCCCACACCTGGAGCCTGTAA
TCCAGCCCCCGACCCTCCACGGTTCACGGCGGTCCAGGCCTGGCTGCTCCCGACCATCGG
GCCAAAGCTGACCACACACAGGCCTGGGGGCACTGCTCCGAGACCAGCGACGTGCTCATA
GGGTCCCCGTTGTACGGGGCAGCCTCCTCTGTGAAACCCGCACAGCCGTGGGTTTGGGGT
CTCATGACACGTGGGGGCCAGCCAGGGGCTCCTTGGTTCTGAGACCGAGGGGCCTGGACA
GCGGGGTCCAGGTTTCTCGTGGCTGTTCGGGGCCACCTGTGGACACGTGTCACCCCCGTG
ACCCCCCCCCGGCGCCCCCCCATCTGACCTCTTTGTCCCAAACAAAGAAGTCAAGCAGGA
AGCGGATGGGAGCTGCAGAATCTGGCGCGCTGGGTGCCCCTTGTCAGTGTTCTTTTCACT
CTTTTTACTTTTTCTTTTCTTTTTTTTTTTTTTTTTTGAGGAAGATTAGCCCTGAGCTAA
CATCTGCTGCCAATCCTCCTCTTTTTGCTGAGGAAGACTGGCCCTGAGCTCACATCCGTG
CCCATCTTCCTCTACTTTGTATGTGGGACGCCTACCACAGCATGGCTTGCCAAGTGGTGC
CATGTCCGCACCCAGGATCGGAACCCGCAAACCCTGGGCCTCTGAAGCAGAACGTGTGAA
CTTAACCGCTCGCCCCCGGGCCGGCCCCTCACTCTGTTTTGTGCTCGGATTAGAAGAAAA
CATCCAGCGACTCGTCAGCGCGAGTTTTTTTTTCAGCTCAATCTTTCATCGTAACAAACA
GCACTTTAGGTGACCGCGTGCGCTGTCCCCGGGTCCCGCCTGGTCCTCTCGCTGCCGCTG
GTGCCCGGAGCCCGGAGCAGCTCAGCCGACAGCCCGGCGGGAGGCCCTCGGAGTCGCCTG
GCTCCTGCCGCGGCCGCGGTCCTCTGCTGGGGGTCCGTCCAAGTGTCCGCTGTCTGTGGC
TGGGGCTCGGCGACCCCTGCCCCTTCCCCCTGAGGGGTTCTCCTGGCACATCAGCCGGCC
CGTCCCCTCCTCAGGAGTGGGGTGTGGAGGCGGGGAGAGATGGAAGGAAAAGTGGCCCGA
GAGCCAAAACAGCACCATTTCCCCTCGCTATCAGCATGAGAAAGGGCAGGGTGGCCCTCG
ACATCCTTTTGTTTTGGTAAAAAGTCTCCGTGACACCGTATGTTTTGCCCTCACAGCCCT
TCTCAGTTCGGACCGACCGCGTCTCGAGCGCTCGGTGCCCTGAGTGGCCGGTGGCTGCCG
GGCGGTCAGTGCGGGTCTGACCCCTGTGCTCTGTCCCCTCCCTGCGATCACTTTGGTCTC
TATGGGGGCCATTCTGCCCCTCAACTCAGGGACACTGGGCCACGTCTGGGGACGTCTGTG
GCTGTCACACTGGGGGTGCTCCTGGCATCGAGTGGGTGGGGCCAGGGATGCTGCTCGGCC
CCCCCACAGCGCCCAGGACGGCCCCCCAGGGAGTGACCCTCCCCGAGGTGATGTCATCAG
TGCCTGATTTGGCCCAAACTCCTCCCTGAATTGACGGGGTAGGAGGCCACCGTCTCCCCA
TAGCAGAGGTGAGACCCTGAAGCCACCGGATTTCCTGTTTCCAGAGCCTAGGACGGTGTG
GCAGGGGGATGTGGGCCCAGAACCTTCTGGAAGGTAGGGAGAAGCGTACTGCTCCACCGA
GGCCGCGGGGGGCGGAGGTGTGTGCCAGGCAGGAAGCCTCAGGCCTGGGAGGCGGAACTT
GGCCCCCCTCTCGGCGGCCTCTACGGCCGGGTTAAGCGAGTTCAGAGGAAGCAGAGGGCG
AGTTTCCCAGAACTCGGGGGTCTGGGGGAGGGGAGGGGGGAGAAAGGGAAGGGGCGGCGC
TCAAAACGAAACCTGCGGGGGGCCGGCCCCACCCCGCCCCGGGCTCTGATGACCAGGTGC
GCACGGGGCCAGGTCCCCGGGCCAGGTGGGTGGAGGACCGGCCTGTCCTGCCGTCTCCGT
GGCAACAGCAGGGCGGGTGGCTCAGGGAGGGGGGAGGGCGAGGCCTGGGCCCCACCAGCC
CCAATGAGGCCGAGGTTCGGGTTTCTGCCCCGGCTTCCCAGGGGACAGAGGGCGCGGGCC
CAGAGCCGCACTGGGGAACCCGGCCTCCGGTGAGCATCACCCACAGCCACCCGGGGCAGC
GGGACCTCCCGTGTGCGCATCGGGCGCAGAGCCCCGGGGAGGGTGCCCAAGGCGACAGGA
GGCCAGTCGAGAGACGCCGACCTCCCCCGGGGTGGACGCTGCAGCCCGGCCTCCACCTCG
GTCAGTGTCTGCGGTCCACAGGGCGCTGGGCTCCCATGCAGGCCCCGTGGGGGTCCTGGA
GGATGGAGGAGCAGCCCCCCCATGGCTTCAGTGGCCCCAGAGCCGGCCACGGTGCCCGAG
AGAGCTCACCGCGCCCCAGAGCCAGCGCGGGGCAGACCCCGGGAGACGACGTCCGGCCGA
GGACCACCTGCGAAGGACGAAGGACAGTGACCCAGAGCCCTGGGGGCGCGGAGGGCATCC
CGGAGCCGGGGAACCGGCCTGAGCAAAGGCTGGCGGTGAAACTGCATCACGGGGACCCCT
GGAGAGACTGGCCTGGTTGGGGGTATGCACTAGGGGTCGGGGGTCAAAGGCCTTAGCAAG
CGTCCAGCAGAGCGGTGACCACTCGGGGCGGGCGGGGAGGGGGCCTCGGCGCAGGAGGGG
TCAGGAGGCCCCGCTGTATCCGGGGGACCCTTCGATTTCTGGGGCTTGGGAGGGGGGTGA
GCGAGGGGCCTCCCAGCCGGACAGGAGCGCATCAGCATTGCCACGCCCGTCGGCCGTGGG
CGCAGGACCGGGTGGCCCTCAGGACGCTGCTTCTGGGGTGCCCTGAGCCCCGTCACACTC
AGCACGGTTCCCGCCCCTGGTAAACCCCCTGCAAGTCAGCTGGTCACCCTCAGAGGAGTT
AAACAGGGAGCGACCTTCGGACCTGGCACTTCAGCCCTGTGTCCACGCGGGAGAAATGAA
GACACGTGTCCACACGGACGCTTACTCCTGAATGTCCACGGCAGCACGAGTCACGAGAGC
TAAAAAGTGGACACAACCCAAACGTCCATCACCAGATGATGGACACACACACGTGTCCCT
CCACACACTGGGACACGACGCAGCCGTGAAGAGGAGCGAGGCCCTGACATGGCCACACGT
GGACGGACCTGAACACGCGACGCTCAGAGAGAGAAGCAGACACAGAAGGACACACGGCGT
GTGACCCCATTGACATGAAACATCCAGAACAGGCCGATCCACAGACAGAGAGCGGGCTCG
TGGGGGCCAGGGGCTGGGGAGGGACTGCTCATGGGGACAGGGCTTCTTTTTAGGGTGATG
GAATGTTCTGGAACAAGATCAAGGTGATGGTTGCACAACTATGTGAATGCACTGAAAAGC
CCTAAATTGTACCCTTGAAATGTTTTAAGGGGTGGATTTGACCTTAATAAAAAAGTCAGC
TGCTGGCAGGCCCGTCTGCCCCTTTCTCTCCAGCATCAGGCGCCTGGCTGTCACCCGCTC
TCAGAGGACGATGCCAGCTGGTGGTGGGTTCACCACCACCGGGCCCACCCAGCTGAGAGG
CCCCTTCTCCCTCCAAGCAGGAAGAGGGGGCCCCTGAGCTGTGGGATCGCTGGACGGGGA
CACTGAAGGGGTGCGGGGCCCCTCAGCGTGGCCCATGGCGCTTGAGGCCTGGTGTTTCTG
CCATGCCACCTGAGAACCAAGGCCGAAGCCGTCGCCCCCAGTATCCTGAGCAGCTTCAAC
GCCAAACTAGAACCATCCAGAACTTTCTAGAACTATCTAGAACCATCATTCCACGAATAC
CCTTATCCAGGAGTCCCGGGTCACTGCGCACCAGCTGAGAGCTGTGCCTGGTGTGGAAGC
CCCTGAGAAACTATCCCCGTGTCCCCCCATCCTCCCAGAAGACCAGGCCCACCTGTCCCC
GGGGCCCCAGACACCGCCGTCCATCCCCACACCGTTCCTCCTCTGTTCCCTCCGCCCTGC
GCAGAAGTCACCTCTCCTTGGGGAGGGGCTCCCCTCTTTCTCTGAGCCCCCATAACTCTT
CCTTGTGGCCCGACATCCCCCACGCTCAGCAGCGAGCTCCCCCACAGGTCACGGCCGTCC
CCCCCGGCCCTGGCACCCATCTCCTTCCTCTTGGTGACCTTGGATGTTGTGGGGACGGAG
AAAGCTTGATCTCAATTAAAAACGGGGGCGTCAAAGGGCACCATGGAGAGAGTGAAGACA
GCCCACGGGGTGGGAGAGCGCAGTTGAGGTTCTGTCTGGGGACGCGTCTAGCGCCCGGAA
TATACAGAGATAAACAGAGCCCTTAGCACTCAGCAGCCCAAGGACCAGCGCCCCATTAGA
AAGCGGGCCGAGGGTCCCAGTGGACATCTGCCCAAGACGATGTGCAAGCGGGCAGGGCGC
GCACGGAGAGACGAGCCCCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCTTTCTATCTGTCCTT
ATCTATGTCTTTAGACATCATTTAGCTGAGGTCGGGCGTCACGTGCCAATCTGCCCAGAA
TCTGGATAAATTTCTTTTTATTCTTACATGGTTCTTGTACCCTACAAATTTCTTGTATAT
TAATTTAACGTATAAGTACTTTGGTCTTCTTATGACACTTTTTGCAACTCTTCATAGACA
AACCTATTCTGAATTTGTTTTCCAATTCTTTTCGTGTGAGGTCTCCTTCTCTGACGGTAA
TGCGCAGGGTTCCCTTCCTTACGTTACCTCGGGCGGATACCTCCGTGGATGCCGGTTACC
CTGACACATGCCCAATTTTACAGCACCGCGATCTCACTGTGGACACCATCACACGGTTGT
CTGCTGAAGAATGGACACACACCGGGGTCCATCCGGGAGAGGGAATACGACGCGGCCGTG
AAGAGGAGCGAGGCCCTGACACGGCTGCACGTGGACGGACCTGCACACACGACGCTCAGG
GAAAGAAGCAGACACAGAAGGACACACGGCGTGTGACCCCATGGACATGAAACGTCCAGA
ACAGGCCGATCCACAGACAGAGAGCGGGCTCGTGGGCGCCAGGGGCTGGGGGTGGGCTGG
GGTTGATGCTGATGGGGATGGGGCTTCCTTTTGTGGAGATGGGATGTTCTAAGCTTAGAG
AATGGTGATGGCTGCACGATTCTGTGAATGCACTAAACCCGGTGAAACGTGCACTTCCAG
TGGGTGACCGTGTGGGGTGGGACCTGTTGACCCCCCAGGGCGGCTCCCCTGTCCGGTCTG
GCTGAGTCCCTTACCAGCCCTGAGCCTAAGCTGCTGCTGGGGAGAAAGCTGAAGGCGCCA
GGACCCCCAGCCTGCGGGCAGGACGGAGGCCGGGGGGCGGGGCAGCGAGCAGGCCACGCC
CACTTCACCGCTGACCGCCCAGAGACAGGCAGGCCTGCGGGAGGGCGGGAGAGCAGCACA
GCGGGCTTCCAGCCCGAGGCCGCCAGACCACAGAGCCCCAGGCCACGGCAGGTGACCTCG
GGGGCGACGTCTCCCCTCTCCGCCCCGGGCCCCAGTCTCAGGCCACACGGATCCTCCTTC
CCCGTGGTTTCTGGGCCAAGGGTGCCTCGCGGGGTGAAGGCAGCTGACATCCTGTCCTGC
GCTGGACCTTGCCCCGCCCCCTCCCACTGGGGACATTGTGGGACTGTCCTTGGCCCGGGT
CAGCGGTCAGCGGGGCTTTGATCTGCCCAGCACCCCGTGGGGTGGACGCGATGCCCAGCC
CCGCTGTCACGGGAGGCGGGAGGCCCCGGGGAGAAAAGAGCCTGGAGCCAGGAGGTGGCT
TGTCCTGCCCAGGGTCACGCAGAGAGGACTTGACCTTGACCCCTTGACCTTGATTCCCAG
AATCCCCAGGAATGGAGCTGCGGGGGGTGGTCCCTCCGGATGGGGGCCGAGGCTGACCCT
GCACCTGACCTAGCTTCTCCTCTGTCTCTGTCTCTGTCTCTCTGTCTCTCCGTCTCTGTC
TGTCTGTCTGTCTGTCTCTCGCTCCCTCCCTCGCTCTGCCTGTCCCTTCTCTCCCGGGCC
CTGAAAGTGAAACCAAGTGACACCGAAGTGAAACCGAAGCCACCGCCTGGCAGCGCAGCC
CGTTGGAGGGGAGAGGGCAAGGGGGAGTCCTCGGGCGGCCCACGTGGCAGGAGGCAGGAT
GGAGGGAAGAGCCGCGCTGTAAATTGCGGTGATTTTAAAAAAAGAAAACCGAGGGGCAGG
TCCGGCCGGCCAGAAATGCTGCCACGTTCTCCCTTCCCCCGCCACCACCCGCCACCTACA
GGGTTAACTATAGTGCTTCTTTCAGCGGGAGCTGAAAAAAAGTGTAAATTTGATGGCTGT
GCTTTAAGAGGATTACATTAACATCGCGTTTTTGTATCGACTAGGCAAGACCCCCAATCA
CCTTGGATTTAGTTTGCGTGGATTCTGTTCTAGTCTGTTAAGCTCCTACCTTCATGTAAT
CTATCAGTTTTTAAGTTCCATTGCGTAATCCAGACGTGAAAATTTGAACAAGGTCCAGTG
GTCCCCGTACGAGATAACCTTTTCTATTGATCCTTAATTTGTAAAAGTGCACATCTACCA
ACAGATCTGGATCAAGAAGATTATCTGTGATAGTATTTCTCTCTAATTAACCTTAAGCCT
CAGCATAGTGTGAAGATGTAAAGTCTCACATCTTGTATCCCATTTAAATTGGTGTTGAGT
GCCGCAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNGGTGTCGAGCAGCATCCCCGGGCCCCCACTCACTCGATGCCAGGAGCA
CCCCCAGTGTGACCACCACAGATGTCCCCAGACGTAGCCCAGTGTCTCCTGGGAGATGAG
GAGTCACCCCCCTGGTGTGACCCACTGCCCTACGCGAATTCCCGTGGTGAGCTCTGAGCC
AGACCCCGCCAGGCAGGCAGGCAGGCCCCCGGCTTGGGAACCCTCATCGGGGTCCCCAGG
GGTGCTTGGGGGGTCGCGTGTCCAGCCCGGAAGTGAGGGGGCGCCGGGCGCACAGCGCGC
AGGCGCGGGGAGGGGCCAGCGCCAGGTGGCGGCGGAGAGGGGCCCATTGCGCGGATGGGA
AGGCTGAGCCGCGGGCGGGGTGGGGACGGCAGCGCCCCCGGAGGAGCCCCCCAGCTTCTT
CCACCCTGAGCTGCCCCGGCCCCCCAGCTGCCAGGGACCCAGCATCCACCCAGCCGCGAG
CATCGGGGCTGCGGGAGCGTCGCTGCTCCGTGATGCTCGGGGTGGGGGTGGGGGGTCCCG
GGAGAGGGCGCGGGGACCCCGGGCTCGGGGGCTGCGATGCGCCCGGTGGCGCCAGGCTGT
TTCCACAGCGCGCACCTGGTTGGGCCGCCCCGGGTGTGCCGGCGAAATGTCAGCTCTGCC
CCCAGCGCGCCCGGGGAGGGGCCCGGCCGGGGGAGGAGCCGGGCCTGCGGCCCCGCGAGG
CTTCTGGAAGCCGCTTCTGCAGCCGCCGAGGCCGGGACGGCGCGCCCGGGGCTGGGGGTC
CGCGCCGGTGACGTCGGCGCCAGAGCGGTGAGCAAGGCTGGCAGCGGGGACGCCGGACCC
CGGGGCCTCTGTCCTTCTTTCTTAAGCAATCAGAACCTTCATTTTTTTTTTATTATGGTA
AAATATACGTAAAAGTCACCCTTTTAACCATTTGTAAGCGCACAGCCCAGTGGCATGAAG
CCCAGCCACGTGGTTGTGCCACCATCCCCTCCATCCGTCTCCAGAACTTTCCATCTCCCC
AAACGGAAGCTCTGTCCCCATGAAACACCAACTCCCACCCCTCCCTCAGCCCCTGGCCCC
CCATCCACTTTCTGTCTCTGTGGATGTGGCTCCTCTGGGGACCTCCTGTGAGTGGACCAC
ACAGTGTGTGTCCCTCTGTGTCTGGCTCACGTCCCTGAGCATCACGTTCTCCAGGTCCCT
CCACGTGGGAGCAGGTGTCAGGCTCTCCTTCCTTTTCACGGCTGCGTAATATTCCAGGGT
GTGGAGGGCCCACACTGTGTGCGTCCATCATCCATCCTCAGATACTGGGGGTGCTTCTGC
CTTTTGGCTGCTGTGAACACGGGTGTGCAAACACCAATATAGTTTTAGGAAGTGGACTCT
GACTTAGGCCTCTGTAGCCCTGTCGGCCCTTTGGAGCCAGACTAAATGAGTTTGGTGGAA
GGGCTCCCAACAAGGCTTCCAGAAGCTTCTCCTGATAAAGTGCTGATCCACTCCCCACCC
CCCTACCCCCACCAGCAGTAGAGTACACCACGCATTGACTGAACCCAGTGCAGTATGCCA
GGTAGTGGGTGGAGAGTCAGCCAGGACCAAAACCAGGTTGACATCCCTCCCTTGGAAAGC
CCCAGACTCAAGTCCATCTTCCACACAACAAGCATACATAGGGCTCCTTCAAGCCAGGCC
CAGCTATCGGTCTGTCTGTTTTTCCTTGTGGGACATGGCTCCCTGTTTCCCTTCACCATC
CTGGTCTCATCCGTGGAATGGTTTGGCAAGACCACCACCTCCCATGAGCTGAGCACTAGA
CCTCTAATAACGTGGCCAGAAATCACATTAGCTTTTTCAGAAGCCCAGTTGCACTGCTAA
TTGCCTGCTTTGTCCCATTCAAACCTGTAGTGGGCAGAACAATGGTCTCCCAGACATATC
CACGTCCTAACCCTTGGGGTCGGCAGAATAATGGTCCCAAAGATGTCCCCATCCCAATCC
TGAGATCCATGGACCTGTCACCTCAAGTGGCAGATGGGTTAAGGCCCCTGTGATGGGAGA
TGACCCAGGATTCCCAGGCCCCAGGCTCATCCCAGGGTCAGAGGCCGAGATGGAGACGCT
GCGCTGCTGGCCGTGCGGACAGAGGAAGGGGCCCCGAGCCCAGGACACGGCGCTTCTGGA
AGCTGGAGGAGGCGGGACACGCTCCTCCCCTGGGGCCTCCGGGGGGACCCCACCCCTACG
GACACCTTCATTTCAGCCGGGGAGACCCCTTTTGGACTTCTGATCTCTAGAAATAAAAAA
AAGGAAAAAAATTGTGTTGTCCTCCGTCACTAAGTTTGTGATCACTTGTTCCAGCGGCCC
TGGAAACTCAGCGGAAACCCTCAGCGGCTATTTGCTTTCTATCTGGTGCAAGTACTTTTT
TTTAAATTTAGGAATGCAATATATATTCAGTGAGGAAAAATTCAAATACTCAGAGAAGCG
AAAAATCACCATGATCATACCACCTACGGATAAACACTGTTGATACCTCGGAGTATATAC
TGGGAGTCTACTGTGTGTGTATTCTTAAAAATAACGGGGACGACTTTTTTTTTTTTTTTT
TTTTTGCTGAGGAAGACTGGCCCTGAGCTCACATCTGTGCCCATCTGCCACTACATTATA
TGTGGGACGCCTACCACAGCATGGCGTGCCAAGCTGTGCCATGTCCGCACCCGGGATCCA
AACCAGCGAACCCTGGGCCGCCCCCTAACAGGGACTTTTTTAGTGTCCTGGCTTGTAACT
CACTTTTTCAATTCTCATAGCTGGACCATCTCCCGTTTCAAGATACATTCGTCTCCAAGA
CCATTTTTAGCAGCTGCATAGTATTCTGTCGCGAGGACGCGAGCCAGGGTCAAACCAAAT
TCTTTCCTTTGGATAAATTTCTAGATACAGAATCTCTGGGCCCAAGGTTGTGCATATTTT
TAAATAAGTCCAGTGGCCTTTTTTGGGTGTTTTTATTTGTTTTTTTTTTAAAAATTAAGC
TGTAGGCTACATACAGTAAAAATACAGATATTAAATATACAGTTTGATGGGTTTGCAAAA
TGTACATAATCTTGTAGCCTCAATTTTTGCTTCTTTTTGTTGTCAAATAAATTTCTTGTT
TTGGAAAAACTTTTAACTTGCAGAAAAGTTGCAAAGGTTCCAAAGAGGTTTGCGTGCGCC
CCTCACCAGCTTCCCCCACTGCCGGCATCCGGGGCCAGCACGGTCGGTGTGTCTGTCCCG
GCTGAGGACCAGCGCCCGCAAACCGCCATTAACACAACGCCACACTGTGTTTGGATGACG
CCAGTTTCTTCGCTGATGCCCTTTGTCCGATTCGGGGTCCCATCCAGGACACCAGTTCGT
CCACTGACTTTCCCCCCCTTTAAAAAAATAATTGGAGTAAAATATGAACACCGTAACATT
TCAACCATTTTTAAGCGTACAGTTCAGAAGTTAAAAAACATTCCCACTGTTGCATATCCA
TCCCCTCCATCCGTCTCCAGAACTTTCCATCTCCCCAAACTGAAGCTCTGTCCCCATGAA
ACACTGACTCCTCACCCCTCCCCCAGCCCCTGGCCCCCCATCCACTTTCTGTCTCTGTGG
ATGTGGCTCCTCTGGGGACCTCCTGTGAGTGGACCACACAGTGTGTGTCCCTCTGTGTCT
GGCTCATGTCACTGAGCGTCACGCCCTCCGGGTCCGTGCGTCCTTCTGTGTCTGCTTCTC
TCCCTGAGCGTCGTGTGCTCAGGTCCGTCCACGTGCACCTGTGTCAGGGCCTCGCTCCTC
GTCACAGCTGAATCGGTGACACTTCGCATGGAGTCTGGACCCCTGGCCTGGCCCACAGCG
GTCCCCTCGCTGCCCCCTGGGTCCCCTGCTCCAGCCGCATCGGCCTTCGGGCCGAGCACC
CCTCAGCCAAGCTCGGTCCCACTTCTGGGCCTTTGCCCTGCGGTCCCCCCGCCCGGGGAT
CCGTCCCCAGATCCTCATGCAGGTTTCTGCTCCAATGCCACCTCCTGGAAAGAAGTGGCC
CTGAGGACCATTTAAAAAAAAAAAAAACGTCGCCCCTGGACAAGACAAGGCTAGGCGTCG
TCTGGCTCCGTGGCTCTCTGTGGCTCTCGCCGTCTGTGAGCTATTTTGCGACTGTGCGCG
TGGCAGAAAGCTGCTCATAGTGGCCGGGAATCGTGGCCATAGAAATGCGGATTAATGGTG
CACAGTCACGTGCTGCTTCCGTGTGTGACTTCCCTGCAGCGTCTCTCATCGGCTCGCGCG
TGGATGTTCTGTGAATTTTCCTGGAAACCTGCTGTAACATCTCACTGGTTCCCTCAGTAA
TGAATGAGGGAAATAAACTCTTTTGACACACGTTCATTTAAAAAAAAAAAATATCTCCCC
AGGCCCGGAGCACTGTCTCTTCAGCTCCTCTGGTGACCCGACTACATGGAACTGATAATC
GTCTGAAATTCTTTTATTTATTTGCTTATTCGCTTATTATCTTTAGCGGCCGCTAGATTG
TGAGCCAGAGATCAAGGACCCGGCCCACGGGAGGCACCCGGGGCTGGCTGTGCGGCCTTC
CGGGCAGACAACTGCTGACCAGAATGTTCTAGAATCGTCGTGAGGTCCACAGCAAGCTCA
GGGACCCCTGGGTTCTAGAACCTTCCTGAGTCCTTTGCTTTTTCAAAAGTGGAACGCGTA
CCCCCAGCTCTCTCTCCCGGAACTTCCTCCAGGAATGTTGCCTGGGTTCTCAAGGCCCGC
GCGGTGCAGACGCTTTGCACACGTTGAGCTGCGGGCCCCCCGGGCCTGCAGCCCCAGATG
CACCCCCAGCAGGCGGGAAGGCCCCTGACCCCTCCCCTCTGGGGTCACGGGCGACACAAT
GGTCGCTACCCCTTGAAAATCCCAAAGACGCTGATGCCAGTGCCCAAGGACACCGCACCT
TTGTTATGTGGCTTCATGTGGAAGAGATATGGCACTCGCCACCGTGGGTAAACTGAGGCT
CCGAAGGAGACAGTAACCTGGGCTGCAGGATTGCACAAAAGGGTAGGTTTTAAGACAGGC
CAGCTTCATGTGTGGGGGCATTCGGGGTTCGGACAGCCCCCCCATAGGCTGTGGGGGTTT
GTCTCTAGATAATTTTGTATTGAGATATAAGCCACAGACGATACAGTTCATCCTTTTAAA
GTCAGTGGTTTCTAGTGTATTCACAGAGTTGCGCAACCACCACTGCTATGTAATTCCAGA
ACATTCCATCACTCCCCAAAATGAAACCTCATCCCCATCAGCATCCCCCCCACCCCCTCC
CCAGCCCCTGGCCCCCACGAGCCCGCTCTCTGTCTGTGCATCGGCCTGTTCTGGACGTTT
CCTGTCCATGGGTTCACACGCCGTGTGTCCTTCTATGTCTGCTTCTCTCCCTGAGCGTCG
CGTGTGCAGGTCCGTCCACGTGCGGCTGTGTCAGGGCCTCGCTCCTTTTCACAGCAGCGT
AATATTCCAGCATGTGGATGGACCCGTGTGCACGTCCATCACCTGTTGACAGGCATGTGG
GTTCTTCCCCCTTTTTGGGGTTTGTGAATGATGCTGCCGTGTTTCCATTTCTCCCGCGCT
GACACCTCGGGGCGGAGCTGCGGGTCGCACGGGAATTCTGTGTTTCATCTTTTGAGAAAC
TGCCAGGCTGTTCTCCACGGGGGCCGCACCGTTTCTGTCCGCACCAGCCGCGCCAGAGGC
CCCACGGTGTCCCCCTCTGCTCCAACTCCTTCTTGTCTGTCTTCTGGCCTCCAGCCATCC
CAGCAGAGGTGAAGTGGCATGTCGCCGTGGTTTTGATTTGCATTTCCCTGATGACTAATG
ACGTTAGGCAACTTTTCTCGAGCTTTATGGCCCATGGTATATTTCTTTCGGAGCAACGTC
TGTTCAACTCCTTTGCTCGTGAAAAAAAAGTTGGTCATTTGTGTTTTTATTGCTGAGTTT
TAAGATTTCTTTCTGTCTTCTGGGTAACCCTTATCAGATCTATGATTTGCAAATATTTTC
TCCCATTCTGTGGGTTTTTCTTTCACTTTCTTGCTGGTGTCCTTTGGGGCACAAACGTTG
AGGAAAGTTACTTTTGAAATATTTTTTTATTTTATTATAAGTATGTATAAGCACCAGACA
AGATTCAAAAGATCAAAGCGTAGATTGAAGTGAAGATTTGTCACCTTGCTCCCCATTGCC
CCTATTTCCCCTCCCCCAAAGCAGACCCCATTTACGGTGACACAAATTATCTGCTTAAAA
TATTATTACTTTGCAGCCTAGCCAACACCACTCGAATTCAACTCCCCTCCCTCACTTGCT
GTGTGTTTTTGGCGAGTCACTCACCCTCTCTGGGCCTCTGTGTCTTCATCGTGTACATGG
GGGATGATAACCCCCACTACGCATGTGGACTCAACACACAAAGGTGGAACTCAGAAAGGA
GACTTGGTGTTACCACTCGCCCCGCAACAAATCTGTTTTGGGACAAGTGTCCAGTATTTA
TCAATTTTTATATTGTGTTATGGCTGAGATGGAGTTAGTCCTGGTACACGCCAAGACCCC
CTTTGCCAAGCGTCCTATGGGGCTCTGCCGGCGAGGTCAGAAAAGCCTCGAGTGTGTGCG
AAGTTCTCACGTTTGGACATGTGGGTTTCATCTCAGCCCAAATAATAATAACAACATAAT
GACATCTGTGGTGACTTGGGGACTTCCCTCATGCAGGCCGTTTAAGTATGTTACATGTAC
GGTCTTGTTTCAAATTGGTCACCACCCTGGGAAATCTGTACCAATATTCTCTCCAAAGGA
CTCTCAGGATCAGAGACGTCAAGTAATCTGCCCAAGGTTGCACAGTAACTCAATCGTCTA
TACTTTATTAGGTTTTAAAACAGTATCTACTTTATTAGATTTTAAGATAATATTGACTCG
GGTATCTTTTGTGGGAGAGACACTGAGGAGGGGGGCTCCGCACAAATCTTTGCTTCCCTC
CCTCATTCTGTCTTCACTGCAGGGGCAGGAGCGGGCAGAGGGTAGGGGCACGGCAGCCTG
GCATTTCCTGCAGGACCCACCCGCAGCCCCTCGGGTAGGATCCAGAGCCGGGGGAAGGCT
GGATTCGACATCCTCGCTCGTTGTCCTCTCTGGGCCTCAGTTTCCTCAAATGTCAGGCAG
CAATCACGTCAGGCGCGTTGAGGATGGGGCTCAAGGCCGATGTCACGCAGGAGTTCCCTG
CGCCCTCTGAGTCAGGTGACCAACTGTGGAGAAACCCAGGCAGGATATCCGAGGCTGGGC
GGTACAAGCGGGGAAACTGAGTCACCCCTGCTCTGGCGGAATGAGCGGCCCTTGGGGCGG
AGGGAGGAAGATGCTTTGGGAGGGAGGCCTGAGCTCCAGTCGTCTGCAGGAGGCCGCGCA
GATCCTGGGACCCGCGACCGCCCGGTGGCTCTGGTCGGCCCTGGGGTGGCGCAGCGATGG
CAGGGTGGTTGAAGGAAGGAAGCCGCCTGATATCCCAGGCGGGGTGGTTAGAACAAAGTC
CCCGGGTTCCACCCTCGGCCTGGACCCACTGGCCCCTCCCCCCGTCCCTTCCCACCTCCC
CGGGGCTGGTTTCGGGCTGCAAGTCCTGGGACTGCCACTTCCCCTCTGGGGGCCTCCCGG
GGTTCCCCTTGGAGCCAAATTATGATCAGCAAAGTCAATGCCACCGTTTGGGAGGTGAAA
GGCGCTCTCAACGTGCTGTGCGAAGGGGCCATAAAGGGCAGGGGGTGGGGGCCGGGAGAC
CTTGGAAGTCAGAGGAGGACAGACTGGGTCCATGTGGCCCCTTGCAGTGGCAGTTTCCCG
CCTGTCAGGGGATGGTGGCAACAACGACAAGCGCAGTAAATAATAATAATGACAAGGCGA
GGAGCTCGTTCGGATGGAGTAAACAGGACCCCGGACAGAGCCAGCCACTCCAGAGGCGCT
CCGGGAAGCGCTGCGCGAAAGCAGGTGCCGGCCCTCCCCGGCCAAGGCAATGAGAAAGGG
GAAACTGAGGCCCGGAGCCCCCATCGCCACCCCCCAGGCGGCCGATCGCGCCAGCCAGCA
CCCCCCCCGCCCCCCCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTGTTTCCCGCGCAGGGCGCCA
GAGCAGAGAGCACGCTTCTCTGGAGCCACACCCGGTGGGGCCCCTGGAGCTCGCCGGGCC
TGCACTCCTCGGCCGGGCTCGGGGCTCTGTTTACCGCCAGCCATCGCTGTGGAGACGGGA
GCCTGGGGGAGAAGGGTGGCGGGAGCCGCGGCTGGAGGCGCGAGCGAGGCCCTGGGATCC
GTCTGTCTGATGAAGGAAAGAGGAGCCAACGGGGACACTGAAATTTTAATTCGTGGGTCA
CTTTGGGGGGGTATTTATTATCCGGTCCTGATTGGCTGCGTGGCGGCCAGTCAGCACCCT
GGGCCCAGCCGGGAGCCACGCACCTCCCAGCAGAGGCCCCGAGGAGCGGTGGCTCGGGTG
GCGGTGGGGAGCCCGTGCGCCCTCTGCTCCGTGTGGCACACTGAGGCCCACGGAGCTCGG
CCCTCGCCGGGTGGGGAAGGTCCCCCGGCAGGAGCAAGGCCTTGTGTTCACTTGTGTCCT
TCTTTTCTCTTCCTTGGGGCCCTGTGACCCACAGCTGGGTCAGGCTGGTGGCCGTCCCCA
CTGCCACATGAGGAAACAGAGGCCGGGAGGGGAGGCCCAAGGCAGTGTGGGAACTCGGGG
GCTCAGAGGAAGCCTGGGAGTGGATGTCGGGCTGGGCAGGGGACACCGAGGCCCAGGGGG
AAGCGGAGAGCAGCCCAAGGTCACCCGGCCGGAGCTGAGTCTGACCCTCGTGGTCCCTGC
CTGCGCGCTCAGGCCTCGTTCAAAGTCCTCCGTGTGTCACAGCCGAGGGGCGCCTGCCCA
CCTGCCTTCAGAAGGCCCAGAGGTTGACAGCAGGACCTGTCGGCCAAACGCAGCCTCCCC
GGGACCGAGGAAACGCTTGGCTCAAAGAGGACAGCGAGGCTCAGAGAGGGCCAGCAAGGT
GCCCAAGGTCACACAGCACGAGCCCCAGTCCTCCTGCCTCCCAGCATTCCGTGGCAGGCG
CTTTTATAGCGTGCAAGGCCCTTTCCCGCCCCCCTCGGAGCCACGGTTGCGCACCTTGGC
ATCTTGGCCCCTGTTGATGGGCTGGGCCCTGGGTTTTATGACCCACTATACCCGGGGAGG
CCCGGGTCACCTCTGGAGAGCCGAGACTCAGGGCCGGCCCGAGGAGGGCGTCCCCTGGGG
TTGGGAATGCCCGGCTCAGCTCCGTGGCCTTGGAACAGCCCCCTTGGACTCTGGGAGTTG
AGCGTCCTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTG
TGGGGCGTTGCAGGGATTACAGTACCCCAATTAAAAACCCTGGTAGGGGCCACCAGGCCC
AAGCCAAGGGATTCGCTCACCCGCTCCAGGGGCCGGGGTTATCCAGAGCAGGATCCTACC
CTTGCGCCAACCAGGCCCCCAGGCCTGGTGATGGGGGCAAGGGGCCAGCTTGGGCGAGGA
GCCTTTACAGTCTGCTATCTTGGACGATAGAATTGGCTGTGAGACCTTGGGGCCAGGCGC
CCCACCCTCTCTGGACCTGGTTTACACTGCAGACAGTGGGCTGCGCTCCCCCAGCCTCTC
GCCTCGTCCCCCCCACTTGCTTCCTTGGGCACATAGTAGGTGGGGAGGGGGCTGGTTACT
GGGAGACGGCCCTTCAGAGGTCAAGTTCAATGGCCGCCATTCACAAGGGGGGGTGGTGAC
CAGACTTGTCGGGCCTTTGGGCACAGGCGCTGGCACACAGTAGGTCCTCAGGCTAAGTTT
GCTCAAGGGACGAGAGTGAGACCATGGCCTAGAGCAGCACCAGCTGCCACCCTTGCCAGC
CTCACGACTCCCGAGGAAACTGAGGCACAGAGAGGTGCTGCACCTTGCCCAAGGTCACAC
AGCTTGGAGGCGGAGGGGCCAGGACCGGGACCCGGGCTGCTGTGCATGGCGCTCAGTAGG
GGTTAGAGCCCCTTCTCTGGTTTCCTGTCGTTGCTCTGTGGGTGAGGGCGGAGGAGCCTG
AACCCCTCACTGAGCTGCCAGTGGACCCCAGACACTCCTCCAGGAAGGCGGGGTGGCAGC
GACTGCCCAGCCCCCTCTCCTTCCTGAAGCCTGTGGGTGGGACGAGGGGGCCGGCCCCAG
CCCCCACCTCGCCCCTGATCTTGGGGAGCCTCCTGGTACAGTGGCCTTCTCCTTCCCTGG
GCCCCTCTCCCGCGTGCCCACCACCAGGCCTTCGCCTCGGCTGTTCCCCAGGCCGGGGAC
ATCCTTCCCACAATCCTGAGGCCTTCCTGGGAACCACCAGCTGTGCCCAGGGCGAGGCCG
GGGTGCTCCTGACCTCCCCTCAGGGCCCCAGCAGGTGAGTGGCGGCAGTTCAGGCCAGCT
CAGGTCAGAGAGTCCGAGTCCTGACCTGGCCGCTGGTCTGCTGTGTGACCTTGCCCACAT
CTCATGCCCTCTCTGAGCCTCTACCCAGCTGTCGAGCCCAGGCCTTTACAGTGGGGAAGA
TGGAAAATAAAGCTGCCCAGTTAGTTCCTGAAAGTTCCGGGGCACAGAGGAGGCTGTTGG
GGGGGCGCCGAAAGCAGGCGTGGGCCCGGCTGCCTTGGAAAGGACCAGCCATAAGTGACC
CGAGGTTAGATCGGAGGTGGGACCGGGTGTGCCGCCAGCCGGGTGGGCAGGGCCGGGCGT
GGGCTCTCCCAGTTCGGAGCCCTCTGGTCTTTGGTTCATCCGGGGGGCCCTGCGTCCCTA
CTGTGCGCTGCCGGGGGCAGGCCGGGCGCCCCCCTTCAGCCCTGGAGGCGCCTGCCGGGG
CCTGTCCCCACCGGCTGCCGAGTCAGCACCGCCGGGCGCCCCGGAAATCCCACGGGGTGA
GCGCGGGGGCGGAGCTGTGATGAAAGACGCCGGTGGGTGTGGGCCTGCGCCCGGGGACCC
TGGCCGTTGAGGGTGGGGACCCGGCGGCGCGGGGGCGGGGCTTCCTGGAGGAGCGCGGCC
TTGTTGGGTCCTCGCTGCCAGTGAGCCGCCACGTGCCGGGCACCGACTGCGCGCCCGGGG
CGCCGGGGCTCCGATGGAGGGGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGCCAGTTCAACCTAGGGGGATGGCGCGGCCGGTGGAGGAAAAAACTCCAAGTCGCAGGG
CTTGGTCCCTGGACAGGAAAGAGTTGGAGGCCAGGCTGGGGGGAAATCTGGGATTCCATC
TTAGGAGTCCAGAGTGGCTGGCGGGGCCTTGTGGGCCAGCCTGGTTGGGGGCGGGGGGCT
GGCGTGCAGGGGCCCGGCCAAGCCGGGTGACTCAGCATCACCCCGTACCCCCGCCTGCCC
TGGGGTTCCCCAGCCACGCCCACCCAGGCTGAAGAAAGAGGCCATTGTCCCAGTTTCCCG
GCCCCGCCCCACGGGGACAGGATCTGGGGGCTGACCCCCGGCCCCTTCCCCAGCGGGCCA
GGAGAGGAGGGTGTGGCCCCAGCTACCCGGGCCAGGCGGGGGCAAAGGGCACTGGCTGGA
GGCGGGCGGGCTAGCTGGCAGCCTGCCCCCCACTTCGGGGGCACTGGGAGTCTTGGGGGA
CCCCCTTCCTCCAGACTGGGGTCCCCAGATGGCTGGGGTCTCTGGGCCCCGGGGGGACCA
GCTTGGTGGCGGCCCAGCGAGCCAGGCTCTGGAGAGGTGACCCGGCCGGACAGAGGCCTG
GGGCCTCCCACCCCTGATGGTGGCCTGGAGCCCCGTTTCACTCTGACCTTAGTTCTCTCG
GTCACCCCACTCTCGACCTGGGGCCGATCCCGTTGGCCAGGCGGGGAAACTGAGGCATAG
AAAGCGGCCCTGGGCCAGGCCTCTTCCCCCTGCGGGCCCCCCACCCCGCCCTCCCAGCCG
GGGAGCCAGGGGCCCCTCTGAGTCACACTAGAGAGTTGAGTAAGCCGGGCCTGTGGTGGC
CCGGGCTATAATTACCCCGGACGGGGCTCGGGGTGACGAAACTGGGGCCGCCTCCACCCC
CACCCCACCTGGGCGCAGCCCCTGACCCGCTGTGCCGCTCAGGGCAAGTCACTTCCCCTC
TCTGAGCCTCCGAACCTCAGCTGGGGGGATCTCTGCACAGCGCTGAAACCATCGGAGGCC
CTGCTGTCCCCACCGTGACCCGGCCCCAGGCCAGCCTCTGGGCAGGGCCCTGGGAGGCAG
CTCCTAGCAGTGTTGTCGCCTCCCTGGTGACAGACCCGGTTGGTTCAGGGAGCAGCAAGC
CCACTGTGGCCCGAGCTCTTTTGGTTCAGGGAGGGGTAACAAGGCCAGAGTGTAGGGAGG
GGTCTGGTTGCACAGGGCCAAGCTTTGGCCCTCAGGGCAATAGGGAGCCACAGAAGGTTC
CAGCAAGTAGGAACCCTAGCTCTGTGGGAGGTGCCAGAGGGAGGGACCCAGAGCCTGGGG
AGAGCCCAGTCTTTGGCAGTTGGGAAAGGCAGGGCAATCAAGGTGGGGCTCTGAAGGATG
AATAGGAGTTTGTCACTCCTTACCTTGAAGAAGCTCTCCTTCCGGTGGGTGTGAGAAGGA
AGAGACCTAGTGGCTCAGACGTGGGGCCCAGGTGGCTGCAGCAAGGAGCAGGGCAGACGC
CAGGAGACCCAGGTCCCCGCCCCGGCCCTGTGGATTCCAAGCAGGAATCTGCTCCCACGA
GTATGGACCAGCACAGCCGTAGAAATATCACGTGACCAAGTTCCGTGTCGCATGTTTTCT
GGCCGCTGCTTGTTAAAGACGTAAAAGGATCAGGGGAGAGTAACTTCCAGCGCATTTTCC
TCGACCCCGTAGCCACATGTCGCCCCGCAAGCCGTGTGCATGGTTACAAATGAGCTGTTT
CACGTCCTGTCAAGCACACGCATCTTCAGAATCCGGGCGCCTTTTGCTCTTCCAGCCACA
TTTCGAGGCTCAGGAGCCACATGTGGGGGTGGCTGCCGCGTGGGACAGAGCAGTCGCCCT
GTGGCTGATGCGGTGACCAGCTCTGTGGGCCGACGGCCCCAGGCTGCGCTGAGTCCACTC
TGCTTCCTGTGGGGCAAGATGGCCGGCGGGGCCCTGGCATCGCTCCGGTCCCTCCTGCCT
CGGGACTCACAGCCCGGTCGGGGAGACAGACGAGAAAGAAGGAAGCTGGGACACAGAGGA
GAGAGTCCGATGGTGGTGGCGTGGGAGTGCGTGGAAGGGCCGGAGTGGAATTGTGAAGAT
GTGGGGAGCAAAAATGGGCTCCAGGCAGCAGAGCAGCACGTGCAAAGGCCCTGAGGTGGG
CTCGCGGTTAGCACGTTGGGGTGACAGCCAGGGCCTAGCCTGGGTGCAGAGCAGAGAGAG
GCAGAGGTTCGGGCGCGTTTGGCTCCTGGCGAGTGGTTATGATCATGGCCAACTGCGGGG
ACCCCACTCTCCCTCCAGGGCTTTCCCGGGACGCAGGACCTTGTGTGCTCAAAGCAGGGC
GGCTGGTCGCATAGTTCCCAAGCCCCTGGCGTCCTCCCTTGTCCCCTGGAATATTTTTCA
GCACCTGCAACGGGGTCTGGTACTCAGCAGGGCTCTGAATGAACGCTCTGCCCACTTTGG
CGGGAACCCCAGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGCCTGTGGCCCCCGATCTCCCGGCCGCTGGGACACGGATCTATTT
ATTGCCAGGCGCAGAGAAGAAGGGGACGAGCCCAGGGGGGAGTGGGGGCGCCCCCTTCAT
GGCACTTACACCCCCGCGGGACCCCCTGGGCCCGCGCGGAGCGCCCCCGCCACCCCCGGC
TGCGCCCCGGCCCCAGGCCGCCCAGAACCCCCCCAAAACGTTTGGAGATTCAAAACTTTC
GGTCTTTCCCCTCCCCAGCCCCGAGCCCCCGCCCAATTTTTAAAGCACTTTTTAGATTTT
TTTTTCTCTCCTTAAAAACAAAATTTATATATAGATATATATATATATATAAAATATACT
TTTTCTTCAGAGGAGCAGGCGAGGGGTGTGGGGTGAACTAGCCGACCCGCAGAGGGAACC
CAGGGTCTCTGGGTTGTCAGGGGTGAGGGGAGAGGGTCTCCGCAGTTCTCAGTGTCACAA
AAAGCAATAAAACTCCAAGATTTTACAAGAAGCGAAAGTGAAAATACGCAATAACACTCC
TCAAAAAAAGAAGAAGGGAAAAAAAAAAAAAAAAAAAGACCACCGACAACCAATAGAAGT
CTCGGCACTTTGAAAACAGAACGGGTACTACACTTTCTCTTAAATCTTAATTTAAAAACG
TGTTTACAAATCGCAAGCAACTTCTATAAAAAAGTCGAAAAGACAAAAAAAAATAAAAAT
AAAAAGAGCGAGCGAGCGAGCGAGAGAGAGAGAGCGAGAGAGAGAGCAAAGAGAAATTCC
TGAAAGCTGATTTATTTTTGTACAAAATAATAAAAAAGCAAACCCACCACAGACGGAACA
TCCGCTTCTGTTCCCCGAGGCGAGGCAGGGGGACAGGGTGTGCGAGGCGGTGAGCCTCCC
GGAGACTGCGCCTCCAGGCAGGACTCCGGACTTTTGTGTTTCTGCCGTGACCCCCTCCCG
TCCCTTCCCCTCCCATCCATGTCCCCTTTCTTCGGTTCCGATTTGAGATGTCTTGTCACC
CCACTAGCCCATCCGACGTCCACCCCGTGTCCGTGGGGACCCTCGCTTTCTGACTGCCCA
ATCTCAGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNCCCTGCCCCACACACCCCCTCGCAATAAAACCAACTGTAAAAATCA
CAGCTGTCGTCCTGGCCGGTGGGGGCGACCGGACTTGGGGGATCGAGGACTATGGCGGGG
GCAAGGGCTCAACCCCGCCGAGCACACTTTAACACGAACCTCCTCGGGAATTGCACTAAA
CCCCTGCGCCTAGCTCTGCGCTCAGCTTCCGCCAGCCCCACCCTCCTTCTCCGCCTTAAC
CCTCCTCCGCTGCCCGCCAGCCTGTCCCGGGGGCCGCAGCGTCTGCATGGGCCCAGCGCC
GGGACGCCCACCCACCCCCCCAGCCCCCCCAGCTCCCCGCAATCACATACTGTATATAGA
CGTGGATCGATTTTATTTTTATTCTTTAAATTAAGGTTGTGATCACGTGTTGCCAAAGAT
ACTGCTGAATTCTCGCGTTTCAGGAAACAAACAAACAAAAAAATCTTTGAGGGGGAACGT
GCTGACCTGTCAGAAAGGACACAGGAAAACGTTTTTTTGTTTGGTTGTTTGGGGTTTTTT
TTTTGTGTTTTCTTTTTTTGGGGTGTTTTTTTTTTTTTTAACTGCCTGGTACAAAAAAAA
AAAAAGAAAAAAGAAAAACAAAGCGGAATTGTGATTTCCATCATCTTGGTAAAGCTGCGT
GGATGCGTGTGTGCGCGCGTGTGCACGAGTGAGGTCCAGGCCGGGGTCTCCGGGCGGGGG
CTCCGGGGGCCCCGGCAGGATGTGGAGGCCGGAGCCCTCGCCTGGAATGGGTGCCAGCCT
GCAGGACCCGGGACAGAGATGAACACCCTCGCTGCTGCTCCCTGCCTAGCCCCCCCGCCC
CATCCCTGCCTTTTGAGATTAAGAGAAAAAAAAAAAAGGCAAAAAAAAATAAAAAAATAA
TAAAAAAAAAAATTTTCAAACCAGTGAATGTAAAGAGCCGGCCCAGCCTGGCACGGTTGT
GGGCCTGCGCCCAGCCGGGCTCCCGCGGGCCATACCAAAGTCTGCCCCCCTCGGGCGGCT
CGCCCAGGAGACCCCCTGTGGCCATTGTCTTGTCACCGTGTTTGTACATGGCTGTCCCTT
CGCTTCCCTCCGAGGGGTCTCGGGGGCGGGGAGGGTCCCCCAGCCCCTTCCAGGGTCTTC
TGGGGGTCTTTGCACTACTGAGACCCATCGGCCGTGGCGGGAGTGGCTGCGTGGCACATG
GGGGGGGTGGCCGAGGCAGGGGCCGGGGGACCCCCAGGACCAAGGCCACCCGGGCAGCCG
GGATTGTAGGAGGCGAGACAGAGAGAGGGAGAGGAAAAGCAGGAAAAGAAAAAAATGTAA
AAACCAACAAAAAAAAGCAAAAATCCTATTTTTTGAGAAAGAAAGATATTTATATTTGCA
GTTTTATTTTAAAAAGTTATTTAAGCTGAGGAAGCAGCCTTCCGGAGGAGGGGCTGGCTG
GCACAGGACGGGTCAGGGGCCTGGGGCTCGGGCACCCCGGGAGCCATAACCTCAGAGTTC
AGACTAGCTCGCACTAAATACATAGATTTACAGGGGGGCGGGGGGCAGGGCCAGGAGGTG
GAGGGGGCTGGGGAGCCCCCCATCCCGTGGCCGGGGCTGCCTGGAGGCTGCGACTGGGGG
TCTCGAGGCCCAGCCTGCCCCTGCCCGGCCCAGACACGAGGTGCCTTGGACTTTGGGGGG
CCAGGCCTGGCGAGCGGGGGTGGGGGCGGCGCCCGCGGGGGGCACAGAGCACAGAGCAGA
CATTCCATAGACTGTATCTGAGAGTCTTTATAAACGTGTGGGAGATTTAAAAAAAATGGA
TAAAAATGCACTTTTTGGGGGTGGGGGGGAGAAGCTTTAAAAGTAATAAAAAAAAAAACA
AAAAGACAAAACATGATGAAAAAACAGACAAAAAAAATGACTTTTCTTGTACATAAGCCA
CTAAACACAGCCTGTTAGGACCGCTGCTGCCTCACTTGCCTGATTTCGACGTTCTTTGTG
TTTTGTTTGGGGGGGTGCGCTGGGGAGCGGGGAGGGTGGGTTTGGGGGGCCCCTCGTCCA
CACGGCTCGCGACCCCCTGCTTGGGTTCTGGGGAGAGGTCCCGAAGCTCAGCCTGACCCT
TCCGCCAGGCCTGGGGCAGGGGGTGGACGCGCTGACTCGGCGGCAGGTCGCCCACGGAGG
AGGTGGCCCACGGCCCCGAGCGCCAGCAGGGGCCCCAGGGACGGACGGCGCAGGTGGGGG
CAGGGGTGCAGGTGGGCTCCTCGGTCACCAGCTCCAGGGTTTTTAGGGGCCCTGGGCAGG
TGGCCTTGGCCGGGAAACCCCAAGTCTGCCAGAGGCCCCCATGGGGCCGCCCCATGCCGA
GCCCCGGTGACGTGGGATCGGGCCTCCGAGCTGGCTGCTGCTACACCTCCCGGGAGGAAG
TCAGGCCGGGGGCCACTCACTGGGACGGGGGGTCATGGCTGAGGCCCCCTCCTGTGGGTT
AGAGGGTCACCAAACGTGGCCATTTCCAGGGGCCCCCAGTCGGACTCAGGCCAGCAGGGT
CCAGGGTGGGGGTGGGTGAGGGAGGGCATAGATGGTCACGGCACAGCCTGGGAGAGGACG
AGCGGGGCTCTGTGGAGTGACACGGGGTGACGGCTCTGGGGGTGTGTGTGGGTGGGTCCC
TTACCTGTCACGTGGCTGCAGACACGGGATTCGAACCCAAGTCTCCACCTTGGGCTGTTG
GGGGTGGCGGGGCTAGCCACGAGGGTGCGCAGAGGCCTCTGATCAGGACGGCGAAGGAAG
CGGGTTTGACAGCCACTCAGCCCATGGGGACCTCCTCGCTCACGTCCCCATGTCCCCTGT
GCTAAGAGGGAGAGACCCTCTGGGTTTTAATCGAGGTATTATTCACACACAATCCAGCCT
GGTAAAACCACTGGTTTTAGCATATTCGAAGAGTTGCGCAACCATCACCAATATCTAGTT
CCAGAACATTCCATCGCCCCAAAAAAGAAGCCCCGTCCCTACCAGCAGTCACCCCCGTCC
CCTCCCCAGCCCCCAACTACCACGAACCCACTTTCTGTCTGTGGATCTGCCTGTTCTGGA
CATTTCATGTCAATGGGATCACACACCATGTGTCCTTCTGTCTGCTTCTCTCCCCGAGCA
TCATGTGTTCAAGGTCCGTCCACGTGCGGCTGTGTGGGGGCCTCGCCCCTCTTCACAGCT
GCGTCATATTCCAGTGTGTAGCTGTATGGATCCACTATTTGAGGATATTTTGGCTATTGT
GAATGATGCTGCTATGAAGACATGTGCACAAGTTTTCTATGACCCTATGTTTTCATGTCT
CCGGAGTGAAATTTCTCCCACGAGTGGACCTGCTGGGTCAGACGGTAACTCCACGTTTCA
CCTTTTGAGGAACCGCCAGACTCTTTCCAAGCGGCTCACGTTCCCGCCAGCCGTTCGCGA
GGGTTCCGGTTTCTCCCGTCCTCGCCAGCGCTTGCCGTTGTCTTGATTCCACCGTCCTGG
TGGGGTGGGGCGCTAGCTCGTGGTTATGACTTGCATTTCCCTGGTGACTAATGATGTCAA
GCATCTTTCTAGGAGCTTATTGGCCATCTGTGTGTCTTCTGGGCCACCCGGGGGGACAGG
AACAATCCTAGAATTCGAGGCTGTCTGAATTCCTGGCCCAGCCCAGCAGAGACACCAGAC
CCAGCAGTTTCAAGTGACATCTTCCTCATTGGACCAAACGCTGTGCCTTTTGAATCCTGG
ACGTCACACAGCCAAAGGGAGGAAGTGGGCACGGGACAGAGCCGCAGTCCTTTGCTCCCC
TCACCCCAGCGACGCCCCGACGCACAGAGAAGCAGACGCCTCAGTGGCTTCACCTTGATC
TTTTTTTATTTGCGTTTTTTAAAAACAATTAAATTAGAATACAAATATTAGAAAACAGCG
GCCCTCAGCTGCCAGTGCAGGTGGAGGGGGCCGAACTGCGCGACTGAGTTTATACAGTAA
AACTGAATTTGCCCTCGACCAGATTGCTGTCCCTTTCTTCTTTAGACCTGAAAGGATATT
GCTTCCTGACTAGGAGAGTTCTGTTTATACAAAGGGAAATTATTCTGGGGCTGGGCAGAG
TGGGGTGGGGGTAAGGAATCAAAAGCAAAGACCGAACGGTGGGCAGAGGTGGTTTGGAGA
ACCAAGCATGGTCGGTGGGGGGGGGCGGGGCCAAGGATGCTGGGCAGGGGGCGGGCACGC
GGCCACGGGTCCCTGGAGACATCTGGGGCAGCTGTGGGAGCTCAGGGGTCCCTGGCCCCC
TAAGCCGGGCTGGGTGCCTGGGAGCCAAAGGGCAGCCCCTGCCCGGGGCCTGTTGGAAGA
CGAGAGGGGCTCCCGGGGAGGGGGTGCCGGGCAGGCCTCATACCCGTTGGAAAACCCAAG
AGCAAGAAGAGGGGCAAGGAACCACCCCAAATAGAGAGGCCGGGGCGGGGGGCCCTGCCG
CCCCTTGGGAAGTGGACGCCCTCCCTGCCCCGCTGAGCGAGGGGCCGGTGGCATCTGTGG
GATCTGCGCTGTTCCGTAGGGAAATTAACCTGAATTGGAGTTACCGAGGTAGCTGGCTAG
AAAACTGAGACACCCCCCCCCCCCAACGCCACACGGTGCCACACTCTGGGGCCCCCACCT
CCCGCAGGGGGTCCTGGCCACATGCCGGGTCTTCAAAATACCAAGTTATTGCACTTTCAA
AAAATACAACACATCTGTGGCTGAACCCTCCCAGCCCCACCCTCCCCCACCCCCTGCCGC
CCCACCCGTGCCCCCGCCACCCCCCTCCCCGCCCCAACCCACTCCATGGCTTCTTGGCTA
AAATGCTTGCTGCTCGGCGGCACGCTCCAGGGTCCCTGGGTGAGAGGACACGTTCGCAGA
GAGGAAAAAAGGAAAGGAACAGACGAATGTCAAAGTCGCGGTTGCCGCCAGGGAGGGGGC
ACACGGCGGGCTGGCTTCCCAGCTGCCCCCACCGCCCCGCCCGGCCTGGGTCCCTCTGCA
CCGGCTGGAATGGTCATCGGAAGGCAGGGCGGGCGTCGGGGGGCGCGGCTTCCTGGGTCC
CGCCCGCCCCTTCCCAGGGTCAGCTCAGTCTTCGGGGCTCTGACTCCGGCTGGGGAAGCA
GCTGTGTGGGTGGCTTGCCCTGTTTGTTAAGAGTTTGATTTTTTTTGTTTGCTTGTTGCA
TTTCTTTTGTACTTTTTTTTTTTTGTCATTTTACTTTTTTTTTTTTAATCCTCCGATAGG
AGAGTCCAGAGGTACAGGTGCCAGGAGTCGGGGAAAGTTTGGGTGGAAAAACAAAATGAA
CAATAAAAAGAAGAAAAATATCTCACTCCTCCCGCTGTACCCGAGGCCTGCCTGCGCCCC
GCCGCGTGGTGAGCACCAGGAAAGTCGAGTGTCCGGCCGGCGGCGAGCGGTCAGCAGGCC
GACACCAGGCCCTTCGGGAAGGGGCAGCGGCGCTTGGGCCGGGGGCCCTCCTCGTCCTCA
TCTTCGTCCTCCTCCTCCTCCTCCTCCTCTTCCTCCGAGGAGGATGAGCTGTCCAGCGTG
AGGTCCACCACGTCGGCTCCTGGCTTCCCATTCTCCACACCGCCCACCACACCGGGACCA
CTGCCGGTGCCCCCAAGCACTGCACTGCCGTTGACACTGGGGGTGGACAGGAGCCCGTTG
GCATCTGAGGTGCCTGCGGGTGAGAGGGACAGACGCTCAGGACAGCTGCTGACTCAGAGG
GGGAGACTGAGGCCAGCGCGGGGCAGGGGGGCCCTAGGACACCTTGTCCTCCTCATCACG
TGGCAGGCCCCAGAAGACAGGCCAAGCTGGGCCTGACGCCACTGGGTCCCCAGCACCCTG
TACAGGGCCTGGCAATGGCAAGCGCTCGATAACTGTGCCACCTCCACACGGCAGGACACA
GACACTCAGAAACTGCAAACCCCATGGAGCAGGGATTCAGGGAGAGCCGTGCTGGCTGGG
GCACCGGGGGCCTGGCGGACTCACCGAGCACGAGGATGGGGCAGTGGGGGCTGCAGCTGT
GCTCCCGCTCGGCGCGGATTGGGCACCACGAGCCGTCCACCAGGTACTCGATCTCGTCAG
CGTCCTTGCACTCGCTCAGGATCTTGGAGAGGAGCCTGGGGGGCGAGCAGGGCTGACTCC
TGGGCCGGGTGCTCCCTGTCCCCACCCTGCTCCCCGAGGTTCTGTGGGCGCTCACTAAGC
TGCCCTCCCGTCTGCACAAGTGGCTCCAGGAAGCACGGCCAGGCCTGGCGGCCTGAGGAC
CCGGGCTGCTGGGGCCTGCACGTTCTGGGCCCCGAGGGTCCGCCACATCGCTCGGGGGCC
TGCAGGTCTACACTCCTAATGCGGTGACAGCTGGCTGCGAGCACAGAGAGCGTGTGGCGT
CCCTCCAACTGCTCAAGAGCAGGGGCCTGGGGGCGCCGCAGGACAGTCCAGCTCTCCGGC
CCCTAACTGAGCTGCCCAAGCTCCCACCTCGAGTCTGTGCTGCCCCTATCAGTACACATG
AAGAAACTGAGGCTCGGAGGGCAGGCGCATGTGGCCCGAGTGGGGCAGAGCAGAAGGGGG
GCCCCCTCACTCCCACACAGACGACGGCGTCCCCAACAGAGCGCCCACGGCAATAGGCCT
GGGCCCCGTTCTGCCATGTACAGCCAGCCCAACCCATTTCAGATGGAGAAACTGAGGCCT
GAGGAGGAGGCGTGAGCTCTCCGAGGCCACAAGGCCAGGCGGCAGCACGCCTGGGTTCCC
GGCCTGCCCCCCGCCACTGCCTGGCCTCGGGGCCTCAGTCTCCCCACCTGCAGGACGAGG
TGAGCGCCACGCCCACGGGATCCAAGGAGCGGCCACGTGTCCATGCCAGGCCAGGCCTGG
CACAGGGGACACACTGGCCACAGTGGCCCCAGGCCCACCTCATCCCCAGCATCTGCTCAA
CATCAGAGCCACACCTGTCTCCAGGTGCCTTCAACCACCTCAGTCAGTCACGGAGAAGAG
AGACCCTGTCCTGCTCCAGACACCCTCTGGCTCCCACCCACCCTGAGACTTCTCCATCAC
CACTCAGACCCCCAGCCCAGGGTCACCGTGGTGAGAACACAGCTCTGCCTGCAACATGCT
TACCCCCCCCTGGAAAACTCCTATTCGCTCTCCAAAGCCCCAGTTGACAGCTCCTCTTCC
TCTCTATGCGCGGCCCAAGCAACAGGAAGGTGTGCGTCTGGCTCAGTTACCCCCAACCCC
CACGCCTAGTGGGAGCTCCTGGCGTGGGATCTGGGACTGGGTCCTTTTGGGGACCCCTGG
ATCACCAGCTCAGGGCCAGGGATGACAAGGTGGCAAAACCTCAAGAAATAAAAGTATGAA
TCAAGGACTCTTCCTCCAGGGAGGCTCCCCGGCTATACCAAGGCCCCAGGGGCATGTGGT
ATGTTGGTCTGTGGGGGGCACAGCCACACTCTCCAGTGCCAGCTGCACCTGGAGCCGTCA
TCGCTGTGGCCAGCCTTGCCTCGCCTCAGGGACCTGCTCGAGGCCTGGGGGGAGGATGGC
GCCGTGCTGCCAGGCCGGGGACAGGGACGCCATTCAGGCCAGCCCTCATGCCCGGCCCCA
GGGGCCTCCTCACTCCACCCGGGGCCGCCCTGCTTGGGCCCACAAGGGAGGGGCCTGGGC
TCAGAGCTGGCTAGGCCTGGGTTCCCATCCCGGCCCCCTATGAGCTAGGGGCGCCGGAGG
CTGGCGTCTGTCCCTTCTGAGTCTCAGCTTCCTCATCTGTAAGGTGGAGATGATCCAGGC
CCACCTGCCGGGACGGCTGGGAGGGAGGGCTTGGCAGGACCCTGAGTTCGGTGACAGGAC
GGAGACCAGTGCTCACTGGTGGGGACAAATTCACACCAGCCCTGCAGGTCGGGCCCATCC
CGTCCCCAGACGCACATGGCCCCTGCCGGATGTCCGCCTGCACAGGCTGGGGGTCCAGGG
TGTGGCTGCCCGCATGCCCACTCCTGCCTGGGCCACTACCTCCCTCGCCCCCGCCTGGCG
CTGGGGACAGGAGGCGGGTGTGGCCAGCGCCTGGCGGGAGCTGGTCAGTCAGGTGCTCGG
CTCAGTTTCTGGAAACCTAAGACCCGAACAGCCTCCCTTCCGGAGAGAAGAGCCTTTTCC
CCTCGGTTCCCTGTGGCACGGGGAGGGCCTGCTGGTCGGGCTGTGGGGACAGCCTGGCCA
TAGGCCAGGGCCCCTAGGAAGGGGACAAGCGGGACGCGACCAGAACTTGGGGGAGACGTG
TGTCCTTTTGACCTTTCTACACGGAAAGCGTGACTAAGGCTGTGCTCAACGCCTGCTGGG
AAGCGGCTCCCTGGCTCGCGCAGCGACCTTGAGGCTGGGGCTCTGGAGTCCCCATTTTAT
GTGGGAAAAGACGACTCCAAGAGCGCACAGTCATACGGGAGCCCCATGGACCTCCAGGGT
CCAGAGACCCCTTCTGAACCCTAAGCCACACTGCCACTGCCCGCACAGCAAAGGCCCCGA
GAAGTCCTGCAGGGACGACACACCTCTCTCTGTAACCCGGGGCTGCCCAAGGGCACTTGC
TGCTGGGCAGCTTGGTGACCCCAGGTAGTCAGGAGCCACAGAAGTAAAGGGCCAAGCCCT
GCGCAGCCCCACAGGCAGGGCGGTCCCCGTGCACCCCCGCCACTCACCCATCGATGATGA
GCTGGTCATAGGGGGCGGGCTTGTCGCACACGGGGCACATCCAGGTGGGCTTCTTCTCGT
TCATCTGGAGGTAGAAGACGGCGTCGAAGCACTGCAGGTGGGCGCAGGTCTCCGCCCGGC
ACGGCACGGACAGCCGCATCTTCACCAGCTGCGGGGAGGGGCACGTGAGCGGGGCCACAC
AGCCGCCCCGGCCGCAACGGGCGGGTGGGGCCGCACGCCGCGACTCACCGGGCAGATGAG
GGAGACGCGCACGCCGGTGGTGGCGATCTCGCTGTCGGGGTCCAGGCGCAGCTTCTCCTT
GACTGCGGAGAGGGGGCAGCCGGCATCAGCAGTGGGGCCGGGGCGCCCGCAGGGCCAGGG
CTGAGGGGAGGTGCTCTCCGGTAGCGAGCGCTCTCGACAGCCCCGGCTCCGGGAAACGGG
CACCCGGCGAGCGCCCCAATGTCCACCCCCAGGCCGACGGGGTACAAGCTGTGCTCTGGG
GCCCAGGGGATGAGGAGCATCTGTGCAAAGGCCCTGGGTGCCCAAGGGGCCAGCCAACCC
CCCCACAAGCCCGCCTGCTGTGGCTCCTTATGACCCCCAGAACTTTTCTGGAAAGATCCA
GGCGACACAGAGCTGCCAGCAGGGCCACGGCTGCGGCTGTGGCTTCTGATGAGAACCATT
CCAAAGGACACGGCAGGGATGCGGACCCCGTGGGGCAGGAATGAACCCACGGGCACAGCT
CCCTCACGTGCCGAGTGTCACTTCCTCAGAACAGGAAGAGATGGCGGGGGCCCCCAAAGC
CACATGTGCCCTGCAGAAACGCTCACACGCCACGGGAGGCCCTGGGGACCGGCAACACTC
GGAGCAGGCGGTGCCACTCCATCCCCAGACGGCTCAGGTGGCCCGATGCCGCCCTGCTGG
GTGGAGGCCCCCCTCGTGCAGCCCAGAACTGCCCCCTCCCTCGACACCACCCCTGCATGC
CCTCCTCCAGGAAGCCTCCTCTCCCCTCCCGCACGGGGCTGGGGGTGACCGTGCTGGCTT
GTCCCCAAAGTCCAGTCAGTCAGTCACAACTCAGTGTGAACTTCCGCCCCGCGGCTCCCA
TCTCTGCTGACAGTGCTAACGGCGGCCCAGAGGCCTGGCCGGCGAGCAGACCCCGGGCAG
CCGGGACCGGACGCAGCGCACCAGGTTGCAGAGCGAGGCCTCACCGCCCGAGCTGACGGG
GGGACGGCACGTGCAGCAGGAGGGGTCCCTCGAGACGAGCACAGGACCTCCCAGTCACGA
CTAGAGGAAGCCAGCGGCCGAGATGCCGGCCTGGGGCTAGCTGGCTACAGGGACACCCTG
CCCCTCGGCCGGCAGGGGCCGGGGCAGCAGGGCTCCTGCCCCACCCCCTGCCCCGGCCCA
AAGGCACCGAGGCCAGGGTGCCTGCAGGGAGCCCGCCTCCTCTGGGCACGCTGGCACTGT
CCCCGCAGGGAGACGGGCAGGTGAGGGGTGAAGAAAGGGCTTTGAGGGGAAAGGGAGGTG
GTGGGGTGGGGGGCTGAGGCCCTGGGGTCACAGCCCTGACTCTGCCACTCTGCGCCTCAG
CATCCCCACTCGTCAGATGGAGACATGGCCCAGCCTGACTGCCCAGGGTCACTGCCACAA
GGCGCCCCACAAGGGCCTCTGGGTGATCAGAGAGGGCCAGTGAGCTGCCCGCGGCCACAC
AGCTGCACCGCAGAGGGATCCTTGCGTTCCTGAGCACCTGGGTGCAAGGGCGCAGGAAGA
GAAACAGGGCCAGGCTGCCTGCCAGTCTTAGTGGGGGGGTTCTTAATGCTCTAGACATCG
CCCCCACCTTTTTTGGGTGTTAAAGGGAGAAGAGAGAAAAATGAACCGTCTCACCCTCTC
TGGTCAGACCTGCATCGAGGCCTGTGAATCCGTCCTCGGCTCTGCTCTCTGTGCCCGTCC
CCCGCCCGCCCTGTTCCCTGCCTAGACATCCATCACCCCGGGAGGGGGGGTCCTCCCCTC
CGGGGAGCCCTCCAAGGCCTCTTGCTGCCACCGGGACCCCCACAGGCCTTGCTCGTCCCG
GCCTCGGGGCCTCGGCACCGCAGGCTCTGCGGCCTGGCTCCCTGCCCCGTGCCCTCCAGG
GCCCCCCAGCGCCCTGGCCTCCGGTGACGGACGGTGCCCAGGCCCCGCGAGGCCGGCCGC
ACTCACCCAGCGCCTTGCACAGCTCCGGGTGCTTGACGCCGATGGTTTTCAACCTCTGCA
GCAGCTCCGAGGACGTCAGCTGCCGCACCAAGTACAAGGCCACGGAGTAGCTCTGGGGGC
AGAGGGGGGCGTCAGGGCCGGGTGGGCGGCGGCGGGCGGGGCGGCCCCCGGCCCACTCAC
CTTGCCGTAGTTGCCCCAGGTGACAGTGATGCGGTTGGTGGCCGAGGACAGGTACATGAG
GTGGGTGAGGTTGATGGGGCGGCACGGCCTCTTGGGCTCCACTCCGGGCTTGTTGGAGGG
GTAGTAGCCCTGGGGAGACACGCGGTCAGGCCACCGCCGGGGCCAGGCCGTGACTCGCCC
TCCGCGTCCCCCGCCCCTCCAGCCTGTGCCATGGCGGAGCCGGGCTGCACGGGGCCCCGC
TCACCGGGACCGAGCAGTAGCTGTGGTTGACCTTCACGGCGATGTTGGGTGGGTACTGGT
CCTCCTGAGGGCCGCTGGTGTCCGAGTAGCAGATTCTGCAACGAAAATGAGGGCCGTGGG
GCCGCGGGCCGGGAGGGGCGGGGGAGTGGGTGGGGGTGGGGCACCCACGGACTAGGGCAG
ACGGCAGGAGGGAGCGAGGAGCAGCCCATGCCCCCTGCCGGGGCACCCAGAGGCTGCCGC
AGGGAGAGGGGCTGTGGCGCAGGTGGGGCAGACCGGGCTCACCTGAGGACAACCTGCACG
GCCTTGATCCCGGGCTGCAGCTCTCTGTGTGCAGAGGGAATCAGAGGGGAGAGAGGGGGC
GTCAGGGAGCAGGGCGCCCGGCCACCAGCCGCCACTTCAGCCAGGTGACTGTGGGCCCCT
CCCGCACCAGCCGCCCGGCCGGCCCGCTGCCTCCCCTGCCACTGAAGGCCGACAGGTGCC
ACCCAGAATGTTCTCTCCTACCACTGACTCCCTGGTGACCCAGACAAATGACCGCCCCTC
CCGGATGACGGGGCAGCTGGTGGGAACAGGACGTGGGTGGCAGGTGTGGCCACGCATGTG
CCGAGCACCCGACATGGGGCTGCTCTGGCGGTGACTTGTGCACAGCTGGAGACGGAGGGG
CCACCGAGAGCAGAGTCAAAGCCCTGGGACCAGCCTCTGTCCCCCATCTGTCACAGCCCA
GTGTCCTCAGCTGGGGCGATGCTGCCCCCAAGGGACAGCAGGCGACGTCTGGGGACATCT
GTGGTTGTCACACTGGGGGTCTCCTAGCAGTGAGAGGGTGGGGCCCAGGATGCTGCTTAG
CCCCCACAGCGCCCAGGACAGCCCCCTGGGGGTGACCAGGCCCAACGTCGCAGTGCCCAG
GGGAGGGCCCCTGTTAAAGGGGCAGCCAGCCAGCTCCGGGGCTGCAGGTCCATGGGAACA
CGCCAACCCGGCACCCTGCCCCACACAGAGGGCCGGCCCTGGGGACACGTGGACGGCAGG
GCACAGCGCACCTGGAGTTCCGGATCAGCTCCACCTGTCTGGGCGTCAACGCGAAGATGC
ACGGGCTCTCCTGGAGCTTCTCATTGTTCTGTGGGACTGAAGACAAACGGGGGGTCAGGG
TCATGTCTGGTCCCCCAGCGAGGGCGCCCACCATGGTCATCTCTACAGACCTGGCCCTCT
TCAGGCTGGGAAGCAGGAAATGGAAGGCTGAGCCCCTGCCGGGCGGGCAGACATGGGGGA
TGGGGGCGGACCCTGGCCCTCCTTGGGGCCGCTCGCCACAGCCTGTGGTTCAGGAAACAC
TCAGGACACCCCGTGCCCTGCTGAGAGCCATGCGGCCCCCAGGGTTCAGGCATCTGTTCA
GGAAGACTGAGAAGCGCTCGGCACAGGCCTTGCACCTAAAGAGCCCTCAGTGGGCCGTGC
ACGGTGCTGCCGTAGGGGACAGGGACAAACTGGACAGAAGGGGTGCCTTGGGCGGTCACA
GCCAGCCAAGGAGACGAGGAAGGGAAACGGCAGCAAACCTCCAGGTGCACAAGACAAGAG
TCACAGGGTGGGCCCGGCGCACAGTAGGGGTGGGGACGCCACACACAGAGCCTTACTGGC
CACCACAAAGCACCCACTGGGTGCAGAAGGCGGAGGAAAGTCAGCCAGAGGATGGAGACC
TTGGTGGCAAAAAGCCAGCTCTTCACTCTCCATTGTGACTGCACTGAGAACCCCCGGCCG
GAGGAGGAGATGCTCTGCACTGAACGAGAAAACACAGCACGCCAAAACTGGGGGAGGCAG
CTAGAGCAGTCACGAGACGGAAAGTCATAGCTTTAAACGCCCCCATCAAACAAGAAAGAA
GGGTCAGCCCCAGAGGCCCACTGGTTAAGTTCGGTGTGCTGTGCTTTCGCAGCCCCAGTT
TGGTTTCCGAGTGTGGACCTACACCACTTAGCTGTCAGTGGCTATGCTGTGGTGGCCCAC
ACACAAAAGAGAAAAATTGGCAACAGATGTTAGCTCAGGACGAGTCTTCCTCAGCAAAAA
AAAAAAAGAAGAAGAAACAAAAAAGACAAAGGTTAAAAATCAATGACTTACACACTTCCT
CCACGACAGGCTAGAAAAAGAGCAAATTAAAGCCAAAGTCATTAGAAAGAAGGAAATTAA
AGACAAAAATGGAAGCCTGTGAAACAGAAAGCCAACAACAGAGAAAACCAACAAAGCCAC
AGTTCTTTGACAGACATCTAGTGAGCGAGGCAGCAATGAAAAAGATGTCGAGGGGCCAGC
CCCATGGCCTAGTGGTGAAGCTCAGCACACTCTGCTTGGGTGGCCCGGGTTTGATTCCTA
CACCACTTGTCGGCAGCCACACTGAGGCAGCGTCCTATACACAAAATAGAGGAAGACTGG
CACAAACGTTAGCTCATGGCCAATCTTCCTCAGGGGGAAAAAAAAGATCTTGAGAACACA
AGCTATCAGAACAAAAAATGGACAACAGTACAGATCCTACAGCCTTTTGGGTTAGTAGGA
CAACATAACGAATGGCTCCATGCCAAGAGACTCGACAACTTAGATGAAAGGGACAAATTC
TTCCAAGGGTGCAAATTACCAAAACTAGCACCAAAAGACATAGAAAGTTTGAAAAGTTCT
TTATCGGTTAAAGAAACTGAGTTTGTAATTAACAATCTTTCCACAAAGAAAAATATAGGC
CCAGATCAGTGAATTCTATCAAACATTTAAGGAAGAAACCAATCAAACTTGACGTAAATG
AAGAGAATAAAGGAGGAACACTCTTTAACCCATTTCACGAGTCGGCATAACCCTGATGCC
TAAACCAAACAAAAACGCATCAAGAAAGGAAGGTACAGACAAACATCCTTCCTGAACACA
GACGTAAAAACCCTCAACGGAACATTAGCAGGGCTGGCCCCGTGGCCAAGTGGTTAAGTT
CATGCACTCTGCTTCGGCGGCCCAGGGTTTTGCTGGTTGGGATCCTGGGCGTGGACACAG
CACCGCTCATCAGGCCACACTGAGGCGGTGTCCCACACGCCACAACTAGAAGGACCTACA
ACTAAAAAATATGCAACTATGTAATGGGAGACTTTGGAGAGAAAAAGGAAAAAAATATAA
AATTTTAATAAATGAATAAATAAATCTTAAAACATTAGCAAATATCCAGGGCCCCTGGGA
ATGGTCCTGGGATGTAAGACTGGTTTAAAACTTCGACATTCAAGGGGCCGGCCCAGTGGC
GTGACGGCTAAGTGCACATGTTCTACTTCGGCGGCCCAGGGTTCACCAGGTCGGATCCTG
GGTGTGGACATGGCACAGCCTGGTAAGCCATGCTGTGGCAGGCATCCCACATATAAAGTA
GAGGAAGATGGGCATGGATGGTAGCTCCGGGTCAGTCTTCCTCAGCAAAAAAGGAGGAGG
ATTGGTGGCAGATGTTAGCTCAGCGCTAATCTTCCTCAAAAAAAAAAAAACAAAAAACAC
CGCAACTTCGACATTCACACTAGAAGGGCTAAAATGAAAAGACAGACAACTCCAAGTGCT
GGCGAGGATGTGGAGCCATCTCTCTCTGCTGTGGAGTATAAACTGGTACGACCACTTGGG
AAAACTGTGGGCCAGCTCCTAATAAACTTAAACACACACCTACCCCAGAACCCAGCAATC
CCCCTCTGGACATCTGCCCCCCAAATAAATGGAAATACGTCTACAAAAACCTGTACGGGA
ACATTCACGGCAGATTTATTCCTAACGGCCCTGAACTGGAGACAACCTGGGTCCCGGCAA
TGGCAGACGTGTAAACCAGCTGCGGTATGTTCACGCAATGGAACAAAACCTGAGATCCAC
ACAACAACGTGGACAAACCTCAACACCGTCACGCTGAGCCAAAGGAGGCAGGCGTGTCAC
GTCGTGTTCTAGAACAGGCCACGCTGATCTGTGGCGACAGGAATCTGAACAGAGGTCGCC
TCTGGAGGGGGTGAGGACTGCCCGGAAGGGGCAGGCAGGCCATCACGGTGATGGCAATGC
TCTGTATTCGATGGCATCTGGGGTACCGGGTACGCTCATTTGTTACCACTCAAACGGCAC
GCTACGGTATCTGTGGATTGCGTTGCGTGTAAATTACACCTCGATTTAAAGCCACACTGA
GAAACCATCTGAGCGACAGATTGGAGGAGACTGAAAGTCTGACAAAGTTGACGAGGCTGC
GGCTGGAGGGGGAGGAGGGGGCAACCTCGCAGATCATCAAAATCACGCACACAGCCGCAG
AGCCGGCCTCCCGGTGGCTGAGGAGCCACAACTGCAGACACGCTCACACACGGGATGGCG
GAGGCCACGGCCACCCCACCCGTTACCTCCGCCACAGACTGCCAGCGAGCCGAACGCCCA
CAACGTGGCCTGGTGAAGACGCGCTCCCGGACACCGTCCGAGGAGCACTAGGCAACGGGG
CAAACGGGGGACGAAGGCTCAAGCGGCCCTTTGCGTTCCGACCAGGAGGACCTTCCGAGA
GTCTCTAGGCGCAAACAGCGGGTGCGGAGCAGCGCCCCGGGGGACGCCTGCGCAGACGCC
GCCCTGCTCATCGGTGCCAAGGCCGTCCCTGGGGAGGCGGCGAGCGGTGGCCACAGGTGC
GGCCTCGGAGGGCTGCGAGGGGGGCAGGAGCGGGCTTTATCTACACCGCAAGCCCTTCAG
GACAGTGCGGGCAGGCTGGGCCTATAAAGGGCCCGGGTGTAAGTATTTTCAGCTTGGCAA
GCCGCTTGGTTTCTGCCTCGGCGTCCCCACTCTGCCTTGTACCCCAAAGCCACCAGGGCC
CCTGAGCACGCAGACAGGCGCGCCTGCGTGTCAGCAAGTCCTGCTTTACGAGGCAAGGTA
GCCAGTGGGGTTGGCCCCTGGCCCTCCTCAGCCAGCCCCCGCTTTCGAACCTTCTGGATT
CCAAAACACAACGGGTAATGTCTTTAAAAGGCAAACAGGATGTGAGTTTCAAACCAGCTC
AGGCTCAGAAGCCAGGCCGCCTGGGGTGGTACCCCAGCTCTGCCCGGGGCCACGCCTCCA
GCCCCGCCTGAGCCTCCGTCTGCAGCTGGCGCTCAGTGAGAGGGGGCTGCTGTCATCGGC
ACTCTGCTCCCCGATCACGCATGTTTGTGGGCCCGGCTGGTCCCTGCGGGGTCCTGGGGG
GGTCCTGGAGGAGAGCTGCCTAGAGACCACCTGCAGACACGCCCAGACCTGTGCGAAGAG
CCTGGGGACAATTATTGGGGGGTGGGGGGCTCAGAATATCCAAGCTGGGCTGTGACGGCT
GGGTGGGAGGTCAAAAGTAAGCCCCATCCTGCAGTGTCCCCAGGGGTGGCGGGGGGCCGG
CAGGTTGTGTGGGAGCCTCGCTCGCCAGGGAGCTCTGCCGCAGACAGTGTGAGAAAGGCA
GGGGAGCCGGGTTGTCGGAAGACCAGACTGCGTGGTCCCTCCCTGGAAGGGCTCCCATCT
CCAGCCGAGGCTGCTGCGGGGACAGGGGATGCGCCCACGCTCTAATCTTCTGCTGCGTCC
TCAGCCCGGGCGGCCAACGGCTCTTCCGGCAAGCCACGTCGCAGGCAGGCAGGAGGCAAG
CCGCCACCTCGGCTGGCACACGGCACGACCTACCCCGTCGGGAGGCGGCTGGGGATCCCC
CAAACCCAGACCCTCGCCCTCTGGGCCAGGGGCAGCTCCACCCCGTCAGCTGTTCAGGGC
CCGGTCATGTGTGGTGTCGGTGACTCTCGTGCCCCCACCCCAACAGCAATTTGCCTGGCC
AGTCCTGTTAGCTCTGCTTCCACACCGCACCCAGGGCGGCCCCTCCCATGCCCGGTACCC
GGCTCAGTCTGATCGACCCGCAGACCCCTCGCTGCTCTCCCGGCTCCCCCAGCTCAGCGC
CTGGGGTGATGCTCTGTGCCCACCCCTGGTGGCCTTGAGTCCATGGTAGCCACCCAGGCC
TCCTCCTCATGCTCCCCACCCGCCAAGAACATCTGCCTCGGGACCTTTGCACTGGTCATC
CCCTCTTCCAGAACATTCCTTCTCCAACCATCTACATGGCCCTGGTGTCTTTTAATTCTG
TGCAAACGCCACCAGGACAAGCGCCTTCATCTAAACACTGCGCCCACCCCCCCTTCTGGC
CCTCCCCACCTCCTTCCCCGCTCAGTGCATCTCCAACACGTTTACTCCTAGCATCCAACA
CAACCTCCCAGCATCCTGGTGTCGTCGCAGACCCTGAACCAGTCCCCAGCACTCCTGCTG
TCACCTGTGCGGCTGTGGGGCAGGGCGAGGGGGGCGCTGATGTGCGCCCGGGGCTGGAAC
TCCTGGAGGAGCCAGGGAACCCGGCAGACTGGGAGCCAGGCCCGGGGCGCCATCCAAGAA
GCGACGGGGGCCGGACACCAGCTCCACCCTGGGCTGCGGGCCGCCATGCGAAGTGCCACC
AGCAAAGAGCAGTAACGACGGCGCAGACGCTCACGGCGCAGGTACCCGGGCGCGGCCAGG
ACACAGCCGCCCGCCTCCTTGCGGGCTGCGCTTGTGGGGGAGGAAGGCTCCCGTGGGGTC
CCCACTGCCGGCCCGGGTTCCTAACTCCAACACGGACTTCCACAGAAGCTCGGACGAGGA
AAGAAGAGGGGGTTTCAAGAGGTCGACGGGATGGGACGTTCTCCCTCCCACTGCCCAAGC
CCCAGGGGCCTCAGGGGACAGAGGAGGACAAGGCCCCTCGTCCAGGCCGACGCCCCGCCC
GCAGGGTCTCTGACCCCTCCCTGCCCAGAGATCCAGCATCAGCTCCCCAAATCTAGAGTC
AGGCCAGCGTGACGTCGAGGTCTGAGCCATGGCGCGGGGCGTGGGTGCTGCTGGGGTGGT
GTCCTGGCGGCAGCGGGAAGTCCCCGGGCCGGGTGCTGGGCGCCTCGCCCCCAGCAGGCA
GAAGACGGGCACCATGAGCCCCGTGTCAGGGGCTCTGGGTTCGAGTCCCAGCTCGTCCAC
TCACAGGGGCGAGGAACCTGGGTGCCCGCACCCGTCCGATGGGCCTGTGACTTCCCACTC
GTGGGGTTACCAACGTGGGCCAGGAGCTCAAGGATCTTAGTTTGGGGGCCTCACTGAGGC
CCCCAGGCTGCCTCTCAGCTCCAAGCCTTTGCTTACGCAGGTGCCCCCCCAGGCCCTCCA
TCCCATGGATGCAGCGGAGAACAAGCCAGTCCCACAGACCCCGGTGTTCAAGAGGCAGGC
ATACAAATGAACAAACAACACTGGGGTTGGCAGCAAGGCCGTGGAGGACCAGAGGGTGGT
GAGGGAAGGCAAGCAGGAGAGGGAGACGAGCTGTAGACACAGCGATCAGGGAGGGAAGGG
CCAGGTGGACGTGTGGGGAGGAGGATGAGAGAAGGAACAGACCGTGCAAAGGTCCTGGGG
CAGGACTGGGCCTGGTGTGTTGGAGGAACAGCGAGGAGGCCAAGGAGGCCATGCGGCTGG
AGCAGAGGGGAGGGAGCAAGGGGGAGAGAGGGAGAAGGGAGGGGACGGGGCAGAGCAGGG
ACGTGACCAGCCTGCTCTTCGAAAGCTTCCTCTGGCTACTGGGGGAGAGTGAACTGCTGT
GTGGGGAATAAACAAGGAGGAAGCTGAACAGCGAAAACTGGGGCTGGGAACCGCGGGAGA
CAGAGGGAGCCAGCAGGCTGGGCCTGGGACCTCCCCGTCCATCTGCGGGCCCCCTCGCAG
GTCGTGCTGGGTGCTCCCCACAGCCGGGGCCCCCTCCAAAGCTGCCCAGGGGGGCAGGCC
CCCTGCCCCTGGTGCTGGGAGATGGGACACAGGATGACCAGGGCCACCCAGGCTCCCCTG
GCAGGAGGCGGGCCTGCAGACACACTGAGGAGCCTGGCTGGGCAATGCGCCGGCGGTGGG
GCGGCGGGCAGGCCACGCGGCCTCTTGGAGCCTTGTGGATGACACTGAGCTCAGACGGGA
CTCAAGAAAACAAGACCTGGGAAGGCTCCCTGGACCTTGGGTGACTCCAAAACCCTCAGG
ACGGTCAGTCTGTCCCCACTCTTCCCAGTGGCCTCTGCCGCCTTGCCCAGGCCGCTCTCG
CCCCTCCTCCCGTGCCACCCCACGCTCGGGTCACAATGGCCTCCATTCACGAGCGCTCTC
CCACCACCGGGCCTCTGCCTGGAACACGCTGCCCTGGTCTTTCCTCTTTGTCCGGCTTGT
CGCTCTTCACCCCCGGGGCAAGAACGAATGCGCCTTCTCCAGGAAGCCCTCCTGCCTGCC
ACCTCCCCACAACGAGCAGTAAGGGGCTCCTGGTGCCGACAGCCCCCCTGGGGACCCTGC
ACTCCCCGATCAGGGCATTCCTCGCCCAGGACCATTTACCCGCCTCTAGCGCAGCTTCCT
GGAAAACGTGCCAGGCCAGGGACACCACTACCTTGCTGTCCCTTGGGCAATACGAGCAAG
AGGGCCTCGAGGCTGGCTGACAGACAGACGTGTGCCCTGTGCCACAGTCCCCACCTCCAG
GGGGCCTGTGGTCAGGACCCGGGGCACGTGCTCGCTCACTCTGCACAGGACGGGGACAGG
CCGAGTGGTCCACCTGCAAGGCACTGACTGCAGGACATCAGGTCACCATGTGTCCTTCCT
CCCGCCCGATGGGCTCCTGGTGGCCCTTCCTGTCCCCACTCGCGCCCTGACTAGGAGCTC
AGGTCCTCCTCAGTTGGGTCCTGGCTGCCGTCACCCTGAGCGGCCATCAGATGCCCAGGG
AGCCCCTAACCATGGGCTGTGACCCGCACAGCGCTCCCGGCCCCCTAAATCCGCCGGCAG
TTGGGAAGCAAGCGCCCCTGCCCCAGGCATGTGCCGCCGGCCTCTGAACTCTCGGCTGGG
ACGGGGCGATGGGCTCTAGAACCTTCATGTGGTTCAGAACCAACGGTGCAGGGAGGGGGT
CAGACTCGGGGGGGTGGCTGAGCACTCGGCCTGGAGCCCCTTGCTCGGGATGCTGTGTGA
CCTTGGGCCAGTCTCCTGACCTTTCTGGGCACCAGTCCCACCTCCCGCTGGAGCAGCTCC
TGTGTCCTCAGGTCCCGGCTCCGCTCTGTGGCTCTATTATTCCCTTCCCTCCCCTCCCCC
AGCCGAGCATTCCACTCCGCGTGATTTATGTCTCCCGGCCGCCTGGCGCGGGCTCCAGCC
CGGAGCCGGCCGGCAGCTCTTCCGGGAAAGCAAACCAGAGGGTCTGGGCCTCGCTTTGGT
CGGTGGGTCATGGCTAGGGCTGCAGGGGCAGCTGGTGGCACTGGAGCCCCACCCCCCACA
GGACCCACCAGGGTGACCCCCAGAGCGAGGGGCAGTGGACAGAACTGCGGGCCCAGGACA
CGCGTGCCCCGACCACTTCCTAGGAGCCCGGGCAGCCCTGGGTCCCCGAGGACGGGGCCA
CCCTGGGATGGCGCAGGGTGGGGGTGGGAGCAGGGACAGGGTGGGGTCGGCCTCTTTGTT
CTGAGCCGCCAGCAGAGTCATTCCTGGTGTAGATGGGGAACAGACTCCCGGAGATCAGGT
GACCGGGGTCCCCGGGGGCTCAGGGCGGCGATGCATTGTGGGCAGGAACGTGCGGCAAGG
AAGCGCCTGGTCCGGGCAGGGCAGGGCAGGGCAGGGGTGGGCAGCGGAGGGTGGCCTGAG
CTGTCACCTCCAGCCCCGGCCCGCCCTGCACCCAGCCCGCCCTGCTGCCTCCCGGTGGAA
ACCCGGCCCTGGGATGAAGACGGCTCTCACGTCCTCAGGAGCCTCAAACGCCTGCTCGAC
CCTCAGCGCCAGCCAGCCAGCCGGCCAGTCTGACCCCAAAGCTGAGGAGGAGCTGGGGGC
GGGGTCCCGCCTCTAGAGAGAGGTGGGGGAGCCGAGGTGGGGAAGGCGTCGCAGGAAGCC
AGCAAGGGCCCGGTCCCCAGCTGCCACCAGCCCTGGCACGTGCTGCTGGGCTGCCTGCCT
CTCAGCTGGGGGACGAGGAGCCCCTCTGCGTGCCAGACACAGGGCGGGGGGGCGCAGACC
CAGCTGGGGCCCCCGCTACGCCCCCTCCACCTTCTGCGGCCTCACCTGGCACCGCAGCGC
CCTGGCCACTGCCCAGCCCTCCCACCAGGACGAAAGGGAGCAGCGCGCGGAGGGCACCGG
CCGAGCAGGACAGTGCTGGGTCAGCAGCAGGACAGGAGTGGGCACGGCGGGCAGGGTCGT
GGGGACTGTGGCCCCTGCCCTGGCACACAGGACAACCAGGACCGGAGCCCGCACCGGCGC
AAGGTGGGGCTCAGCAAGGACGTAGGGGTCGGACGGGAGATGGGACAACGGGCCGGACAG
GGCAGGACCCACAGTGCCAGAGGGCTGGGGCCCCCTCAGGAGCTAGAAGGGACTCCCCAC
CAGGCCGGGGGCTTCAACTGCTACGGGCCCCGGCGGGCACCCAGCCACAGGCACCCAGAC
GTGCACTATGAGTAAGTGACGAGTGAAAACACACACAAAGAGAGAGGAAAGATGCAGGGA
GAAGAGGCGCTGGGGGTCCCCAGGACACTCAGGGCCTGGAACCGTGGGTCCACGGGAGGC
CCGGGACCAGCCCTGACGTCAAGGCTGCTACACAGGCCCAGCACACAGCAGGCGCTCAAT
CAATGTGGGGACAGAGCGCCTCAGAGCCCTGGCCTCTCCTGCGCCTGCCGGTGCCCCATC
GGGAGCTCGCCCGGCCATGCCCAGAGCGGTCGGCCGTACTGGCCAGAGCCTCCCACAGGC
CGCCTGCTGCGAAACGCCCCTGCGGGCAAGCAGAGAGGTCATCTCCACCTCCTGGCCCCT
CTGCCTTAGGGAGTAAGAGTGCAGAAGCTGCCTCCCGGGGGCCCCTGGGGCCCCCACCTC
CTGGCGCAGCCACTGGCCACCCTGCTCAGAGCGGCCTGTGTGACCCACGGGATGTGGCAG
AAACCAAGGTGTGCACTTGCCAGCTCGGCCGAGGAGAAGGCTGCAGCTCCAGCTGGGCTG
TGCACACGCACATGCGCACACACTCGCTCTCCCCTCCCTGCCCTGGGTCACTGGTTCCAC
GGGAAGTGAGCCACCGTGCCACGATGGGGGACACTCGAGCCGTCTTGGAGGCCACCATGG
CGAGAACGGGGGTCCCCAGCCCACAGCCGGCAAGGAGCCCAGCCTGCCTGCAGCCACGCG
CAGATGCGGCCTCCAGCCTCAGCCGAGCCTTCAGACCGGGTGGACGCCCCCGACAGCCTG
ACCGTGAGCTCTTGGCAGCCCTGCACTGGGCAGTCCCCAGCTGGCCACTCCCAGGTGCCG
ACTCTCGGAAACCGAGCGCCCAGAGGTGTTGGCTACTGTGGGCAGCTGTCATCGGGGTAA
CTTGTTACACAGCAACAGCTCACTAATGTAAAGACCCAAAGGTGGCCCCGAGCTTCCCAG
AAGGACAGGCCCCGCCACCCCTTGCTGCTCCCGAGGCTCAGGAAGGAGGAGGTGGGTGCC
CCGGGGGGCGGACTCACCCAGCTCGGTGGGCTTCAGCAGCTCGTCCAGCATGTTGAAGAA
GGGCAGCTTCACCAGGCGCACCTCCGGCTTGAGGGTCTTGGCGGGCAAGCGTCCGAGTCC
GTTTAAGTACTTCCCGTACAGCACGGGGTAGTCGAGGTTGGGGCCCGAGAGGGGAGTCCT
GGGCACGGCGCCGGCCCGCTCGAAGGTCGGGTGCATGGCCAGGGGGTCCAGCGGCCGGTG
GGGCTGGGGCACGGGCTCCGAGCTCTTCTTGGCGTAGCGCGTCTCGTAGAGCTCCTTGAT
CTTCTTGAAGAGCTCGGGGCTGCAGTCAAACTGGACCAGCTGCAGGGCCCGGGTGACAAG
TTCGTGTTTCAGTCCGCTCTTACTCCGGCCGACGAAACCCAGGAGCATCTGCAGGTCGGA
GACTCGGAAGCTCATGACCATGTTCTGCGGACGAGCAAGCACAGACGCGCGGGTCAGGGC
GTCGCGGCCCGGAGGGGGGCCGCCACCGGGGCGCCCGGGCTTCCCCGGAGCATCTGCCCG
ACGGGGGGATCCCCCGGCAGCCCGCTGCCCGGGCCTGGCCCAGGCCCCCTGCGTTCTGGC
CGGCCGGGGTGGGGGGCCCAGGGCTCGGCACCCCCTCCAACGCAGGCTGCCGCCCCCCCC
CCCCCACCTTCCTCAGCCTCGCCAACGCAGCGAAAGCTCCGCCACTACCCCCCACACCAC
TGCCTTCTAATTTAGGTCCTCTTTTCCCATCTTCCGCCTGAAAGCGTCCCCAGGGCAGGA
ACTGGGACTCTTGCTCTACCGTCAACAGCCTCAGCCAGCCCCTGGCCCAGCACTCATGGC
CTCTCTGACCCTCGGGCTCTTCGTCAGGGAGGACAGGCTCCATCCCAGCGGGATGTGGGA
AGGACCAGATGACGTACCACACTTCCCTCTGCTCTAGAGGACGGGAGCCACAACTCGCCT
AATACCGACCACGGGCCAGGCAGTGAGCGGGAGCCATGATCACAGACTCACCCTGATCCT
TAAGACACCCCCACCAGGTTGGTGTGAGCCCCGAGTCACAGCCCAGGTTCAGCCAGGCCA
GCTCAGAAACCGGGGTAGCCGCTCTCTAAGACGCTGCCCCCAGCGTGACACAGAACTGAG
CGCTGCCATCAGAACGTCCCCTGATCACTCCAGCAGCCTCCAGGGGGCCGTCCCGGGCGC
TGTGGGGGGCGGAGCAGCACCCCAGCCCCCCCAATGACGCCAGGAGCACCCCAAACCCCA
GTCGTGACAATCGTACACATCCCACAGACATCACCATGTGTCCCCAGGAGGTAGGATCAA
CCCCACTGAAAACCGCAGATCTGAGGGGAAGGCTCTGGGAATCTGGCAGCTGGGGGTGCC
GTTCACTGAGCTGGGGCAAAGGGACAAACGAGGTCTGGCACTTAATACCTGGCAGGGTCC
CTCCCACCAGACCAAACCACACACAGGAGCCCAGCCACGCCAGGGTTTTCTCCTGGGCCG
TCTGGCGGTGGCCTGCCCTCCATGAGACTGGCCAGGGCGGGCTCCCCGAAATGCTCCCTA
AGCAGTGTGTCTGCGAGGGACGGGCCAGCAGGGTTTCGGGGCCATCCGAGCTGAGCCCTG
AGGCTGGCCTGTGATGAATGAAACGTGGTGGGAAAAAGAAACTTCCAGGGGCAATGGGAA
GAAGATAGCACAGGTCCCCAGAGTGGGGATGGATGGCTGGCGTGCTGGGGGCGGGACGAC
ACCTAAAGAAAGTCATCAATCGCTGAAACTCAACTCGAGAAGTTCTGACAGTGGGAGGAG
GGCGGGAACCCTGCCAGGTGTTTACGGAGCGGCCTGAGTGCCAGAAGGTTCTGGCATGTC
CCGTTTCCTGGCTGTCTAAGAGGCAGGCGAGGAGTCTGCTGGCGGCCGGGGACTCAGGAG
CCCTGGGCTCCCACACTTGCGTGGGTCCGTGCATGGGGGCGCTCAGCTCCCTTCTGGCTA
TACGCTCCTGCGGAAGGCGGAGGGGCCATCCAGGCTCAAGATAACAGTCCTGCCAAACCT
GGAGGGGGAGCCTCCGGCTGCAGGGTCCTCCTCCTCCTCCCTCACGACAGCCATGGAGCG
TCCACCACATGCCCAGCCCCACAGGGACTGGCGCCCACGCTGCAGGAGCGAAGGCTGAGG
TCCCAGGGGGCCTCCCCGCGAGTCAGGGGCAGGGCTGGCACACGGACCCCGGGCCGTGGG
GCTCCTAAGAGCATTTCCTTCCACGGCCTGGGGGCGCTCACTCCCCAGCACAGCCCCTGC
CTGGGGACCTAGGCATCTGCTGGCCCTCAGAGTCCGGGGCTCTGAAAACAGAGGCTCCCC
TCCCTCGGCCTGACGTCCCACCTGGAGCAGAGGAAAAAGGCTTGCAGACAAGATGTTTCC
TCTGGAAGGGGCCCACGGCCTTGGAGGGGAGAGACACCGTCGTGTGGAGGCTGACGGCGC
CATGGAGACAAAGTGGGGTGCGCTCGGCCTTTCTGAGCCCGACCACAAGGATCTTCTGAC
AGCAGGCTGCCCCTCGGAGCCCCCGCCCCACCGAGGCCGCCCCTTCCACCAGGGCGCACA
TCCGGAGTGGCCACAGGAGCATCCCGGGGCACACCCCTCAAGCTGCCATATGTTCGCCGC
TCGGGTTTCTCAGCAGCTGCCACCAGCAAGGAGCCTGCCCTTGACACAGGGAGGGTGGCG
TCTCGAGGGGGGCAAGGCTGCTCAGGAAGCAGCCCCAGCGCTCCGCAGATCACTTCCTGC
CATGCCTTCATCCTGACCCGCCTGGCCTCAGATCTGTTTATAAACAGCGCCAGGCCCCTG
CAGCTTCCAGAGGCTCAGCTCCGGGCTGGTGTGGAGCCGCGTGGAGACACGGCAGCCTGG
ACAGAGCTGCTGTGCCTCACGGCCCCTCTCCCGGCCATGGCTCCATGGAGCGGCCGTTGG
GGGAAAGCCAAGGCCCCCTCTTCAGGAAACCGGAGATCCGTGCAAAACGCTCCCCGCCAG
CTCAGAGTCCAGCGGCCACCCCTGCCCTCTCAACCCCTCTCGGGGGCCTAGGAGTCTCAG
ATTTCCCGTTTATCGACAGGTTATCAACAAGCCCCTCTCACACCAGCCCTTCCTGCACCC
CAAAAGACAAAATCTCCAGCTCTTAACACGAGAGGCTGAGAAAGCGCCTGAAAGAGGGAA
TATGTCAGTTACGCATAAGGCACTCCGCAGGGATGGAGAAGCTGAAGAAAAAGGCTCCCG
AGGAGGGAAAAAGTCATGCGGAGTCCCAAACCCCCTGAACAGCGGCCTGAAAAAAGGGTC
AACCTGATTTAATTGGGGTGGGGCGCCCCAGCCAGCAGAGGGCCAAGTAGAGTTCACCAG
ATCGTGTTTCAAGGCCCCGGATGTAAAAAGGAGCATAGACCCTATCCTCCGCTGGAGCGG
GGGTGGGAGTCCCAGGCCCACAGCCCCACTGGGGGGTGGGAGGGGTTAAATTTCAGGGCT
GGGGGACTTTGGGCCCTTGGGCTGCCACCTTGGGCTTACAGAGTTCACACCTCCACATCT
CTGAGGCAAGCCTCAATTTCTCACAACCCTGGAGAGGAGCAGAGGTGTGGGGGGGGTGGT
ATTGGGGGGGGCACTCTGGGGTCATGCCCTATAAACACAGAACCTTGAGGGCTGCATTCG
GATCCCAGTGGGAAGACATGGCAGATCTAAGAAGACGGAGGAGCCAGGGAGAGAAAACAT
TGACAGGTCAGGACCTCGGGGAGGAGAGCCCAGAAGGGGGAGACGGCCACGCCTCGGTCC
TGTGAAGGTCCAGCCCCCTCCCCTCCCCGGGATCAGCGGCCTTGAGTAAACTTCTCAGGG
CACTAAGGGAGAGCCCTAGTCCAGCCAGGGGCAAGGGTTCTGGAGCCTCACCTCCAGGAG
GGCACATCTCTGGGACAAGGATGCTCCTAGCTCAACTCCAAGAGAGTTTGAAGAGGCCAC
AAGCTGGGAGAAGGGATGGCATCTAGATGCGGAACCTGCACCCCCAACTGGAGCATGGGG
GAGAAGCACGAGGAGCTATCCCCAAAAAGAGGCCTAACCCGCAACCAGCCCCTCCAAGGA
CCAACACAAGACATCGGCAGAAAGGCAGGGGGGCCGAGAAGCCACAGCTGGGGTTCCTAA
GGGGACCGAAAGCAGGGGATCCGGGGGCTGTGTGGGGAGAGGGTCAGTTCGGAGAAGCAG
ACTGACAAGGACTAGACGAGCGGGGTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTCTTAAAGGGGCACGAGCCCAATACAAGTC
TGGGCGGGCGCCGGTTGCGGTCTGGGCAGAAAAGGCGGAAGCGGGCGGGCGGGCACGACA
AGGCGGTCAGGTGCCGCGGCCTTCGGCGCGAGGCGGCCGTCAGGTGTGTGCCCGTTCGCC
CCGCGGCGTCGGGTCGGGGAGGAGACGGTTGCTCCAGCGCGGCGGCCGCCAGGTCGCCCC
GCGCGCTGCACATCCGGGTCCTGGCGCGGCACATGGGGAGCAGGCGCTGCACCCCTTTTG
CTGGCCCCGGGCTGATCAATGCGGGACCCCCTCCCCGGTTCCCCGGAGCTCGTGCATCCC
TCACTCCCGCAGGCGACCCCTCCCCGCTAGTCCGCCTCCCCACCCACAGTAAACCTTTGC
CGCAACCTCCCCTGCTCAAGAGCTCTCCGTGGCTCCCCAGTGCCCGCCGCCGCGGAGCTC
TAACATTCTGGTGTCAAAAGCAGGAAGAAGCGAGAAGACAAATTTTATATTCCAGGGCCC
GTCCCCTGAGATCATCAGTCTCAGGGCAGGAATTAGGCGAAATTTAACGGTGCGCCCCAT
ATCACTCAGTCATCAATTATGTTAATATGATATTTTTAAAAATAAGAAATGCAAAAAAAA
AAAAAATCCAGGATGAAGAAAATATCCAAAATTTTCAGGCCAGACAGACTCCAGCTCTGC
AATGGCACACGTGGTCTCGCTCAGGTCTTTCTAACTGTTCACCTCACCCAAGCCCCGACG
GTGCAGGGTTCTGGTCTATTTCTATGACAAATTTTTATTTTCAAAATAGTTTTAAGATTC
GGAAGAAGTTGCAAAAATAGTGCAGAGTTTTACGTACCCTTCACCCAGCCTCCCCCAGGA
TAACATCTTACATAACCACCGAGGTGTGTTGTCAAAACCAGGCAATGGATGTTGATACAA
TACAGCCCTTATTTGCATTTCACTAGTTTTTACGTACACTTGGGGGCGGGGATACTTCTG
TGAAATTTGATCACACGTGTAGATTCTCACAACCAACACGGCTTAGCGCGTGAGGATGGC
ATCATGGCTGTGTTTTTAAAAGTATCTGGTCAAGAATATTTATGGAAGAAATGGCATAGG
ATTTGTCTTAAAATAACAGGGAGGTCGTGGGGCAGAAGAGCTGAAACACAGTGGCCTGTG
AATTGCTCATGGGTGAGGCTGGGGCACGGACTCAGGAGCGATTCATGACATTCTGTAGCC
AAGACTGCAGGCCCCCTCAGCTCTCTCAGGACCACCAGATCAAGCTCCTTCCGTGTGATC
AGCATTCTCATTGACCCCCATTTTCTCTTTTTTTCTTTTGAGGAAGATCAGCCCTGAGCT
AATATCTGCTGCCAATCCTTTTTTTTTTTTTTTTTTTGCTGAGGAAGACTGGCCCTGAGC
TAACATCTGTGCCCATCTTCCTCTACTTTGTACATGGGATGCCTAGCCTACCACAGCATG
GTGTGCCAAGCGGTGCCATGTCCGCACCGGGATCCAAAACAGCAAACCCCGGGCTGGACC
CCCATTTTCTGATGATGAAACCCAGGCTCAGAGATGAGAAGCAACCTGCCCAGACACTGG
CAGAGCCAGAAGACCATGCTTGTAAACTGCTTCAGACTCTTCCATCAGATATTCAGCGAC
ATCTCTCCATATATCCTGCAGCTGCTACAGGCCAGACGCTGTTCTGAGTCAGGGGTTGCA
AACGTGTTCTGTGAAGGTCCAGGTAGTGGATATTTTCCACTTTCCAGGCCACCTGCGTGT
CTGCAGCAAGTGCTCAGCTCTGCCATCTAGGGGCAGGCGAAAGAAGCCACAGACCGGATG
TTAACCACAGGCATGGCTGTGTGCCCATAAAACTTTATTTATAAACACTGAAATTTGAAT
TTTATGTAATTTTCACGTGTTCTGAGATATCATTATTATTTTGGTTTTGATCAAACATTT
AAAGGAGAAAAAAATATGTTGTTAGCTCATGAGCTGCACAAAAATAGTGGTCAGGCTAGA
TTTCGCCCCGCCTTCCTTCCTCCTCCCTCCCTTTCCTCTGGCTTTCCATTCTTTCTTTTT
AAAAAAATTTTAATTATGGTAAAGTACACATAAAATTTGCTATTTAGCCATTTTTAAGGT
CATAGCTAAGTGGCATGAAGCACATTCACATTGTCGTGCAACCATCCCCTCCATCCGTCT
CCAGAACTTTCCATCTCCCCAAACTGCAGCTCTGTCCCCATTAAACACTGACTCCCACCC
CTCCCCCAGCCCCTAGCCCCCATCCACTTTCTGTCTCTGTGGATGTGGCTCCTCTGGGGA
CCTCCGGTGAGTGGACCACACAGTATGTGTCCCTCTGGCTCACGTCACTGAGCATCACGT
CCTCAGGTCCCTTCACGTTGGAGCAGGCATCAGGCTCTCCTTCCTTTTCATGGCTGCGTA
ATATTCCAGGCTGTGGCTGGACCACACTGTGTGTGTCTCTCGTCCATCAGTGGACACTGG
GTTGCTTCCACCTTTTGGCGGCTGTGAATCCTGCTGCTACGGATGTGGGTGTGCAAACAG
CTCTTTCAACTCTTCTGGATGGATACCCAGGAGTGGGCTAGCTGGCTCATATGGTCATTC
TATGTTTAATGTTTTGAGGAACCTCCATACTGTTTTCCGCGGCAGCTGCACCCTTTTCCA
TTCCCACCAACAGGGCACAAGGGTTCCAATCCCTCCACATCCTCACCAACACGTTATTTT
CTGTTTGTTGTTGTTTGATCATTGCCATCCTAATGGGAGTGAAGTGGTATCCCATTGGGG
TTTTGATTTGCGTTCCCTGAGCGTTAGTGATGAAGATTCTCATCCTTTTGTGTGCTTACT
CGCCATGTGTGTATCTTCTTTGGGGAAATGTCTAGTCAAGTCTTTTGATCACTTTTTTAA
ATCGGGTTGTTTGTGTTTCGTTTTGTTGAGCTGTAGGAGTGCTTTTTTGTTTTGTTTTGT
TTTTTGAGGAAGATTAGCCCTGAGCTAACATCTGCTGCCAATCCTCCTTTTTTTTTTTTT
TTATTGCTGAGGAAGACTGGCCCTGAGCTAACATCCGTGCCCATCTTCCTCTACTTTCTG
TGTGGGATGCCTACCACAGCATGGCGTGCCAAGCGGTGCCATGTCCGCACCCAGGATCCG
AACCGGCAAACCCTGGGCCACGGAGAAGCGGAATGTGCACACTTAACTGCTGCGCCACCG
GGCCGGCCCCAGGAGTGGTTTATATCTTGTGGAAATTAACCCCTCATGAGATACACGATT
TGCAAATATTTTCTCCTAATCCCTGGGTCGTCTAACAATATTATTAAGAAGTAAATACTA
CCCAAAGCAATCACAGATTCCATGCTGTCCCTGTTAAAATCCCGACGTTTTTGCAGAGAG
AGAAAAACGCCTCCTAAAATTCATGTGGAATCTCAAGGGACCCCAAATAGCCAACACAAT
CTTGAAAAAGAAGAACAAACATAAGAACTCACATTTCCCAATTTCAAAATTTACTGCAAA
GTGATGTAATTAAAATAGTGTGGTGCTGGCATCTGTACAGACACATAGACCAATGGAATG
GAGTGGAGAGTAAATTTTATGTTATGAATATTTTGCCACGATTTTTTTAAAGTATGAAAA
AAGAAAAAATTGGGGCCGGCCCAGTGGCATAGCGGTTAAGTTTGCGCACTCTGCTTCCAC
GGCCCAGGGTTCACCAGTTCGGATCCTGGGTGTGGACATGGCACCGCTCACCAAGCCATG
CTGAGGCAGCGTCCCACATAGCAGAGCCAGAAGGACCTACAACTACAATATACAACTATG
CACTGGGGGACTTTGGGGAGAAGAAGAAGGAAAAAAAAAAAGATTGGCAACCGATGTTGC
CTCCGGTGCTAATCCTTGAGAAAAAGAAAGTGAAACTAATAAAGTTAAAAAAAAAAAAGA
GAGAGATTCACCCGAATGTTAAGACCCAGGGAGGAGTTGAAGCTGCAGTTCAAGTCCGAA
AGGCATCTGCTGGCAGAAGTCTTCTTGCTGGGAGAGGTCCATCTTTTTGTCTAGCCAGGC
CTTCAACTGATTGCGCAAGGCCCACCCACATCAGGAAGGACCATCTCTTTTACTCAACAG
TCCACCGATTTAAATGTCAGTCTCATCCAAAAACAACTTCACAGAAACAGTCGGGATGAT
GTCTGACCAAATATCCGGGCAGCACGGCCCGGCCAAGCCGCCGCGTACAATTAACCAGCA
CCCCGGAGTAAGACGGGATTCACGTTTACAAAGATGCTTCAGGCAGCTGTGGAAAATGGA
TGGTGGGAGACAGGAGGGGAGGCAGGAGGCCAGGGAGGAGGCTGGTGCGTCACCCAGGCA
AGCAGTGATGGGGTCCTGGACCAGAGCGACAGGCGGGGGGCGGAGGGGATGGAGAGAAAT
GGACAGAGTCCAGAGGTTTCAGCGCACGGTTCACTTAAAGAATCTTAATAGCACCACCTT
ATAATTTTTAAACATTTCCATCACCCCCCAAAAAAACCCGTTCCCTGAGCAGTCACCCCC
GCCCCCGCCCCTGGCCCCCACGAGCCCGCTTTCTGTCTGTGGATCTGCTTGCTGCGCGCA
TTTCACACCCGTGGGCTCCCACCACGTGGGTCGCATCCCCTGCCGTCCCACGTGACCCAG
AGAGCGGCGCCTCCAGCCCGGCCTCCCCGCACTCTGCATCCGCACGTGGCGCCACCGGTG
TCTCCCGGCCTCCCTCCCGAGCGCCAGGCCCTCCTCCCATCTCAGCGCACGGCAGCTCCT
CCTTCCTCCTCATCCCGCCCCGAATCTTGAAGGCGGCGTGGACTCCCGTCTCCCGCTCAT
TCTTCACGTGCAGCGCGTCAGCCCGAACCCTCGGCTCCGGGGTCAAAATCTATCCTAAAT
CTCAGCCCCTCCGTGAGAGCCACTGGGGCCAGTACCGGCCCCTCCGCCCCCGCCCCCACC
AAGGTCTGTCCTCCCTGCAGCCCCCACCAGAGGGCGCCCGGGAGCCCTGAGTCGGTCCCG
CCCTCCTCCACCCGCAGCCCTCCAGGCTCCCCCTCCCTGGGGGGAGAAGCCGAGTCTTTC
CCGCGGCCCCCCACGTCCTGCCCGGTCCCCTCCCTGTCCTCTTTCCTCCCTCTCTCCCCC
TCCTCCCTCTGCTCCAGCCACACGGCCTCCCTGCTGTTCCTCCAACACGCCAGGCACGTT
CCTGCCCCAGGGCCTTTGCACCTGCAGTTCTTGCCTCCTGAAACACCCTTCCTGCAGATG
TGCACAATTGCTCCCTCCCTGGCCATCTTCAGGTCTGTTCTCTGATATCTTCTGACACAT
ATAAAGGAACTACTAGCTATCTGTCCCCAGTCCTCCCATCCCCTCTTCCTATTCCACTCC
CCTGCACAGTACTTCTCACCATCCCACAGACCATATCTTCCGCTCCGCTCTTTATTGTCT
GCCCCACAGGAATATACGCGCCGCCAGGAGAGGGGTGCTTGTCCTGGGTCCCCATAATCT
CAACATCTGGCTCACTAAATATGTGTCGGATGAATGAATACCATCCACACTCTAAAAATT
TAGAGCGTGTCATTTAAAAAAAAAATCGCTTAAAGAGTTTTTCTCAACTCTGGCGCTGTG
GGCATTCAGGGCCAGCTCATCCTCTGTGGGGGACATCGCGGGCCCTGTGGGGTGTTGAGC
AGCCTGTCTGGCTCCCACTAACTCTATGTAGAAGCACCTCCAATGTGACAACCACAGATG
TCCCCAGACATGGCCCAGTGTCCCCTGGGGGGAGAATGACTCCTGGGTGCCATCCAGTGA
TGTAGGGTGAGCATTACCTGTTTGTTTCATTTCACAAATGAGGGTCACGTGGGCCCGGGA
CGTGTCGGGGGTTCTCACTGGGGTCTCCACTCGGAGGCCCCTGGGGGCCTGGGACCAACC
CGACTTACTGCCATCAGTCATCCTGCTGGAATTAAACTGATGTCCCTTTTGCGTTTAAAG
ACATCCTGATGTGCCACTTGGTAAATGGCTGTATCCACTCAAGCGGGAACCAGGCAGAGT
ATGACTCAGCACTTCCACTCCAGGGGACACACCCCACAGAAAGGCTGTCGCGGGACATGT
GCTAGAATGTTCCACGGCGGCAGCACTCATAACGCACCCAAGCGGGCAACAACCCCGACG
CCCACCCACAGTGACATGGATCAATCGGGTGCGCCAGGGTCTCCAGAGGAGGATACAGCA
GGGAGAGCAAAGTTCATGCCGCCACCACATCCGCAAATCTTCGTTTGAACATCGAGCGCA
GGAAACCAGGTTCAGAAGAGGCCACGCTGCTCGGTTCCACGGTGACGACATTCGGAAATA
GGCCGCCTAGAATCTATGATGTTGCAAGACGGGACGGTGGGCGTCTTTGGGGCAGGAGTG
ACCGGAAGAGACACAAGGCAGATTTGCAGGGTTTCTGGGGGCTGGTTATTCTGTAGCTTG
ATTTTCATGTTGCTTATGGGGGCGTGCTTATTTGTGAGAGCCACTGGATTTTATACGTCG
TATCTATGTTCTTTGTTTATTGGTTAAATTGTAATCACAACGTTGCAAACGAAAAGTGTT
CCGATTTGGATGATAAGTTATAAGGACCCTCTTCTCCTCCAGCAGGGGAAGTGACAAACT
ACAGCCCGCTGGCCGTGTCTGCCCCGCGGCCTGTTTTTGGAGGCCCCAGGAGCTAAAGGT
GGTGTTTGCATTTTTAAGTGGTTGGGGGAAAAAAAAATCAAAAGAAGAATCTTGGGTCAT
GTCACGTGAAAATTGTACGAAATGCAAATGTTAGCATCTATAAATAAAGTTTTATTGGAA
CACGACCACGCCTATTTGTGTATGTCTGTGGCTGTGCGGCTGCTATAACAGCAGAGATCA
GTAGCTGTGATCGAAACTGTGTGGCCCGCAAAGCCAAAATGTTTTCTACTTGGCCCTTTA
AAAAGTTAGCCGACTTTTGTCCTGGCCACTCCATCTAAAGGCTCTCTCCTCTCTTTTTAC
ACTCCCTCCCTGTGTACAGGTAGTGGTACAGACAGCCCCACTGTTTTGTTTTTTCTCTGT
GCCTCCTACCTCAGGACCTTTGCACTTGCTGTCCCCTTTCCCTGGAATGCCTCCTCCTCT
TTTGCCCATTGAACGCGTTCTCATCTTTCAGGTGATAGTTTAAGAATCACCTCCTCCAGG
CAGTCCTCCCTCATCCGCCAGGCTGGATCATAGCCCTCCCCTTTTCTACTCTCTCCCTTG
CTCTTTCTCTGTCTCCTTCCCGGCACGATTTAAAAGGTTCAACTTGTGCGAATATTCTTG
ACTCTTTCCTCCAGCAGCCCATCAGCTTCCCGAGGGCGGGAAGTCTGTGTTTCCGCAGGC
TCCTGGGAAACATTTGCTGGACCAGTGAGTGCCGGGCCTGAGGGATGCGAGGCGTTCCAG
GCGGAAGGGATGAGCCAGGTTTCAAAGCCAACGGGAGTGTTTGCAGGTGGGGAGGGGTGG
GGCCTGGCGGGAAGTCCCCCAGCCTGGAGGTCCCACAGGGCCAGCAAAGCAGCAAACAAA
TGCAAAACAGCTCACAGCGGTCTCTAATCTGGTCCCTAAGGGCGTGCTGGGAGCCCCCGC
GGAAGGCGGGTCCCGAACAGGCTGTCGCCCTCACCAGTGGCACTCGAGCCTCACCAGGCT
TTCCTTGGATCCCCTGTTCTTACGAGGCAGCCTCGCCAGACCTGCCTGAACCCTGCTTTG
CTCAACATCCCTGAGGGGACAGTGGCGCCCCTTCCTTGGGGCGTTTGGCGGAGATTTCAA
CGCCACGCTGCCCACAAAGAGCCCTCTGCAGTCATGCTGGCCCAGAAGCCAGGGAAAAAT
CAGCAATCCTGGTCGTGTCTTTATTTATTTCAACTCTGGGGGTTTTGTTCCTCGTGGACT
TTTCTGGCTTTCTTTTGGATTGAAAAAAAAAGGTATTTAAATATTATTATCATGCTGACT
GAGGGTTTTTTGGAGGCCTCTGGATACCTCACCCCAGACCCAGGATGTCGCAGGCGCTAA
TAAATGAGCGTAGAAGGAAGGGTGGCAATGCGATCTAACATTTCCATCCCACCGTGGGGG
CTGTTTTAGCCGGCCAGGACCGCCACCGCGAAATGCCACGACCTCGGTGGCTTCAACCAC
AGACGTTTATTGTCTCGTGGTTCTGGAGGCCGGAAGACTGGGCTCGAGGTGGCAGCGGGG
CCGCGTTCTCTGAGGCCTCTCTCTAGGCCAGTGGATGGTCATCTCCTCCCTGGGTCCTCA
CGGGATCTTTGTTCTGGGTGCGTCTGTGTCCTAATCTCACCAACTGGGGCCACGATGGAT
CAGGACCCACCCTAATGACCTCATTTTAACCTAACTGTCTCTTTAAAAGCCCTACGTCCA
AAGAGAGTCACATTCTGAGGTCCTGGGGGTCCGGGGACTTCAATACATGAATTTTGGGGG
GGACATAGTTCAGCCCATAACAGGAGCAGACTCTTAAAGAGGGTCAACTGTGTGCCAGGT
ATTAATTTCTTTGTCTCACAAGAGCCCTGTAGGGGCCGGCCCGGTGGTGCAGCGGTTAAG
TGAGCACGTTCCTCTTCGGCGGCCGGGGGTTCGCCGGTTCGGATCCCGGTTGTGGACATG
GTACCGCTTGGCAAGCCATGCTGTGATAGGCATCCCACATATAAAGTACAGGAAGATGGG
CACGGATGTGAGCTCAGGGCCAGTCTTCCTCAGCAAAAAAAAGAGGAGGATTGGCAGCAG
ATGTTAGCTCAGGGTTAATCTTCCTCAAAAAACCCCAAAAAACAAAAAACAAGAGCCCCA
AAATAAAATAGATTCTGTTCTTATTCAGTATTTTACAAGCAGAATCTCAGGCACAGAGAG
GTTAAGTAATATGCCCAAGGCCATACAGCCAGTGGGGGCAGAAGCAGAATTTAAACCCAG
GATGTCTGGCTTTGGTTAACCAAATCTGAGAAACATCTAGGAAATACTAGTGTGGCAGAG
TTGCGCCCTGATTAAACCATGCCTTTTAAAACATTGCGGTAAAACAGACATAACATAAAA
CTTACCATTTTAACCATTTTTAGGTGCACAGCTCAGCAGCATGAAGCACATTCACACTGT
TATGCAACCATCCCCACCATCCGTCTCCAGAACTTTCCATCTCCCCAAACTGAAGCTCTG
TCCCCATGAAACACTGACTCCTCACCCCTCCCCCAGCCCCTGGCCCCCCATCCACTTTCT
GTCTCTGTGGATGTGGCTCCTCTGGGGACCTCCTGTGAGTGGAACACACAGTGTGTGTCC
TTCTGTGTCTGGCTCATGTCACTAAGCATCACGTCCTCCAGGTCCATCCACGTTGGAGCA
GGCATCAGGATCTCCTTCCTTTTCAGGGCTGCATAATATTCCGTTGTCCTACCGCTAAAC
CATGCCTTTTCGAGTGCACTCTAATGAGCTGTGTGACCTTGGGCAAATCTTAACATCTCT
GAGCCTCAATTTCCTCCAGCTTAAACGAGCTCACCCAAAGCCCAGGGCGGGGGGAGGATT
AAGGGCATTCATTGATTAAAGGGCGGTGGCTGGTAGCTAATAAGCATCCAAAGGCACATG
CAACGGGCGTGCAGTGGCGGGCGCTGGCCAGCAGGGGCCGCTGCCGCGGGTTCCACGCCC
GGCTCGCGCCGCGAGGGGCGCATGCGCAGCGGAGCCTCCCTGCAGAGGTGGCTCCTTTCT
CCGGGCTCCTCCCCGCGCTCTGCCCCGCCTGTATTTATTGCTGCAGACCTTGGAGCTGGC
TGTGGCTGCTGTAGGTCTCTGCTGAGCCCCGGCTCCCCACTCCCCAAGCTGCTGCTCAAC
ATGAGGCTGGGGATCGCGGTGGGGAGAGGTCCCTTGCCAATATATGGCCCCATCTCTACA
GCCCTGGGGCCGAAACACCTCCCCACGCAGGGTAACGATGGGGGAAAAAAGACTTCGATC
TCTCTAATTCCCCTTAAACTCTCCCCTCCTTCTTCAACTTACACTAAATTTTTTTCAATA
AGCACTCTGTTCACTTGAGAGCGAATTCAACCTCCCTTTGCTTTTCTTCTCTGAGATGCC
CCGTTTGCAAAGTGCTGCGGAGTGCCTCCCATGCAGCCCAGCACACAGTGGGTGCTCAGC
GCATGTAAAGATTTCAAGAGAGTTTTTTTTTTTGATTGAAAACATTGTTAAAAATGGGAA
ACGGGATACCCATCGGCTGAAAACGCGTCCTCCAACGAGCTGGATTAACATAAAACTTGT
CACGAATACAGGTGTAGGTGTTTAAAGACGCCTGATGGAGCCCCGGGGAATCGACATCTG
ATGCCTGCCACTCCCTCTGCCATTCTGAGCCTCGATCATCTCGTAGATGCTTATTGGGCA
GCGCCTATCTGCCTCAGTTTCCCCCTGGGTTAAACGCGGGATGGTGATAGCAATCTCTGA
TCAAATGAGATCAGGGCTGGGACAGCGCCTTAGAAAGCAAAATGCGAAAGCATTTGCGGG
AGGGAGGAGCGCACACGCTGATTTTAGAGTCCAGACGCAAATTTGCATCGCTTTCTGCAG
AGGCGCATTTCCGCTGCTCCCGGCGCAGGAAGAGCCCTGCAAACTCTTTCCTTTTGACAA
GAGTGAGTTTAGAGGAAAGATTTACCGAAGGGCGTTGATTTGCGCTCATGAGAATCTCAT
GGATGCAAGAAATACTTCTGGACCAGGCATGGTAGCTGGGCTCTTTCTAAAGAAAAAGGT
TATTGAATTGAATGCCAATTCGTTCCCTCGAGCCAAAGATCGGAAGCACAACTGTTTCTT
AGGGTCAGATTAGGACACAAATGCAAAATAGGCCTCCTGCGCCTCCCCCTGGAGAGGAAA
TGAATAAAGAGATTGCGCACGGAAAGAAGCGCTCAGCCCCGTGCCTGAGACCCGGCAAAG
CAGCCCCTGAAATAAATGAATAAATTCATTTATAAATAGATGAAATAAATGAATAAAGGA
AATAAATTAACAGCAGTGATAACTAATTAAAATAGCTGACGTGTATTGAGAACCGTGTCA
GGCGCGGCGCAAATCTCTTTACGTGTATTTAGTTAATTTCACTCTCCCCCCCCCCCCAAA
GAATGAGGTGGCCCTTGTGCAGACAAGGAAACTGAGGCAGACAACTCTGAGCAACTAGTG
TGAAGACACGTAAAGTGGTGAAGCATCATCTTCCATGACAATGTCAAAAAACCAGGTAAT
TGGGATAACCCACAAACCTTATTGACATAGTAATGTGCTTCTAATAGAAGTGCTGGGCAA
ATGGAAAGGTAATCTAGTTGCTATGATGAATATGCTCAGTTAAAACGGCGCTCGTCGCTT
TGTGCCCCCGAGGTGTGTGATCAGCTCGGGGCGGGCGGACCACCGCCCGGGGCAAACCCA
GCCGGGGAAAGCCGATCCTAGAGCAGCCGCGCCGGCGCCTAAGGGGTTAACCGGAGGAGC
GCGTCTCTGCGCCTGCGCGCGGCGTCGCTTCGCCCCGCCCCCCGCAGCGCAGTCAGAGGA
TCCGCCCAACCGGCGTCGGCCTATAAAAGGCGGGGTGTTGACGTCAGCGGTCTCTTCCGC
CGTCGTCGCCGCCATCCTCGGCGCGGCTCGTTTCGCTCGGATCTGTCTGGGAGAATCCAC
CGCCATCCGCCACCATGGTGAGCGACGCCGTCCGGCTGGCGGCCTGGAGCGGCGTCGGGA
CCTCCCCGGGCGTCGGCGCTGCCAGGCTCGGAAACGCTTGGGGAGCCGCCGGGCTTGTGA
AGGAGACATGCCGAGGCGGCGGGGTCGGTAGGCCCCGGGGCTGCCTAATGCTGTGACCGC
CGGCAATGTCCTGCGCGTCGGCGCTGCCTGGCCGAGCCCTCTTGTCCGCTTCTTGGGGAG
CGCCGCCGCCTTCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNAGACCCGTGTTGTGTCGAGGTCCCGGGGCGCCGGGA
AGGGGCAAACGAGGGGCGCCTGGCTTACGAAGCCTCCTGTCTCCTCCGAGCGCTGTGTAA
CCTTGGACTGGCTCCTTGGTCTCTCTGTGCCCCTGATCGTGAACAGCTGACCCCGGAGCC
ACGGAGCGGGGGTGGCTCAGGCGTGTTGGGGCTGCGCAGGCTCCCCCCGCACCCGGCTGG
TGTCTGTAGTGATCTCATGGGGTGGGTGGCCTTATCTGATTTCTCTCCTAGCCAGAGAGG
TGACCTTGGACTTTAAGGGAGGCCCTTGGGTCTGGGGAAACCTGGGGGCCACACGGAGGG
GGCTTTGGGGGGCTTCATCCATCCCGTGTTGTTTAACTGGCCGCTGCGACCCCCCATACG
TGTGCCCCACCTAAGGGGACCGAGATTCCGCAGCTGCTGTTGCGGGTTGTCATTTCTGAG
TGACAGCTGGAATCTGGGTCTCAGAGATGGGGTGGGTGGTGTCTTTAAAGGGCTGTCTGC
GAGGGGACTGGAGGTGGGAGTTGGGGCAGCCCCAGGACCTGCCCGCTCCCAACCGTGGGC
CCGGCACCCTCCATCGATCGGGGTGTCCCTGCCAAGCCTGGTGCCTGGCGCCCAGGCCCA
GCCTGAGCCTCCTCCTCCCTCCCCCTCCCGGCGCAGGTGAACTTCACGGTTGACCAGATC
CGGGCCATCATGGACAAGAAGGCCAACATCCGGAACATGTCCGTCATCGCCCACGTGGAC
CACGGCAAGTCCACGCTGACGGACTCCCTCGTGTGCAAGGCTGGCATCATCGCCTCCGCT
CGGGCCGGCGAGACCCGCTTCACGGACACCCGGAAGGACGAGCAGGAGCGTTGCATCACC
ATCAAGTCGACGTGAGCGAGCCCCCGCGTCCTGGGGATGGGGGTGGGGGGGGGCGCCTGC
GGGAGGCTGGAGCGGCCCTGGGTGTGGGGAGAGGCAGGTGACATCCTTTTCTAGGCAGCC
TCTTGCGCTGAGTCACACGCCTTGGGGTTGGTGTTGAAGCCTCTCAGGAGGATGGAGTTC
AGCCTCAGGGGAGTGGGAAGCTGTGACTGGTGGGGGCACGGTGACAGGTCTTGGTGGCGG
GGCCTTGGAGGCTCTGCCAGGTGGTTCCCTCTTCCTGGGGCCAAGGGATTGGTGACGAGG
TCTGGAGAAGTCTGGGAGGGGCCACTGACCTTTAAAGGTGCTGGACATCCGCCCTGCTCA
GGATGCCCCAGGTGTTAGGAGGGTTCAGAGCCTGAAACCAAGTGACTGAATGTCAGTTGC
CCTCGATGGGCGAGTTGTGGGGTTTTCTGGGTTCTCTGCTCAGAGTCACTCAAGCTAGGG
CTGGAGAGAGCGGAAAGTGGGGAGGGAACAGTGAAAGGTGGTCCCTGGGGTTGGTGGGTC
TCACCTGGTTATGGTGGTGTTCTTAGAAATCAGATGTGTGAGCCTGGGAGGGACAGGTGG
GGGCTGGACCCGTGGGCTTTCTGTCTGGTCCCAGGGAGGGGGCGTCCCTGGCAGAGGGCG
CTGCAGAGGCAGAGTCCCCTGGGTGGGATGGCTCGAGTGGGAAGTCTGAAGTTTCTCCAG
GGATGAGTAATGCAGGGGGAGGGGACGGCGGGCAGTGGCTGCTCCGGCTGCGCACCTGGC
TTCTTGCTGCGTCTCCGCCTTCCTGAGGGGCTGAAGGTCTTAGTCCTGGCTCCCCTTGGG
CAGAGCCCGGGCCAACCCTGGGGGCACGGGGAGGCCAGTGTAGGGCCAGGCTGGGGGTGG
CTTCCAGCAGCCGACCTGTCGCCCCCCCACCCAGGGCCATCTCCCTCTTCTACGAGCTCT
CTGAGAACGACCTGAACTTCATCAAGCAGAGCAAGGACGGCTCCGGCTTCCTCATCAACC
TCATCGACTCCCCCGGCCACGTGGACTTCTCCTCGGAGGTGACCGCCGCCCTCCGCGTCA
CCGACGGGGCCTTGGTGGTAGTAGACTGCGTGTCGGGTAAGCAGCGGGTCCCCTCGTGCC
CCTGCAGCCTGGGGCCGTCCTCCCCGGGGCTGACGGCGGCGCCCTGTCCTGCGCCCAGGC
GTGTGCGTGCAGACGGAGACGGTGCTGCGGCAGGCCATCGCCGAGCGCATCAAGCCTGTG
CTTATGATGAACAAGATGGACCGCGCACTGCTCGAGCTGCAGCTGGAGCCCGAGGAGCTC
TACCAGACCTTCCAGCGCATCGTGGAGAACGTCAACGTCATCATCTCCACCTATGGCGAG
GGCGAGAGCGGCCCCATGGGCAACATCATGGTAGGTCGGCTGCCCGCCTGGCATGCGGGG
GCCCCAGCCCCCCGGACTTATGATCTGGAAGTGGCTTTGCTAGGAGTGCTGGTGTGACAA
GGGGGCTGAAATGTTTGAAGATGATTTGGTCCAGCGCTTGAGCTCTTAGGGGAGCGCAGG
GCTGGATGGTCCCCTGCCTGGATGGTGCTGTGGCCGGGCCATCAGTTTTCGCACCCCCTT
CTCTCCCGGGGGGAGGCAGGTTGGGCGCCGTTTATGTGATGACTGAAATTTCTTCACTTT
GACCTGATGTCTGTTGAAGAATCCCATTGTCTGAGGTCTGCGGCGCCTGGGGCCAGTGGA
GCTGTGGGCTGTCCTGCTGCCCCCTCTCACAGCCCTCGTGTCCCCTCAGATCGACCCCGT
CCTCGGCACTGTGGGCTTCGGGTCCGGCCTCCACGGCTGGGCCTTCACCCTGAAGCAGTT
CGCGGAGATGTATGTGGCCAAGTTTGCTGCCAAGGGCGAGGGCCAGCTGGGGCCTGCGGA
GCGAGCCAAGAAGGTGGAGGACATGATGAAGAAGCTCTGGGGGGACCGGTGAGTGCGGCG
GGGCGGCCGGGGCTCTCCAGCGTGCCCGCGGGGTGGGGGGCCCTGCTCAGAACCGCCGGG
TGCCTGGGTGCTCCTGGCCAGCCTCGTTCCTCCGGATCCCCCTAACCCGTCTCGGGCCTG
CTCTGCCAGGTACTTTGATCCAGCCAACGGCAAGTTCAGCAAGTCTGCCAACAGCCCTGA
CGGGAAGAAGCTGCCCCGGACGTTCTGCCAGCTCATCCTGGACCCCATCTTCAAGGTGGG
CCACTGCGTGTGGGTGGAGCGGGTGGCCCCGGGCTGCCTTTGGGCCCAGCACCTCCCCAG
GACCTGCTGGCGGGCACGCTGCAGTGGGGCTGCACGGAGCGTGCCTGCCAGGTGGCTGCC
AAGAGGGGAGAGCTGCATGCCGCCAGCCGCGGGCGCTGGACCCTGACAAGCTTGTGTCCA
GATCTCTGGGCCACATGGTGGGGCAGCTGGCCTCCCTGGCTGGGGCGGGTGGGCAGGATA
CGATGGGAGGGATGACCCACGCCTTGCCCGATGTCGAGTCCTAGGTTCGGAGCGGGGTCG
TCTGCTCCGCATGGGCTTTTCTCCCTGAGCACTGTGGGGAGGCTACCGGGCCTGAGCTGG
GTGGCAGTGGTGGGGTGGGGCTGAGGGTCTTTGCAGCCCTGCTTCCTGCGGGGCCCCCTT
TCAGCAGAGCTGCCCGTGGCGGTCCCAGGGTGCTCACAAAGCCACTCTGTGCTCTCCTTG
GGTCGGTAGGTGTTTGACGCGATCATGAACTTCAAGAAAGAGGAGACGGCAAAGCTGATC
GAGAAGCTGGACATCAAGTTAGACAGTGAGGACAAGGACAAGGAGGGAAAGCCGCTTCTG
AAGGTGGGTGCCGCCCGCCCGCCCGCTGCCCTCGGGTGGTGGGACGGCTGCCCTCGGGTG
GTGGGACGGCTGCCCTCGGGGCTCCGGGCTCCATCGGCCCTTCTAGCGGGCCCCGGCCCT
CTTGGCAGCGTCACCTGCCACAGGCCCGTCCCCCAGGGGGTGGGAGACCTCAGTGTCTGC
TTGCTCTGTCCTTCTGGAAGGGGTCCTGCGTGGTGGCGTCCCTTAGACAGACGTGTGACC
CTGAGCCCCCCGTCTGCCCCGCAGGCTGTGATGCGCCGCTGGCTGCCCGCCGGGGACGCT
CTGCTGCAGATGATCACCATCCACCTGCCGTCGCCCGTGACGGCCCAGAAGTACCGCTGC
GAGCTGCTCTACGAGGGGCCCCCCGACGACGAGGCGGCCATGGGTGCGTGGGGCGCCGGG
CGGGAGCCCCAGGGCGGCTGCTGTACGAGGGTGATGCATCACCCAGCCTCGGCGCGCAGC
GTTCCCGCAGTTTGAGCTGCGGGCACTCACGCTTTTCCCCTTGGGGCTTTGTCTCTTGTT
CCTCAGGTATTAAAAGCTGTGACCCCAAAGGCCCCCTTATGATGTACATTTCCAAAATGG
TGCCGACCTCTGACAAAGGCCGGTTCTACGCCTTCGGCCGGGTCTTCTCGGGGCTGGTGT
CCACTGGCCTGAAGGTCAGGATCATGGGGCCCAACTACACACCCGGCAAGAAGGAGGACC
TGTACTTGAAGCCCATCCAGAGGTGAGCGGCCGGTGGGGCTGGCAGCGCCACCAGGCGGC
AGGGACGGCCACAGGCTTAGAGGGAGGAGGCCTGTCTTGCAGCCATGTGAGTATCTGGCC
CTCTGGGGCTGGCGTATTGACACCTGTTGCGTCTCTTCCAGGACAATTCTCATGATGGGT
CGCTACGTGGAGCCCATTGAGGACGTGCCTTGCGGGAACATCGTGGGCCTGGTGGGCGTG
GACCAGTTCCTGGTGAAGACGGGCACCATCACCACCTTCGAGCACGCCCACAACATGCGT
GTGATGAAGTTCAGCGTCAGCCCCGTCGTCAGGGTCGCCGTGGAGGCCAAGAACCCCGCC
GACCTGCCCAAGCTGGTGGAGGGGCTGAAGCGGCTGGCCAAGTCGGACCCCATGGTGCAG
GTGGGTGGGCGCCCCGCCAGGAGGCGATGGCTTTTGTCTGTGGCTTACGTCCCGAGTGGC
TGAGCTGGGGAGATGGGGCGGCTTCTTACAGTGCACCTGCCCGGGCACAGCTGTTGCCCA
TCCAGGGGGCGCACCGCCACCAGCGCTCGCGCGCAGGCTGCTTGGATCTCTGCAGCTCTG
TTGACTGTGTGCTGGGCCTCTGTAGGGCGTTAGTGCTGGGAACCAGCAGTAACGGCATGT
GGGGCCTGTCCCTGCCTCCTGATGCCTTCCCTGAAAACCCTGTTTGGGCAGGGCCCCTCC
CCAGCTGGAGGGAAGCTGGGAGCCGGTGCTCCGGCCGTGCCCTGGCGTCCCCCGGGTTCC
TGGAGCGTCCGCGGTGACACGTGGCTCCCTTGCAGTGCATCATTGAGGAGTCGGGCGAGC
ACATCATCGCGGGCGCCGGCGAGCTGCACCTGGAGATCTGTCTGAAGGACCTGGAGGAGG
ACCACGCCTGCATTCCCATCAAGGTGAGCCGCGGGCGCGCCGGGGCCTCTCCCCGGGACA
GAGGGCAAGGGAGGCGCCGGGCTGGGCGCTCCGAGGAGCCGCTCGGTTAGTGGCTTCAGC
TCTTCACCCCCCTCGACCCGGTCCTGCCAGATAAGCACAGGTGCTGTTGGAAAACCAGCA
GTTATGCACTGCCTCAGATTTTTTTTCCCTCAACTGTTGTTTTTTTTGAGGAAGATTAGC
CGTTGTCTAACACCTGCTGCCAATCCTTCTCTTTTTGCTGAGGAAGAGTGGCCCCCAGCT
CATGTCCGTGCCCATCTTTCCTCTACTTTATATGTGGGACGCCCACCACAGCATGGCTCA
CCAAGTGGTGCTATGTCCGCACCTGGGATCCCAGCCGGCAAACCCCAGGCCACTAAAGCG
GAACGTGCGCACTTAACTGCTGTGCCACCCGCCACCGGGCTGTCCCCTCACTGAACTGTT
TAACAACTATTCGGTGTTTTTTATATAACAAAGCTTTTTTGTGGTGACGTGGAGTCAGGC
TGTGCTTGCTTTCGCATCTTGCTTTTCTCTGGTCAGTACCGTGTCGGCTGTCGCAGGACG
GGTGGCTGTTTGACCGGTCCTGTGGGAGGCGGGAGCGCTGCCCGGGGATGGCTGTGCCCG
GCCGAGCCAGTACAGCCTTCTGTGCCCCCGGCCTGGCTGTCGCCTGAGCCTCCTTAGGGG
GAGAGGCCCTCGTTACCTGCTCTCCCCGGGGCAGGCCTGACCTCGCGCCCCCCGTTGCAG
AAATCCGACCCGGTGGTCTCGTACCGCGAGACGGTGAGCGAGGAGTCGAACGTGCTCTGC
TTGTCCAAGTCGCCGAACAAGCACAACCGGCTGTACATGAAGGCGCGACCCTTCCCCGAC
GGCTTGGCCGAGGACATCGACAAGGGCGAGGTGTCCTCCCGCCAGGAGCTCAAGCAGCGC
GCCCGCTACCTGGCCGAGAAGTACGAGTGGGACGTGGCCGAGGCCCGCAAGATCTGGTGC
TTCGGGCCCGACGGCACCGGCCCCAACATCCTCACCGACATCACCAAGGGCGTGCAGTAC
CTCAACGAGATCAAGGACAGCGTGGTGGCCGGCTTCCAGTGGGCCACCAAGGAGGTGAGC
GGGGATGGCCCTCCTGGCCCCGTTGCTCTGCTGAAGTGGGGCTGGGACTCCTGCCTCCTG
GGAAGGGGACCCGAGGGAGGGTGAGTTGGTCGAGACACCCAGGGCCCGGTGGGCCAAGAG
CAGGAGGTGGCACAGGTGACTGTTGCGGGAGGGATGGTGACACTGAGGCTGAGCCTGACG
CTGCCTTGTTCTCTGCAGGGGGCGCTGTGCGAGGAGAACATGCGCGGCGTGCGTTTCGAC
GTCCACGATGTGACACTGCACGCGGACGCCATCCACCGCGGGGGCGGCCAGATCATCCCC
ACGGCGCGGCGCTGCCTGTACGCCAGCGTGCTGACGGCGCAGCCCCGGCTCATGGGAGCC
CATCTACCTTGGTGGAGATCCAGGTGGGCAGGCCGCCCCGCCCGGCCCGCGGCCCCGGCC
CGCCCCGCAGCCGCTGCTCACCGCCTTTCTCTGCCCCGCAGTGTCCGGAGCAGGTGGTTG
GTGGCATCTACGGCGTCCTGAACAGGAAGCGGGGCCACGTCTTCGAGGAGTCCCAGGTGG
CCGGCACCCCCATGTTTGTCGTGAAGGCCTACCTGCCTGTGAACGAGTCCTTCGGTAGGT
GCCAGCCGGCTGCGGCCCTCAGGGCCCTGGGTGGTGTGCTGGCATCCGGGAGAGCCTCCT
GCTCCTGCCTGGTCTGGGGGACGGACCCGGCGCTTGGCCCCTGTGGGAGGTGCAGGGCAG
GCCTGATGGGGGCGGGAGCCGTGGGTATTGTGTGCCCGCTGCTGCCCTTCCCCGCCTGGA
AGCGGCGGGCACCATAGTTGAGGAGGAGGCGGCGGCCCCGGGTCCATGTAGACCCTGGAG
TCACTGACCGGAAGGCCCTTGGTGGGTGTGTCGCTCAGCGACCAGGGCCGCCACGCTGTG
GCTGCAGCTTCTGAGAATGGGCAGACGGAGGCCGGGCACGAGCTTGGTGGCTTCTGAGCG
AGCCTGGGAGGGGCACAGTCGGGGGACGTCCCGCCTCCGGAGCCCGACCAGGGAGCCACC
CGGTGACCCGAGCCTGCCCCTCCCGCAGGCTTCACCGCCGACCTGCGCTCCAACACGGGC
GGCCAGGCCTTCCCGCAGTGCGTGTTTGACCACTGGCAGATCCTGCCCGGGGACCCCTTC
GACAGCACCAGCCGCCCCAGCCAGGTGGTGGCCGAGACACGCAGGCGCAAGGGCCTGAAG
GAGGGCATCCCAGCCCTGGACAACTTCCTGGACAAGCTGTAGGCGGCCCTGCCCGCTGCC
GGGCGGCTCTCAGCCCCCGCGCCCGGCCCTCCCGTCCTCCACCGACCTCGAGACTGTCCC
GGCGGGCCGCTCCGTGCCACCGTCAGTGCCCACGCGACGTCGGCCCTTCGATAATTTATT
TCGGGATTTCAGACGCAGCAGAGAGGCCCTCCCAGCGGGGACTGGTTCGGCTGGTGGGGG
TGGGGGAGGCGGGTTGGGACACCCAACACTTTTTTTTTTCCCCATTTCAGAGGAAGACTC
ACATGTCCTTAAAAAAAGAAATTTAAAATAAACGCATTAAGAGGTTTATTGGGGAAATGG
CCCGTAGTGGATTTTCCCCCAGAAACGGGGGGAAGGAAGAAGCGGGTAGACTTTCCATTT
GGACAGAAGCTAGAAGGCGGGAGACCCTGAGCGGGGTCACCGTGAGCCCCTCCAGCTGTG
TTAGTGCCATTGGAGTAATAAATTTGATATGGTGGTGACCGTGCACGTCCACGTGACTTC
TTTCTCCATCCCCGTTCCCGCATGCGTGGCCACCAGGGACGCCGCGATACAGAGGGTTCA
CTGGGACCTTGAGGCGTCAGTCCAGACGTCAGACCCGCGCCCAGAGGCGAGATCCAGGAG
ACTTGCGATCCAGGCCGGGCCCCTCCAGTGGGACTTGTGACGGCAGTTCTGTCCCCTTTG
CCGTGTGGAGGGCTGGAGTTTGCATCTTTGCCTTGCGAGTGCGTGTCCGTAGTCTGTGGG
GCTGCCGTCGGTCCGTGCAGGTGTGGACGGCCCCACGTGGCTGAACCTGTCTCACCCCGA
GCGCCTCCCTCCCGTCACCGCGGTCCAGACCAGCGCAGCGGGCGCTCCTTTGGAAGGCGG
CCCCCGGGAAGTGTGGTGGGCGTGTGAGCAGCTGCAGACCTTACCTGAGGCTTGAGCTCA
TCACTCCGCGTGTTCCTGTCTGTCCTCAGGAAGACGGGGACAGGCCGTAGCGGTGGGGCT
CCTGGCGAGGTGGGTGGCCCATGCGCACCCAGACTGTCCGGGGTGCCCTTGCTCTGTTGT
ATCCACGGTATTTCACTGTAGTTGCTGAATCAAGGCTGTAGCTGGCGCTGCGTCCTGCCA
GCCAAAGCGAGGGGAAATGGAGTCAATTTTTCATAGTAAAGAAAGATCACAGAAGTTGAA
CTGCCTGCATATCCAGTCACGTAGAAAGTTCTAGAAGAGGGGTGTTTATGGGAGAGAAAA
CGCCCAATATAAAGTAACAGGAGGAATGTTATTATGTTAATATCAGAGTCTGACCCAGAT
CCAGGTGACAGTTGCCATCCTCGTGTCCCCTACATTCATCCTCGGAAAGCTCTGAAGACC
CACCTCTTCCCTTGGGCACAGCCGGCCGGTGGATGCTGAGGGTCCGCCGATGGCCGCTGG
CCCATCGCTGTTGGCCCATCGTTGGCACCATCTCTAGTCCAACTGACGACCTTGGGTCAT
CATGAACCCGCTTGCCATGTGAGCAGACTTAGAACCCAGCTGCCCCAGGTGGTGATGGTG
GGGGAGCCCGCACTGGAGCCCAGGCCCTAGTCCCTTGTCCCTAAGTGCATGCACGAGGAG
ATTCCCCACGGCACGCGGATACAGGATTGCTGAAGCCGGGGCTCGCTGCACACTCGCCTT
CAGGTCCTGCCGAGTACCTGGAAGACAGCAGGATGTTGTGGGCGGCGATGGAAAGCTGCC
TTTGCAATGATCTCAACTTACGGCCGAGTGTTGCTTGACATATGCCAAGTGTTTTTTGCA
GTTTTTATAAAACACGTAAGTTTTTTAAGTTTATATTTACAGGAAAGTTGCAAAGACGGT
GGAGAGATGTTAACATCCTGCATGGGTACTGTGCATCTGTCAAAACAGAGAAGTAGGTCG
GTAGCTTGCTCTTAGCTGCCTGAGAGTTCATGCTGGCGTTACCTGTTCCACTCATGGTCT
TTGCTCCGTTTCCGCATTCGAGGCAGGACAGATACATTGCACCCAGTTTTGCGCATTCTT
TTTTAATAAAGATTTTATTTTTTTTTAAATAAAGATTTCTCCTTTTTCTTCCCAAAGTCC
CCCGGTACATAGTTGTGTATTTTTAGTTGTGGGTCCTTCTAGATGTGGCATGTGGGACGC
CGCCTCAGCATGGCCTGATGAGTGGTGCCATGTCCACACCCAGGATTCGAACCGGCAAAA
CCCTGGGCCACCGAAGCGGAGTCTGCAAACTTAACCACTCGGCCACGGGGCCCGCCCCAG
CGCGTTCTTAATACTAAGTAATTTTGCTGGGGATGAGACTATAAATCGAGACAAGACTGA
ACTGTGTTTGGTTGAACTGCAAGAATTTCTCAGTGCCGCTTGCGGTCCTTGGCTTGTTAA
TTTGGCCCCCCCGGGTCAATGTGCATTTACAGCTGCCACGTCCAGCAATGCCATTTATGG
GGGCTGACATCTGATGACTTCACCGTGGCTTCTTGTGTAATTACACCCGAGCATTGGCAT
GTTACAAATGTGTGTGTGTTTTGCTCTCGACCTAGATTTGGTTCATTTCATTTATTGATT
TAATTGTATTATTTTTGTGACCGTTCTAGGCCAGCAGTTCTCATCTTTTTGGTGTCAGGA
CCCCTAGACACTCTTAAACATTACCGAGCTTTTGTTTAAACAAATAGCTTTTGTTTAAAT
GGGTTACATCGACTGGTATTTACCATATTTAGAAATTAAAATTGAGAAATTTTAAAAACT
GTTTTTAAATGATAAACCCATCTCATTTAACATAAGTAACATTTTTATGGAAGAAAAACT
TTTCCAAAACAAAACAGAAAACAGAAGAGTGGCATTGTTCTGCATTTTTGCAAATCTTTG
AAATCTCTGGGTTAATAGACAGTGGATTGTCATATCCATTTCTGTATTAAATCTGAAAGG
CTGTATCGTTTTGGTTCAACTGTCTGGAGAGAAGCCAGCCTGACTCATTCCTATACTCGG
AAAAGAGAAAGCATTTTCATACTTTTTTTCAGATAATTGTGGACATTCTTTGAAACAACA
CCAAAACTCAACAAGTGTTAGCTTACTGAAGATTAATTACAATGTGGTATCTGAAACCAT
ATCAATGAGCTTTTCATGACTGTTACATTAAAATCCATTTGTCTATCTTGCACTTTGAAT
GGGTTTCCCCCCCCACTCAATTTTGTAACATCGTGCATTTGTTATCTGGAAATATTAGCA
GTAAACCAAGTTTGCAGCCCTTGCACATGTTGCCACACTTCATTAAACAACACAGAAATC
ACATTTGTTAATAGCAATTTCATCAGGACAGTGTTGAAGTGTCAGGAAGCTGTCAGGTTT
CAAAAATTTTAATATTTTGCTTGAAAGCTCCAATGTGACTATCAGCGACAAGTATTGTCA
ATTGTTTCCCTCGAAGTGATTGACGGGCTCAATTTGTTCATTTCTGAGAAAATGTCTGCC
AAATACCCAAGTCTGAATTGCTACAGTTTGTCAGGTGTCTTTTCGAGTAAAAATGGTGTC
CCAACCCCTCACTCATGAAGTGTGGGCTGTGCATACATAACTTTCTTCCAAAGAAGACAG
TATGGAAAGGGGAGGGGAAAAAAAGTAACTTTCCAGTGGGAAAACCTGACAAACACTGCC
TGGAGCCAGGTGACCAAGGTCAATGTCAACAGTGATGTGACATGGATTGAATGGACTCTC
GTGAAAGGGTGAAAAGGCCGCTTTACCTCTGGGGTCCTCGTCCTTAAAACCCATCACCCC
AGTCTAACCATGAGAGAACCATCAGATGCATCCCGATTGAGGGACATTCTACAAAACAGC
CAGTCTTCAAAACTGTGGAGGTCATCAAAAACAGGAAAGGCAGAAAGGACTAAATGTCAT
GTGGGATCCTGAGTGGGATCCTGGGACAGAAACATGACAATAGGAAAAACCCGGAATCTG
AGTCAAGGACGGACTCGGTTAAGAATACCGTGTGACTGTCAGTTTGTTCGTTGTGACAAA
TGCACCATGCTAGTGTAAGAGGCAATCACAGGGGAACCGGGTGTGGAGAAGGTGCTGCTT
TCGCTGTGAACTGCATGCAGTGCGCGCAGGAGGTAGACCAGAGCAGAGGAAGGCGGTCTC
CGGGCAGAAGGAATAGCTCATGCCAAGATCTGGGGTAGAAATGAGATGTCTGAGGCCAGA
AGGATCACAAATGGGTGCGGACTGCAGTGAGCAAGGCGGAGACCATCATGATGGTAGGGC
CATCGGCAGAGGCCAAAAGACAAGGTCTAGTGTCCGATGGCCTGTGAGGTGGTTCAGCAT
TAGCTTAGGATCAGGTGTATCTGGGAACGATTCAGCTCTGCCATTTACCAGCTGTGTGAC
ATTGGGTGGGCTGCTTAACCTCTCTGGGTCTCAACTTCCCCATCTATAGAATGGGGGAAA
TATTAATATGTCTTAGCTTCTAAGGTTCTTGATTGATACATAATAAGGCTCAGTAAATGC
TAACTGTTATTATCATGTGTCTTTGAGACAACAGGAGTCACAGTCGGATGCTCAACAATG
AATGGCAACACCTGACTGACCTCATTTGCATTTTTATTTACATATTTGGAATATGGGTAA
CATTTTACAGAGGAGGAAACTGCCACTAAGGGACTAAGGCGGGACCGGGGGTCCCTGGCT
GGGCTTTGGATTCACGACCTTAGCGCCCGAGAGAGGCAGGAAGAGGGAGGAAGGACTTCA
GTATCGCACCGCCCAGCTGCAGGACCCCGGTCAGAGGAGTGCGGCTGCGCTGCCCAGGGC
CAGAGGCAGTCTTGCGCGCTAAAACGTTTGACCGGCNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNTGAGCGGGGATATTAGGGATTGGGGAAGTCCTTGGAGGGTCCCTGGAGGGGTCATC
GGGGTCTTCCTTGGAGCTTGTGCGAGGGTTGCGGGCGAAAGGCCATGGAGGGGACTCAGA
TGTGGCCCTTTGCGAGGGCCCTTTGTTTGCGGGAGAATGGGGGGGTGGGGGGCTCTGATA
CCTGGAGGGGTGCCTTCCGGGAGTGGGTGGCCCGGGGGACGCAGGAGTGGGGGGAGGGGG
CTTGCAGGAGCCTGGAAGCTGTTGTCTAGTCCTTGGGGATTCAGGATGGGGTGGAGCACA
GCGCTGAGGAGGGTCTTAAGAGGCCTGCCGAGGTCGGGGCGCCCGTGGGGCGACAGCATC
AGGACCAGGAGGGGCGGAGGCCCCGATGGGCAGGGAGATGGGACTGTGTGGCCCTGGGAC
TAGTTAGGACGTGGGGGCAGGGAGTCAGGGCGTGCCGGGGTTGAGGCATGAAGCGTGTGG
GGGATCTTGCAGGAATGTCTGGGGTCTCCGATGAGCGGGTTGGAGGAAGGCAGAGAAAGG
CCGGGGTGGTGTGTGGGAAGCTGGAGGTATGTGCCTGCTGGGAGTTATGGGGGCGAAGGT
GGCACGGTGGGGCTTTCACCGACCTTGTGGGTGGCGTGGTGTCTAAATGAGATGCCACTG
GAAGCTGGCCGGCTCGCCAAACCACACACGCCCTCCGAGGACCGTGGGACTTGAGCGTGG
AGTGATGTGAAAGCTATTTCTGGCGAGCAGGTGGCCCCGTTTACCTAGGAGTAATGGCAT
CTCAGTCCTTCTTTCTTGTTTCTCTGTCTCCTCCAGGCTCACGGCTAGGGGGGCTCCCCG
AGGTCCCGGCCCCAGGCTGCAGTGACTGGGCTTTTGCTGGAGCGGAAGGTGCTGGAAGGC
AGCCCGGCCACCATGTCCACGTTCAGGCAGGAAGATGTGGAAGACCACTATGAGATGGGG
GAGGAGCTGGGCAGGTGAGCAGCCCCCTCTGGCGGGGCTCGGCGGGGTGGGAGAGGCGCG
GCGGGGCTTTTCTGGACGCATCTCTCCTCCTGTTCTTTGTTCTGTTCTCCAAGAGAGAAT
GAGTCAGGCTTCTGTGCTGGGGGAACCAGTTTGGGCTTTGGGGCCAGACAGCCCCAGCCG
TGAATTCCTGCTCTGAGGTCCTCTGTGCGTTTCCTCTGGGGAGACACTAACTGCGGTGTG
AGCGCCGTGGAGGTTAGCAGTTTTTTGCTGGTGAAGCTCTGTCTGTCTCTTTAATCCTCT
CGTGTGGGAGGCATTTAAGTCTCCCCCACCCCTGCCAACTGTTGAGCATTCTTGTGGGAA
AAAGAGAAGGTTTCCCGTTCCAGCCAGGCAGCTGACTTCCTGCCTGGCCGGGCCTCGCAG
CCCCCTGGGAACTACCCCCCCCCCCCCCCCACCTCGGACCAGCCAGGCACCATCCTTTTT
TTTTTTTTTTTTTTTGGCAGAGTCTCAAACCTTATTTGGTGAGTTTGCTGCTGGCCGGCC
TTCCCCAGCCCAGCCGCCTTGGCCGGCCCCGTGATGTCACCAGAAAGGAATGTAAATAAC
TGAGCCCTGTATCAGGCCTCTGCTGAGAGAGTGTTTGCGGCTCATTTGGGGTCCTGAAGG
GCTTCCTTTAGAAATTTACTGTGTTAGGGGCCCGGCCTGGTGGCGCAGTGGTTAAGTGCA
CATGTTCCGCTTCTCAGCGGCCCGGGGTTCGCCGGTTCGGATCCCGGGTGCAGACACGGC
ACCGCTTGGCAAGCCATGCTGTGGCAGGTGTCCCACATATAAAGTAGAGGAGGATGGGCA
CAGATGTGAGCTCAGGGCCAGCCTTCCTCAGCAAAAAGAGGAGGATTGGCAGCAGATGTT
AGCTCGGGGCTAATCTTCCTCAAAAAGAAAAAAAAAAAGAAATTTTCTCTGTTAGAGTGG
TAGCAAATACAGCCTCCTTGCCTCTGAAGAAATCTCATGCTTTGTTGTTGAAAATGTGTT
AGGACCTCTTCCTGACGGTCGCTTGGCAACAGTCTGCAAAATGTCACATGTGTGTTCTCT
TTAGCCCACCGATTCCACTCCCAGGAGTGAATTCAGGGGAAATATGTACTACACGGACCC
AGTGACCTAGGATGGAATAGTTGCTATGGGGATGTTCTGTGAGCAAAAGATGGGAAGCCT
CTTCAGTGGCCGACACAGCAACACCACATCCGTGGGTGGAATAATATGCAGCCGGTAAAA
AGAGCCACATAGGAAAGTTATTGGAATTTTCTAGATAAACTGAGGATGAGAGAAGGGAAG
TGACTTGCTCGAAGGGCATGCAGACCGGAAGTGGCAAAGCAGGATCCAGACCTTGAGACA
AGGCCCTCCCTGTCTGGAGCCAGAGCTGGGCACCCGGCTCAGCCAGCTCCGTGCCCCCCA
GATCCTGGGCTTGGGCCCAATAGATGTGCAAACGAAGATGAGCTCCGCCAGTTGGGGAGG
GAGTGCGTACTCATGCCCAGAACACCATCCTCTTTCGGGTGTGCACTTTGCCGCTCTGAA
GTGGGCCCCCTTGGTAAACTCCGGATTTCAGAGGCAGGAATGAGCTGGAATTCGGTTTCC
AGCAGAACCGTGTCTTTCGCGGGTCTAATTCTCGACCGTCTTTGGAGAATTAGCTGCCGG
AGGTCACCATGATTACAAGGCCTGAGGGTCAGGCTGGGCCACCTTTTCTTGTCCCGGCGG
TCACGGGGCTCAGCGAACTGGGAGTGTGTGTGTGTGGGGGGGGCGGTCTTTCTTCCCAAT
TCAACTTCGCATCGACCGTCTTGGGAGAAAATAAACCTGTGGTTGATGCGTCTGCGGGCT
CCCACGTCCTGCGTGGGGTGTGCGTCTGTATCGGTCAGCTCCGGCTGCCTGAGCAAAGTG
CCACTTTCGGGGCGGCTTACACAGCGGACACTCATCCTATCCCGGGCCTGGGGGCTGGAG
GCTGCGATCACCGTGTCGACAGGGCTGGTTCCTCAGAGGCCTCTCTCCGTGGCTGTGGAC
GGCGGCTCCTCCCTGGGTCCTCACGTGGTCGTCCCTCTGTGCGTGTCTGTGTCCCCATCT
CTTCTTATAAGGACACCAGTCCTATTGGATCAGGACCCACCCCAGTGGCCTCATTTTAAC
TTAATCGCTGCTTTTTTTTTTTTTTAAGGAAGATTAGCCCTGAGCTAACATCTGCCAATC
CTCCTCTTTTTGCTGAGGAAGACTGGCCCTGAGCTCACATCCATGCCCATCTTCCTCTAC
TTTATACATGGGACGCCTGCCACAGCATGGCTTGCCAAGCGGTGCCGTGTCCGCGCCCGG
GATCTGAACCAGCGAACTTTGGCCCGCCAAAGCGGAATGTGCGCACTTAACCGCTGTGCC
TCTGGGCCGGCCCCCTTAATCACCTCTTTAAAGGCCCCATCTCCAGATAGTCACATTCTG
AGGTCCTGGGGGTTGGGGCTTCAACTTAGGGACTTTTGGGGGACCCGGTTCAGCCCGTAA
CAGCATCTTTTTACCTGTTCTCGTGAGTCCGCTCTGACTTCTCTTTGTGTGTTAGTTCAG
CTTAGAGTAAAGCTAGCAGAAAAGAATCCTTGTGTTGGAAATTCAGGCCACACGTCCAGC
GCTCATCCCGGCGGTCCCGGCACGTGGTGGCCGCTCGGCATTTGGTGCCCTTGTCGTCAG
GGAGTCATCGTGGGATGGGAGCTGGAAGAATTCGCTTGCTTGATATAGACGGGGGTGGAG
GGGAAGGCATGTCAGGTGGGGGGAGTGTTAGCCGAGATTCAGAGGGTCCGGAACATCACG
GGCCAGGGGCTGTTGGGTTCGGCGGGCAGGACCTGAGCAGGAACACTGGGCTGACCTGGG
CCCCTGGCTTTTATGTTAGTGGTGGCGTTTCCTGTTGGTGCCAGAACAGGTTACCATAGT
TTGGTGGCTGAGAAGAACACGCATTGATTATCACAAAGGTCTGGGAGTCAGGCTTCTAAA
ATGGGTCTGCTGGGTGGGCCCTCCCGGAGGCCCCAGGGGAGGAGCGCGTCCCGCCTCCTC
CAGCTTCCAGAGGCGCCGCGTCCTGGGCTTGGGGCCCCTTCCTCCATCTGCACGGCCAGC
AGCGCAGCGTCTCCATCTCTGCCTCTGACCCTCCCGCCTCCCTCTGCTCAGGACCCTGGG
GTGACCCTGGGCCCCGGGAATCCAGGGTCGTCCCCATCCCAGGGGCCTTAACTTAATTCG
TCTGCAAAGTCCCCTCTGCCGTGTGAGGTGCCACGTCCACGGGTCCCGGGCTGTGGACGT
GGTTGTGATTTTGGCTACCGTGGTCACAGATGGTTTCGCACCTCCCATGTGCCCGCCATG
AACTTCACGCACCTGCGTGTGCGGAGCGTACCTGTGAGCCCGCCATGGGCGCTGTCGCCC
CTCAGTGCTGGCGAGGGCAGCGGCCTAGGTGCCCGCCAGTTGCAGGTGTCCTGGGCACCA
CAGGAGGACCCGCAGACTGGGACACATCCAGTCGGGTCCCTTGGCTTTTCTGAGGGCCCC
GCTGGCCTGGCAGAGGTACCCCTCACTCATGTGTCTGTGTCTCCTGCCTGGCCTGTCCTC
CCTCTGCCGCCACCAACTTCAGGGATCCCTCCTGTCCCCAGGGCCCGTCTCTGCCGTTCC
TCCTCTACATGCTGTTGCCTATTTCCCCAAGATGTCGCGTGGTCTCTTTCCTCTTGCCCC
CTGGTGTGCCTTGTTGCAATTTCTGGCCTGGCCTGTGTGCTCTCGGTCTGGGAATCGGTC
TGTCCACTGACATGTTGTGTTACTGTGACCTCTTGATGCTGGGGTCAGCAACCATGGCCT
GTGCACTAACTCCCACCCTAGTCAGTGTCGTCTGGCCCACCCACGCGCCTGGAATGGGCT
CTGGCTTTTTTTTAAAGATTTTATTTTTCCTTTTTTTCTCCCCAAAGCCCCCTGGTACAT
AGTTGTGTATTTTTAGTTGTGGGTCCTTCTAGTTGTGGCATGTGGGACGCCACCTCAGCA
TGGCCTGACGAGCGGCGCCATGTCTGTGTCCAGGATCCGAACCAGCGAAACCCTGGGCCA
GCAAGGCAGAGTATGCGAACCTAACGACTCGGCCGTGGGGCCAGCCCGCTCAGACTTGTT
TTTAAGGGTTGTGAAAACATACAGGAATTGTGGCGGAGACCACGCGGCCCGTGGAGCTTG
AAGTATTTACAGTCTGGCCTTTTTCAGTCAACTGTCGAGTTAAAGCAAGTTACTATGACC
GAGTTCCTAGACAGCAAAGGAGTTTGGACATTGGACGGCTCCCTGGCATGCGGTCAACAG
ACTTTCTGTCTCTCTCTTAAATAACAGCTGTCAGGAGATGTAATTCACATACCATATGGG
TCACTCATTCCAAGTGTACGGTTTAGTGATCTTTGGTACATTCACAGAGTTGTGCAACCA
TCACCACTAAGTGATTCCAGAACATTCCATCACCCCCAAAATTCTGTCCCTGTCAGCAAT
CAACCGCACCCCAGCCCCTGGCCCCTACGTGCCTGCTCTCTGTCTGTGGATCTGCCTGTT
CAGGACATTTCCCATCAATGGGGTCACAGGCCATGTGTCCTTCTGTGTCTGCTTCTCTCC
CTGAGCGTCGTGTGTTCAGGTCCGTCCACGTGCGGCTGTGTCAGGGCCTCACTCCTCTTC
ACAGCTGCGTCGTATTCCGGGGCGTGAATGGACCCACTGTGTATCCATTCTTGCACTGAT
GGGCACGCACTTGGCTTGTTCCCCCTTTGGGCTGTTGGGAGTAATGCTGCTGTGAACGTC
TATATACAAGTCTCTGTGTGGACACGTGTTTTCATTTCTCTTGAGTGGACACCCAGGGGT
GGAATTGTGGGTCACACAGAAACTTCTGGTTTAACCTTCTGAGGACCCGGCACTCTGTCC
CGCACAGCGGCTGCCCCGTTTTGCATTCCCACCCGCCATCCCTGAGGGTGCTGGGTTCTC
CACGTCCTCGCTCTGCTCTCTTCTTTTGAAACTGGGTGCGCCTCCTTCAGCCTGCCTAGT
GAACAAGAAGCTTTTTTTTTTATAATTTTTTTTTGTGGTGAGAACAATTGTCCCTGAGCT
GACATCTGTGCCTGTGTTCCCCTGTTCTGTATGTGGGACGCCGCCACAGCGTGGCTTCAT
GAGCAGTGGGGATCCAAACCTGTGAACCCCAGGCTGCCGAACTGGAGCGTGCGAACTTAA
CCACTGCCCACTGCGCCAGCCCCAAGAAGCGCTTTTGAAGTCAGTGACTTTTCTTTCTTT
TTTGTTAGATTTTTCAAAACGATGAAATACGCTGTGAAAAGTTGAATCAGAATAGAATGA
TATCAAATAAAAAGTAAAAACCCCTCTTCACTGGCCCCGTTCCCTCAGTACCACTCCCCA
GAGTGTCTGTTGGTAACAGGTCAGCCTGTGTCCTCCAGACCTTTTTTCCCACGTGGACGC
ATGTAAATCCATCTGTGCCAATGGGTACAGCCTGTACGCCTTTGAAACAGAAAGAGCTCT
TTCTGTGTGTCGTTCTGCAGCTTTTGCCCCTGAGCAGGTCCTCGGGGACGCTGTCCTTGT
CAGCTCACGGAGAGTCACCCCGTTCTTCTTCATGACTGCATAAGATTCCGCCGGACCCAC
CGTGATGGGTTCCAGCGCCCTTCTGATCAGCGTCGAGCTGTTTCTGTCCCTCTCACTGTG
GCAGGAGTGTCAGGTGGCCATCGTGTTACACGCCGCTTTGCGCTCACATAGCAACACCTT
CCACGAAAATTCTCAGAGGCTGTGGGGACAGTGCCTGGCATCAGGAGTTGGGACAGTGTT
GCCCGAGGAGGCCGTGGCAGCCCGGTTCCTCTCGGCGCACGCTCACCTCTCCTCCTCTCC
TCTCCCCTCCCCTCCCCTCCCCTCCTCTCCCCTCCCCGGCCCTCCTCCCGCAGCGGCCAG
TTTGCGATCGTGCGCAAGTGCCGGCAGAAGGGCACGGGCAAGGAGTACGCGGCCAAGTTC
ATCAAGAAGCGCCGCCTGTCGTCCAGCCGGCGGGGGGTGAGCCGGGAGGAGATCGAGCGG
GAGGTGAACATCCTGCGGGAGATCCGGCACCCCAACATCATCACGCTCCACGACATCTTC
GAGAACAAGACCGACGTCGTGCTCATCCTGGAGCTGGTCTCGGGCGGCGAGCTCTTCGAC
TTCCTGGCCGAGAAGGAGTCGCTGACGGAGGACGAGGCCACCCAGTTCCTCAAGCAGATC
CTGGACGGCGTCCACTACCTGCACTCCAAGCGCATCGCCCACTTCGACCTCAAGGTGAGC
CCCGTGGGGCCCTCGGGACAGAGCGGCAGGGGCTGGCTGTCAGGGCCCAGAACGCACACC
CCAGACCCATTGCCGCCAGGGGCCAGGAGACGGACCGGCTCAGGCCTGGGCCAGTGAGGG
GGTGCCAGGGAAATCGGGGCGCTGTTCCCGGGACTCGGGGCTGGCAGAAGCCGCAGAGGC
CCCCTCACACCGCCATGCTCCCCCCCAGCCAGAAAACATCATGCTCCTGGACAAGAACGT
GCCCAACCCGCGGATCAAGCTCATCGACTTCGGCATCGCCCACAAGATCGAGGCGGGGAA
TGAGTTCAAGAACATCTTTGGCACCCCGGAGTTTGTGGGTGAGGCCCTGCGGGGATGTCG
CGGCTCGCGGCTTCGGGGGGGGGGTCCCTGAGGACTTGTGGCTGGCTCCTGGGTGCCTGG
CCCATTGCCCTGGGGTTTCCCCTCCCAGCCCCAGTGTCGGGTACATGGGAGCTCAAGGCC
TCAGCTTGGTGGCTGTCACCGTCCAGGCCTTCCTGCCTGAGAGCTGGCCCTGCCCGCCTG
TGCCTTCATTTCTTTGGGGACCAGATGGTCACCTGCCAGTGGGGCTGTGCTGCTCCCCGA
GGCCGCGTCCCCAGGGCCGCCTCACACCTCCAGCACCTGAGCCTGCGCCTTCTCTCTCCC
TGTGCCCGCAGCGCCCGAGATTGTCAACTACGAGCCCCTGGGCCTGGAGGCGGACATGTG
GTGAGTGGGGGCAGCGGGGGCCCAACACACACCCCGGGATGCAGCATCTCTGCTCCCCCG
CGTGTCCCCTGCCCGTCCCAGGAGCTCCCGGCCACAGCTGCAGGCGGGGACACAGCCCAT
CCTTGTGGTCCTGGTGTCATGGGGTGTGGGCGGGCCAGCCTGCTGCCTTAAAACGGGGGT
CGGCAGGTTACGGCCCACGGGCCAGAGCAGGCCCACGAGCCAGGAGTGGCTCTCTCCTTT
TTAAAGGGTTAGTTAAAAATGAAACAGGTGAGTGTGTGACAGACCGTTGGTGGCCCACAA
AGCCTGAAATATTCGCTCCTCTGTAGAAAAAGTTTGCCAACTCCGCCTTCGAGCACAGCA
GGCCCCGGGGAGGGTCCCACGCCTGCGTGGTCTGTGGCTGCAATGCGCTGACCTCCCCCA
CCCCAGCCGGTGGAGCCTTGACAGGCAGGCGCAGCCAGACATGCTGAAGTGTCCCCACCG
AGACCCCTGGAGCGGGAGAGGGGAAGGGACTTGGCCTGGGTCGCGCAGACCCCTGCTTCC
CGCCTGGCCCCCGAGCCTTGGGCGCTGGACCCCCCGCCGTCTAGAGGCCCTGGGAGTCGG
GGTGCTGCGCCCCATGGCCGAGCTGACCCTCGTCTCTCCCGTGTGTTCTCTGCAGGAGCA
TCGGCGTCATCACCTACATCCTGTAAGTGCCTGGTGGCTTGCCTGCCGCCCCGCCGGGCC
CGCAGACTCAGGAGGAGGGGCTCGGGTCGCCACGGGGCTGAGCGAGCTGTGGGTGGGGGC
TGGGTGAGCGAGTGAAGGACCCTGTGCAGGAGAGAAAGGTGTGGTTCCCGTCTCAGGCTT
CTGACTGACTGACTGTGGATCAGGGCCCCGTGACCCGTCCTCGGGGGATAGTTTGCTTGA
GCAGCTCGCAGAACCTGGGGAGACAGTTGACTTCCCAGGACCAGCTGATCAGAGGCTGAG
ATAAGGGATTCAGATGAACAGCCAGAGGAGGAGGCACAGATGGAAGGTGACAGCTGACAG
GGCCCACGCACCGGAGCTTCTGTCCCCGTGGAGCTGGGGCGCGCCACCCTCCAGGTGTGG
ACGTGTTCAACCCGGAACCCCGCTCTCCGTCACCTAGGCAGGGTTCATTAACCCTTGGCC
GTGGGTGATTAGCTCAGTGCCCAGCCGCTCCCCTCCCCAGAGGTCGGAGGTCAGAGGTCG
GGGTGACGATGAGAGTGCCATCCCTCTAATCCCGTGGCTGGTCCCCTGGCCGCCAGCCCC
ATCCTTAGGGCTTTCCAGAAGTCACCTCATTAGCATAAGCTCGGGTGCGGCTGAAGGGGG
CTTGTTAGGAATAACAGAAGATGCTCCTGCATCTTTGTCACCCTGGAGCTATTTCAGAAT
CCAGGACGCCGAATATTCTAGATGCTCCCACCGTCTTAGCTCTTATCGCTCAGGAAGTTG
AAGGGTTTGGGCAGCTGTGAGCCTGAGGACAGGGACGGGGACCAGTACATACTTGTTCCC
GTGAGTCCCAGGGGCATGCTGTGGCCACCTCAGTGCAGCATAGGGAGGCACCCGACGCTG
TCACCGTTGGTGGGCGCCCCGCCCGTGTGCCGTGATGGTATCGGCCAGGAGGCCCTCCGG
GAAGTTACTGGTTGGCCCCCTGGAGTCACTAAACGTTTTGGGGGAGATGCTTTGAGGTTC
CACGGAGACTGTGGCTGTCGCTTTAGCACGTGTCGGTGGCTGGCGGTGACTCTGCTGCCT
TCCCGTTGGTGGCCAGGGCGTGGCTGGGGGAGAGAATGCGGGTGCGAGGGGTGTCCGGGG
CCCCCGCCGCCATCCTTGGCATCTGGCCCCTGGTGGGCCTGGCAGAGTGCGCGGCTCCCC
GGCCGCGGCCTGGTCGTGGAGCGAGCGCGTGCAGGGGACCTGAGCCCTGCGTCCGTCTCC
CAGCCTGAGCGGCGCGTCCCCGTTCCTGGGCGAGACCAAGCAGGAGACGCTGACCAACAT
CTCGGCCGTGAACTATGACTTCGACGAGGAATACTTCAGCAACACCAGCGAGCTGGCCAA
GGACTTCATCCGCCGGCTGCTCGTCAAAGACCCCAAGTAGGCGCCCTGGGCCCCGGGGGG
CGGGGGCCGCCTGGCAGGGAGGCGGACTGGGGCCCCAGAACGGGCGGGGGGCCCAGAGCT
CGTCTTTCCGAGCCGGCCCCTCCCTGTACCTGGGAATCAGACGCGGCTCCCGCTTGGGCA
GGAGACTGCGATGGATGACGCCGGTTGGGCCACCCCATCCATGTCTTAAGAAGCTTTTCA
TGTGTTGCCAATGTTTAAAATAAGTTTCACGTAAAAGTCTAGGTGGCTGTTTTCTTCTAG
AAAAAACCTAAAACTCCTGCAGAGCCCTCATTCACGGGGAGGCGCTCCCATGGGCCGCAA
TCCTCCCTGTTGAGTGCCACCCATTCCTCTCACCTGCCCAGCCCCTCCTGTGGGTGCCTG
ACTTTGCGAGACGCCAACATTAGGTCTCGACCCTGTTTATAAAAACCCTCAGAAAACACG
GAGACCCCACAGGCCCCTCATGGGCTCCTCGTGGTGGGCCCGGCAGAGCGGATGCTCTCT
GCATGTAGATTCAGAGTCATTTCAGGGACTTGCCCCTGGGCTGGAGGGTGACTTAGAGGT
TTGGGGGTCCCCAGGGGCAGGGGTCTGTGGGTCGGCCCTGGGAGGGGCCTGAGGGCAGAG
CTGTGGTGGGCAGAGCCTGGAACACCTTCCCGGCTCTCTGCCCGGCTCTTCCTGCCAGCC
TTGGGGGAAGATGGCACACGTGTGGGTAACCAGGGCGGGGGCCTCTTCTAGGAGGAGAAT
GACCATCGCCCAGAGCCTGGAGCATTCCTGGATCAAGGTAAGGGGGGCTGCTCCCACTGG
AGGAGGGCGGGTGTGACAGGGGAGTGGGCCTGGACGGTGGGGGGCTGGAATCCAGGGCCC
CTCTGTGAAACTTCCCAGAAAGGGGTCATCTCTAGGTCAAGGTCAGGATGGACAGCCTTC
TGGAAAGGGCCAGAGGGCCAGTGTTTTTGGCTCTGCGGCCTCGGGTGTAACTGCTCAGCT
GGGCCATCGTAGCAGAAAGCTCCGTGAGCCATAGGTATTCGAATGGGCATGGCCGTGTGC
CAATAAAACTTTATTTACAAAAGCAAGCGGAGGGCCGGACATGGCCCTCAGCGGGCCTCT
GCTTCCTGGCCCTCGCGCCATGTGCCCCCTCCTCCGCCTGCAGGCGATCCGGCGCCGGAA
CGTGCGGCGAGAGGACAGCGGCAGGAAGCCGGAGCGGCGGCGCCTGAAGACGTCCCGCCT
CAAGGAGTACACCATCAAGTCGCACTCCAGCATGCCCCCCAACAACACCTACGTCAACTT
CGAGCGCTTCTCCAAGGTGCTGGAGGAGGTGGCGGCCGCCGAGGAGGGCCTGCGCGGGCT
CGAGCACAGCCGGCGCCTGTTCCACGAGGACATCGAGGCGCTGACGGCCATCTACGAGGA
GAAGGAGGCCTGGTACCGGGAGGAGAACGAGAGCATCGGCCAGGACCTGCGGCGGCTGCG
GCAGGAGCTGCACAAGACCGAGGCGCTGCAGCGGCAGGCCCAGGAGGAGGCCAAGGGCGC
GCTGCTGGGGGCCAGCGGGCTCAAGCGCCGCTTCAGCCGCCTGGAGAACCGCTACGAGGC
CCTGGCCAAGCAGGTGGCCTCCGAGATGCGCTTCGTGCAGGAGCTGGTGCGCGCCATGGA
GCAGGAGAAGCTGCAGGGCGGGGAGTGCAGCCTCCGCTAGGGCCGCGGCGCGGGCCCTGG
CGGGCGCGGTGATGAGTGCGCCGGGCTGGGCTGGGCTGCCCCCACGGGGCCCTGGGGTTC
ACGGCCGAGGGGAGGGGCTCGGCCCCCGGAAGACGGGGCGGCCCAGGCGGCCTTCTCCGC
ACGGCCCACCGCCCCCTGCTCGGCCCTCTCCTGCAGCATCGCGGACTCGGGGGGCTTCCG
GGGCAGCATTGCCTCGGGACTCGGTCATCTCTGCAAGGGGTTGGTCCCGCCAGGACGGAA
CCAGCCACGGTGGACACAGGTGCCTTCTGCCTGGCCGGGCGGCCGCCTTTGTGTCTAGGA
CCTGGGTCAGGGGAGAGTCCAAGTACACGGAGCCTCGGGGAGGGGGCTGCGAGTGCCCCG
GGCTCGCCTCAGGCTCAGAACTGCAGGGGCCCCTGCTGGACCCCCGGCCCCTCCTCTTCT
GGAAACGGGAAGCGGCTCCCTCGGCGTCAGCGGTGGAGGTGGCTGTGCGCCCGGCTCTCC
CAGCGCCCCCGTCACAGGTCTGGCAGTGGGCACGGGGCCAGAGCTGACTAGCTGACCCAG
CTCCCGAGGACGTGTGGGTCTGGAGGTGCATAGGGGAGTGTGTGGCCGGGCCCGGTGCTC
AGATGCAGTAAAGGTGACACCTGTGGAAACTGTCTCCTCCCTTCCTGAGGTGGGGGTGGG
GGGTCCCGCTGACGAGGGGGCGAGGAGTCATGAGCCATTTCTGCCTGGTGACCCTCCCAG
CGGGCGTGCTGTGGAGCAGCGCCCTTCTCTCCGGCTCCCTAACAGTGCCGGGTCCAGGCT
CTGGGGACACAGCCCCTGACGTGCCTCAGCCGCCAGCAGGGGTCCCACCCCTCCTTCGCT
CCCTTCCCCAGTGCTGCCTTTTGAATCATTAGGGTCCCAGGCCAGCACCCCTTGGGCTGG
GCTGCATGGAGTAGGCACAGCCAGGATGCCATGCAAAGGCCCGTGGGCCCAGCGCTCCCC
TCGGCAGAGAGCTGAGCTCCGTCCTGGCCTGTGCTGGTGTTTCCCTGGGTACATCTAGCC
GGAACCTCCAACAGGTGGATGCCTTGGGGACCTGGCGTTGGACTAGGGAGTGAAGGGGCC
GTGGTGGCAGCAGTGCCACTGGGCGCCGCTAGGTGCCGCCCTGGAGCAGGGCCTCGGGCC
CCAGAGAAGGTGCCCAGGTCCCGGCTTCAGTGAACCGGGAGTCGGGGGGCCCAGCTGGTG
GCCGCTCTGGGCTGACTTCTCTGCTGCAGGTCATGTTAACCGAGGGCCACCTGTGCAGCC
CCGAGCCCGAGCGACTCTCAGGACAGAGGCCAGCCAGGCCGAGGGCAGGGGGAGCCGGGC
GGGTGGGCTGGCGTTCCAGCTGTGGCCCCTAGCTGGGGCCACCAGGATGCTGCCGGGCCG
AGGCAGGGCCTTGGGACCTGGCTCTGGGGTCCAGCGGAGGGGTCTTCCCTCTGCAAGCTG
CGCTGTGTCCCATGTACACGCCTCTGCCAGCACATGCCTGCCCGAAGTCCCAGGACATGG
CCCCACGGCCGTCACCTGCAGCTGTACCTTACTCAGCCAGGCAGGGTCCAGCCTTGCTGG
TCACCCGGCGCTGTGGCCTCGCCAGGCTCTGTCTCCCTCTCCGTCCGCTGCCTGTCCCTG
TGCTCCTTGGCAGGAAGGGGACACCCGGGGTGTGGCTGCCGTGACGGGCTCAGCTGGCCT
CTGGTTCTTGTGGTTGCAGTGAGATGGAAGCTTCCAGCAGCCAGAACAGTCCCAGAGGGG
TTTCCCGTCCCTTTGAGCCTTGGGTCACACGTGGCCCCGCCCTACCTCGGGCCGCCTGGG
TGGGGCGGGGCGCGACCTTGCTGACCTTGCAGCCCCGCGGTCTGGAATGTGGCCCCCAGA
GGCCCTTCTGCCCTCCTTCCCAGGAGCCGCGTCCTGAGCCTTCGGCAGCCCCGTCATCCT
CCTGTTAGCTTGTTCACACCGAGGGGCGCCTTCCCCCTTGTTTGTTCTTTTACTTTAATT
TTGAAAAAAATCGAGATAAGACTCATCGTCAAATTCATCCCTTTTTTGCCTTCTTTTTCT
GGCCAACAACTTCCACTCTTAAAATTTCAACAAAGTTCAGCTCATCAGACGGTCAGACCT
ACTCAGGGTTCCCCGGTCGGTCTGTGACTGTCCTTTTGGGACCCGGTCCGGCCTGTAGGT
GGCGTCTGATGGTTGGGTCCCTTGGGGCTTACAGATGCAACTCTGGGCAGCGAATTCCCA
GCCTTCACGTTGGGAAACACAGCCAGCCGGGATGGGACAGGGGCGCCCCGAGGGGCATAA
GTCACGTGACTTCAATAGACTGTAGTCTGCGGTGCCCTCTGTCTCCCGTGGAAAAGGAGG
GCCTTCCGTGCAGGGCCCGAGGGTCTCCAGATTCGGGGGGCGGGGGGCGGCTGCAGGCTC
CCTGGAGTCCCCAGGGGGCCAGGAGACAGCCTTCGGCCGGCCAGAGTTCATCTGGTCCTG
CCACACTGAGCCGTGTGTCGGGCGCTGGGAGACAGCAGTGGGAGGGCGAGACGGCGTCTG
TCTCCTGGGGGAGAGACAGGGGCCCTCACCTTTCCAGCCTTTCTGGTTAAAACTGGGTAG
AAACCGAAACTTGCTTTGGACTAGCGCCTACCTTCTCAGTGTCCAGAGCGCCTCCACGTT
GCGGGGCCAAGCTCCCCACATTTGTGCAGAGGGTGCCGGGCAGGCGTCCTTGCTCTGGGG
ACGGTCTCTGCCCCACCCTCGCGAGCTGGGCTCTCCTGGGTGGCTCGGCTCAGTGCAGCC
TCAGTTTTCTCAGTCTGTCAGTTCGGGTCCCAGGGAACCCCGTTGGGGTCGTAAAGCACC
TTACGAGGGTGTCCAGCCCACGCAAGCACGTGGCAAATGGTACTGCCCCTTGGCAGAGCC
CACGGACTGATACGCTGTTGCTCACCCCGACTGCGGCAGGCAGACCCCAAGATGGCCCCC
GAGCTTCCCCACCTCCTGCTCTTCACTCCCGTGAGAGAGGGCTGGCCTGCTGGCGGGTTC
TAACCAATTGGACAGCATAAAGCTGATGAGGTCACGTCTGTGATTAGACTCCATAAGGTC
ATGACTTCTGTCTTGCTGGCACGCTCTCTCCTGGGCTGGCTTTGAAGCAAGCTGCCACAG
TGGAGAGGTCCATGTGGGGACCAGCCAGCGAGGAATGACACCCGCCAGCCACAGGAGTGG
CCTCAGAAGCGAGTCCTTCCCCAGTCAGGCCTTCAGATAAAACCCAGCCCTGCCTTGGGT
TGCAGTGGGCTCGCAGCCTCCGGAGGGACCCTGCACAGAGGCCCCAGGTAAGCCACGCAC
AGACTCCCGACCCACAGACGCTGCGAGAGAACGTGCGTATGTTTTCTCAAGCTACTCAGT
CTGTGGGGCGTTGTTACGTGGCAGTAGCTGGCTGATACAGACGGGGCCATTCGGCGAGGC
TGCACAGTGGGGGCTCCCTGCCATCTAGTTTTGCTTTTTGCAAAATGGGAATGTCGTCTT
CTCTGCTTCTGAAGGTGGGCTGGAGACAGGGACTGGGGGCCATGAATTCCACTCCTCCAG
CTGGCGGGAGTCAGGCCAGACCTGCCCGCGGGTTGGCTCAGGGTTTGGCTGCAGGGCCAT
GTGCACGAGGCTCGTAGGAAGGAAGGGGTTTAAAGCTTAGGTTTGTCTCCGAAGCAAGGC
TCGTGTGCAAGGTGGCGAGTGAGGGCGGCCCTGCCCCTAAATGGCAGAGTGACCTCGGGC
AGGTTACCCCCTCCCGGCCTCAATGGTCCCTTCCCCCATCAGAGAAGCTGTGAGGATTAA
GCGGGAGCCGTAGAGGCTGCTGCAGTCGTATGCTGCTACGTTCCCATCAGTGGTAAAGCT
CATCCAATCGGAGTCTCTGAGCTGGACAAGACCGGGAGGCTGGGGTGCTCAGGCGGGGCC
CATTCTGCACACGTACGTTAGCAGACACCCGGGGCAGGGAGGGGTGGGGGTTGGGGAGCA
GGCACGTGGTCACGATCGTGACTCTGGAGCCACGCCACCCAGCTCTGGAATCCCAGCTCT
GTGACATAGTGGTCCTGCGACTCAGGGCAAGCTGTCCCCTCTGTAGAGTGGGAACAACGG
AATCATCCTCATGGGTTGGTTTTGAAGATGAAATGGATTAAGATACGTAAAGTGCTTAAA
ACAGGGCCGGTCACAGCAGCCAAAACATGGAAGAAACACCAGTGTCCGTGGACGGATGAT
GGAGAAACACAGTGTGTCCATCCACACCCTGGAATATTACGCAGCCGTGAAAAGGAAGGA
GATCCTGACACCTGCTCCCACGTGGAGGGACCTGGAGGACGTGATGCTCAGTGACGTGAG
CCAGACACAGAAGGACACACACTGTGTGGTCCACTCACAGGAGGTCCCCAGAGGAGCCAC
ATCCACAGAGACAGAAAGTGAATGGGGGGCCAGGGGCTGGGGGAGGGGTGGGAGTCAGTG
TTTCCTGGGGACAGAGCTTCAGTTTGGGGAGATGGAAAGTTCTGGAGACGGATGGAGGGG
ACGGTGGCACAACCGTGTGAATGTGCTTCTTGCAGCTGAGCTGGGCCCTTAAAATTGATG
AAGATGGTGAATTTTACGCTATGTTTATTTCCCCACACACACGAAAGGCGGGTGTTAGGA
AACACGGCATCCTTTGTTATTCGTGACAAGCCCCTTTCAACCACATCTAACTTTATGCCA
GTGGAGTGACGGGGACTGGTGGCCAAGAGACCAACCACGTGACCAGAGGGACAGAGCTCT
CAGCCTCCCCCGAGGGGCTGGGGACTGAGTTAATCACCAACGGCCAGTGATTTAGTCGTG
CCTGTGTACTGGGTCCTCTCGGAGACCCTGGATGAAGGGGTCCAGAGAACTTCCGGGGGG
TGGACATGTGGAGGGGCAGGGGGCGGGGGCCCCGGTCGGGTGTGGACGCCCCTTCCTCAT
ACCTCACTCTGAGTATCTCTCCCACCTGGCTGTCCCTGAGTTATAGTCAACAAACGGGTG
ATAGGAAAGAGCTTTCCCAAGTTCTACAAGCTGTTCTAGCAAATTCTCGGACCCGAGGAG
GGGGTCTTGGTGACCCTGGTTTATAGCCGGCCGGTCAGAAGCACAAGAGGCCGGGACTTG
GGGCTGGCGTCTGAAGCAGGGGCCGTCCTGCGGGGCCGGGCCCTGGACCTGTGGGGTCTG
CCTGCTCACTGCGCGTAGACAGCGTCACAATTGCTGAATGGGACGGAAACCCCACACCTC
GGGGTCGGACGGGCCATGAGAGGAGAGAACGAGAAAGTTGTCCTTTACATTCCAAGTCAG
CAAGAGTGTGACCCTGGGTCCAGTTGGCAGAAGGATAAATTGGGGTCACGTACCAGGTGG
CCACTGTGGGTTGAAGTGTGTCCCCAGAAAGAGATGTTGAAGTCTGTGACCTTACTGGGA
AATGGGCACATTGCAGCTGTCATTAGTTAAGATGAGGTCAGATCGGACTAGGGTGGGCCC
CAATCCACTGGCAGGTGTCCTTATAAGAAGGCACATGAATGGAGCTGGCCCCGTGGCATA
GTGGTTAAGTTTGCGAAATCTGCTTTGGTGGCTGGGGTTCGTGGGTTCAGATCCTGGGCG
CGGACCTACACACGGCTCATCAATCAAGTCATGCTCCAGTGGCGTCCCACATACACAATA
GAGGAAGACGGGCACAGATGTTAGCTCAGGGCCAATCTTCCTCACCAAAAATAAAAAATA
AAAAATAAAAAAATTTAGAGAGAACGCACGTGAAGACACAGACATGGGGAGCAGATGAAC
ATGTGATGACAGAGGCCGAGCCTGGAGTGACGCGTCTATAAGCCGATGAACCCCAAGGAT
TGCTGGAGCCCCCAGGACCTGGGAGAGGCAGGAAGGACCCTCCCCTGGAGCCTGCAGAGG
GAGCGCGATACCTGGATTTCAACTGCTGAACTCCAAACCATGCAAGAATAGATTTCTGTT
ATTTTAAGCCGCTGAGTTTGTGGTCATTTGTCACGGCAGCCACAGGGCACAAATACGGGG
CTCCGAGGTGGGAGTGAAGCCATCGTGGCTGCTCGCGCCCGGGTGCTGAGCCTGATGTCT
CCCGACTGGCCCTTTTGGCCGTTTCTAGAGTCCTTGCACCTGGCTGTTTCCAGCCTCGGC
TCCCTCAGGCCAGGAAGTGTCCCTGCTGTGGTTTCCAGGTTGACAGTGTCCCCTCCCCAG
GCCCCGACAGAGCCCCTGTCTTGCTCCCCCGGTGGAACCTGGCCATCGGGTTCCCGCCTT
CGGGGTGAGACCCAGCCAGAAAGTTCCCCGCGTGGGCAGAAAGCCCCTTGGCCAGCAGAG
AGGAGGGCCAGGAGGCGCGGGGACCCGGGCTGAGGCAGAGGAGGGAGGGGGCGTCCGGTA
TCTGGGTGGCCCAGCAGAAAGCCCGGCGGACTTCAGCCTGAGCAGGGTCATGTAGACAGG
CCTGGGAGCGGTCGCCCGGGCTGGACGGGGACAGAGATGCTGCCCGTGGCTGGGCTGCTG
ACCTGGGGTCCGTGGGGTCAGCGACTGGGGTTTTGTCGCATCCTGATCACCCTATTAGAG
AGGGCGGGAGTCCCGCGTGGGGTAGTGGGGATGGCCAAACTCGAGAAAGACTCACAGCCC
AGGGGGGGACACCGCAGGCCCCACGGGACCCCTCAGGGGGTGCACTCGGGGCCAGAGAGA
ATGCCAGGGCCGCGGGAGGCAGATGTGTTAGGGACCGGCGGGCAAGGGGCCCTGATTCCC
GGTGGAGGATGTCACTGGCTTTCTAGAATGCTCCATGGGGCCGGCAGCGGATCAGCAGCC
CCTGCACCTGGTCCCCTCACTCAGGAGGGCATCGTCTAGTGGACATCGTCCTCAGGGGGC
GCCGTGGGGAGGCCACCGGAGGCCCTCCCGGCTTTACGCCTGGGCCCTAATTTTAGGCCT
GGACTAAGTCACACGCCACCTGCAAGATGAGTCAGCGGTCCTGGGTTCAGACGCGGCCAC
CTCTCCAGGCGCCAGCATGGCCCTCCCTCTGGACGCTGCTGGCTCCGTCTGCCCCCCAGG
GTGGCGGCGGGGGTGAGAGAAAGGACGTGTCGGGGGCCAGCACACCCCGGGCGCCCCCCT
TGTCCGATCTTGGGGCCCGGGTGTCCCCTTGCCACGCCGGGCCTTGTAGGTCAGAGGGCA
TGGGGCAGGTGCCGGAGAAGGGGGGCGGGCCAGCCCGCGGCCCCTGCGCTCCGGACCATA
TTGGGGCAAGAAGCGGCGCCGCTATTAATAACCAGGGGGCCGCCTATAAAGCCAGGCCCG
CCAGCCGCCCGCGGCTCCTTCAGCCCCGAGACCTTTAGCCCCCCTGTTGTGAAAAGAAAA
AAAAAGTAAGTACCAAGACCACCTCCCCAACCCCCCGCCCGGCCCCCCTCGCTGGGCGGC
CTGCAAAGTGACACAGAACAGTGGTGAAATGACACACCCACGCAAAGGACACGGCACACG
GCCTCGGGTACCTAACTGTCCCCGGCGGCTGGGGCGTCCCGGCGGGGACGAGGGCCGGAG
GAGGCGGAGGGGGGGGCCGGGTCTCCTCCTCGTGGCTTCTCCTTGTCCCCGAGGGGACGG
AGCCAGGCGGCCCCAGAGTGCGTGTGTGTCTTGCGGCGGTGGCTGGCTCCCCTCGGGAGC
CCCCGGAGCCCCTGGCGTCCCCCCATCCCCTGGGGTTTTGTATCTGGAATGTCCCTTAGG
GGAGGACTTACAGGCCCGTCTGGAAATGAGCCCCCGTTTGCGTCCATTGAACCCCAAGAC
GCCTCTGCTCTGGGAGCTGCCCCCGTCCCCCGCCACCTTGACGGATGCCAGAGAAGCTCA
AAGGGGACAGGGAGGCGATGAGGCCACCTCTTGGGCGCCACCCCCAGAATGCGCTGGGTG
GATATGGGGGGCTCCCTGGCGGCAGCATGGGGCGTGTGGCGGTCTGAAGCCATCGGCTGC
CCGTCTGTCCCCGTCAGCCCACTCCTCGCCCCGCTGGCCCCAAGGACGCCCGCTCAGGGG
CCTGGCGGCTGGAGGATGGGGCGCCCCCGGAGGTGGCGGCCCTGGCCTTGTTGGGACGCG
GTGGGGGTGGGGGCGCCGGCAGAGGACGTGCTGATGGAAGGGCCGGCTGAGTGCTGCTTG
ACGGGAGTGGCAAGTGCTTGGGGTGGGGGGGTCCCGAAATAGAGTGAGCGGAGGGGGGCA
GGGGGACGGGCGTGCAGCCTCGCCCCCCACCTCTGGGCCTCTGCCTCTCTCCTCCCACGG
CTGGTAGGACATTGAGGGCAGGGCCCAGGGATGGAGTTCTGGCGGGGCAAGCGGGGGCTC
CTGTGGGATAATTTGCACGAAGGTCGCCGGTCCGTCTGTCTGTCTGCAGGGGGCTGGGGT
GGGGTAGGGTCTCCCCAGCAGGGAGGGGCTCAGATGGGCTTCCCACTGCAGGGGAGCCAC
GGAGGAGCAGCCAGGTTTCAGCAAGGGGCCCAGTGGGGTCCCCCTGTCCCCTGGGCCGCC
AGCAGTCCTGCAGGGTCCTTCCATGGGGTGGGCCCCCTGGTGCCCCGGGCCCTGCGGGCA
GCAAGGAAGGGGGGCTGCGGGCAGGCCTGGCCCGGCCAAGTTCCTTGGGGTGGGGGATGA
CTTGGCTTGGGAGGGTGTCAGCCACGGGACGTGGGGCACGCTGGCGTGTGGCAGGGTCTG
GACCCGTCCTGGGCTCCCAGCCCCTTCCCAAGGTCTTGCCTGCACAGTGTGGGGACACGG
CAGGGCTGGCCCCGGTCTCTGCCCTTGGGCCAAGGTGCCCCCTCGGCGCTGCTGACATCA
GGGCCGGGTCATCTCTGGGGGGCCGTCCCGGGTGCTGAGGGGGGCTGAGCAGCATCCCTG
GCCCCCACCCACTTGATGCCAGGAGCCCCCCCAGTGTGACACCCGCAGATGTCCCCAGAG
GTCCCCCGGTGTCCCCCAGGGGGCAGGGTTGCCTCTAGCTGAGAGTTCGTGGCCTTGAAC
GTTTAAAGAAGGTGGAGGTCTCGGTGCTGGGGGTCCCGGGGTGGCGCGTGGGCGAGCTTT
CTAACTTTCGGTGGTCACGTGCTTCGTTCTGACGTGACTCAGGAAGCTGAGGTTTTCCCG
GTGACGCCAGCGCCACAGTTTCCTCTTCAAACGAATTTAGTCCAAATCAATAAAATAAGT
GAGAACCATAAAGAGAGCATGAGTCATTGTGGGGGGGGGTCTGCGGCCCCGGCCCCCCTG
TAGAGGGACCTCCGAGGGCTCCGGAGGGGTTTCCGGGAGGCCGGCCGCGATGGGGTCCCC
AGGAGCTGGGGGAGCGCAGAGGTGAAGGTTCGGCCGCCTGTCACACGCTGGGCTGTGCAG
TCTCCAGGGGGTCCCAGCCTGGGGTCCCGGGGAGGCCGCCCGGCACTCGGGGTGAGGGGT
GAGTCGGTTCATCTTGGGGTTCTGTCCGTGAGGCCAGGGGCTGCCGGGAAGGCGCAGGTT
AGCCTAGCCGACGGCATCGCCGCGCCCACAGCCGCCGGCCGGGTTCTCTGGGCCCCTGGG
TGCTTCTGGGAGGGACGAGGGAGCTCCTCTGGGATGTGGGTGGGAAGACGAGGCCAGACG
GGCCTGGGGTGAGTGGGCTGGCCGTGTTTCCTCGGCTGGGGAAGCCCACGGGGTCGGCAT
TTGACAGACTTCGAGCTCAAATCTCAGCTCTGCTGAGTGACCTTGGGCAAGTCCGTCTGC
CTCTCTGAGCCCTAGAGAAATGGGGCCTAGAACAATCAGATCTCTCGAGGCGGTTGACCC
TGAGTAGGGTGACCAGCTGTCCCAGCTTGCCCGGGGCTCCCAGGATGGGGACTTTCAGTG
CTAAAACCAGGACAGTTTGGGCAAACCGGGACGAGGCGGTCACGGCGTTGCTGCTGCCCT
CATCTTTTCTTTTTTTAAATTGTGGTGAAATATCAACAACATAAAATTCGCCTTTTTACC
CATTTTTGAGTGCACAGCTCAGCAGCATGAAGCAAGTTACACTGCTGTGCAACCAGCCCC
TCCATCCGTCTCCAGAACTTTCCATCTCCCCAAACGGAAGCTCTGTCCCCATGAAACACC
AACTCCCATCCCTCCCTCAGCCCCTGGCCCCCCATCCACTTTCTGTCTCTGTGGATGTGG
CTCCTCTGGGGACCTCCTGTGAGTGGACCACATGGTGTGTGTCCCTCTGTGTCTGGCTCA
CGTCCCTGAGCATCACGTCCTCCAGGTCCGTCCACGTGGGAGCAGATGTCAGGATCTCCT
TCCTTTTCACGGCTGCGTAATATTCCAGGGTGTGGATGGACCGCACTGTGTGTGTCCCTC
ATCCATCCTCAGATACTGGGGATGTTTGAAAGTTTTGGCTCTGGGTATTGCGCTGCTGTG
AACACGGTTGTGCAGCTGTCTCTTTGGGACCCTGATTTCAATTCTTTGGATATTCACCCA
GAAGTGGGACTGTGGGGGTCATACAGTGATTCGATGTCCAATTTTTTGAGGAGCTGCCAG
ATCGTTTCCTGCAGTGGCTGCCCGGTCATTCCCACCAGCCACGCGCGAGGGGCCAATTTC
TCCACATCCTCCAACATTTGTTTTCTTCCATTTTTTCACGTTGCTCACCCTGTTGCAACT
GTTCTCGAAAGGACTCAGGTGCCCGGGTGGCCGGGCAGGGCTCAGGCTGCCAGGAGCCAC
CTCTCCCAGGTTCCCGTCCCATCCTGGACTATTTTGGGCCCGGTGACCAGCAGATCACCT
TTGCCGCGCTCCGTGCCCGTGGCAAAGGGCGAGGCTTGGCAGCCCCCCAGGGCTTCCTCC
GGGTCCTGCCCCAGCCCTCGCTCGGGGTGGGACGCAGCGACCTCAGTCCCAGCTGTCCCC
TGAGACCCTCGGCTCCAGACCTGGTCTACACGGCGCCGCTCAGCAAGCATTTTCTGCAAA
GGGGCAGAAAGTACATAGTTTCCTCTCTGCAGACGAGCAGATCCCTCTGGAAGCTTCCAA
GCTCAGCCGTCGCGGGCCCGCCGCAGATGACACGTTCCAAAACGCGCGTGGCCGCATGCC
AATAAGGCTTTATTTCTGGACGCTGAAATTTGAATTCCACGTAATTTGCATGTGTCACGA
AATTTAATTCTTCTTGCTATTTTTTTTTTCCCCTGACCATTTAAAAATGTGAAACCGTGC
TTAGCTGGCAGCCTGTGCAAAATCTCGCCGTGGACGGGATTCGGCCCACAGGCCACAGTC
TGCAGATCGACAGACTGCACACCCAGTAAATGTTTGTTGAATGAAACAATGTTTAGGGCC
CTGTGAAGCCACGTGCCCGATTTGTTACCATGACAGTAATGTGCTGTTAATGAGTAGATG
GGCATGAATGCGTTTTTTTTATTCAAGTCACAAATGTTGAAAATGTCACTGAATAAAACA
AATTGACGTTGGGTATTTTGTTTTTCCTTATCCAATCCTGAAGGACTTTTTAAACAGCTT
TGTTGAGATAGAATTAACGTACCGTAACATTTACCCATGGAATGTGTTCACTTCAGAATT
TTTTTTGTCTATTTGTAGGATGTGCAATCGATTTTAGAAAATTTTGTCACCCCCATAAAG
AAGCCCCATTAGCAGTCACTCCCACCCCTCCCCCAGCCCCTGGCCCCCCATCCACTTTCT
GTCTCTGTGGATGTGGCTCCTCTGGGGACCTCCTGTGAGTGGACCACACAGTGTGTGTCC
CTCTGTGTCTGGCTCATGTCACTGAGCATCACGTCCTCCAGGTCCCTCCACGTGGGAGCA
GGTGTCAGGATCTCCTTCCTTTTCACGGCTGTGTAATATTCCAGGGTGTGGATGGACACA
CTGTGTGGATCCATCATGTGTCGGCGGACACTTGGGGTTGTTTCCACCTTTTGGTGACTG
AGAATCATGCTGCTGTGAACATGTGTGGACATGTTGTTGTCGGATCACCTGTTTTCAATG
CTTTGGGTGTATTTCTAGGAGTGGAATTTCTGGGTTATATAATAATTGGTTCTTTTCTCT
TTTTCCCCCATAATTTCCCTATACTCCCCAGCTTTGTCCAAACCTGTCTGGACTGCGAGT
TTTTCCTGCTGGCCGCAGGGTGTCACCCTCAGGTCAGGGGGCACCCCGTCCTCTCCCTTT
CTTCCCCCTTGCCCTGCTCCCGGGGCTCCAGTCTCCACCAGACCTTCCAGCCTCCCTTGA
GCAAAAAGAATGAAGTCTGAGGTGACCCGGGGTCAAATCTCAGCTCTGCAGAGCCGCTGG
CCATCTCTGTGCCTCAGTTTCCCCATCTGTGAAATGGGTGTGCATGAGCAGCTCTCTCAC
TGAGGTTTCTGGGAGGGCTCAGGGGCACGTGCTTCTGGGCAGGAAATGTCCTCTGTGGGC
ATCTTGGGTCGCAAAAGCTTTCCCAGAGTCCCAGGAAATAGGTGCCGGCTCCAGTCACGG
GGGAGACGCCGGGGGCTTCCGGCGTGGCCGACTTCCCAGCCCCTGGTGTGACCGTCCGTT
GAAATCTCGCAGGAAATGTCCCCTTTGGGGAAACTGAGGCCCCCAGGACCCCCAGGAGGC
CCCTGGGTCACATGGGCCTGAGTCCAACGCGTGGACACTGAAACTGCCCAGACCTCGCAG
TGCCGCCCCCAGAGGCCACCGACGACCCAATGGAACACCACAGGCTGGACCCCGATGGTT
AAAAAACAGGACTGGCTTTAATCCTGAAGTGGTCGTGAGGTTGCAAAGGCATCTCGGGGG
GACCCCCGGGGCCTGAGACGCTGAGCCGGGAGTAGATTTCCCCAGAGGGAGACGGTCACG
CAGCACCCGTCTGGGCCTCCCTGTGGCCGGCGTGGCGCATGGGCCCCTGGGACCCCGGCC
GGCCCCTGCCCTCGGCCTGCCTAGACACTGTTCAGGAGCAAGTTCCGGATGTCTTCCAGG
ACTTGATGGAAGAGCTGCTCGCGGGACTTGGTGCCGTCCAGGTACACTGCAACCGGAGAC
GCCACCGTCAGGGCCGGGTCAGGGGGCTGCCGCCAAGAGGGAGGTGGCCAGCCCACAGGC
GACGGCCGACGGCTGGGTCAGGAGGAGGCCGACCTGCAGAGTCCGGCTGCTGGAACAGAC
CGGCCTCCGGGGCCCAAAGCAAGAGGGACTGGTGGCGAGACTCGAGGAGGGACTTCCAGG
ATTCTGATGGTCCCAATGGGGAGGGGCTGGGTTCCGGGTTCCCCCAGGGCCAGGCCTCAT
CTCCCACGGGCGCTTACCGACTTCCACGCCGCTGGCTTCCATCTCCCGCTTGTATTTCTG
GTACATTGGCCACACGTGGCCATCAAAGAGGCCGGGGGGGTCGGGGACCTCATAGCTTCG
AGTACTGGGGAGACAGGTGGGGGAGCATGAGCGACACCCGCGTCCCCCAAAGGTGGTGCC
GTGAGCGCAGCCTGGAGGACGTGAACTAGGTCAGGGGCAGCACCCCCAAGAAAGGGGACC
CCACAGAGGCAGAGGCCCCACACTGGGGCCTGGGTGCCCCCGCTTCCAGCATTGCCACCC
CGTGGGCCCAGGGGGTGCCCAGGGCGGGGCGCGGGGGCGCCGGGCTGTGGGCTCCCGGCA
CAGAGCCTCGGCCGGATGGTCTCTGCTGTCTGCTGGCCTTCGGGGGCCTGGGGTCTGGTG
GGCGCCATCCGGCCCCCCGGACCCCCGGGAGTCCCGCCCGGGCCAGCAGCTCACCTCCTC
CGCCGCTTGCATTCCTCGTACGGGACGGTCAGGAAGTACCGCCGGCTGTACAAATCCACC
AGGGGCCTGGCCGGGGCAAGGGACACGGTCAGCGCCCCGGGCCTGGCATCCGTGGGCTCC
AGGGACCTTCCTGGGTGGCGAGGGCTGGGGGCTTCTGGGCCGGTGAGTTTGGGGGTCAGG
GAGGGGACCAGCATTGGCGCCAGGAACGTCCCCACAGCAGACCCCAAGGATGGGCGCCCC
ACTCTCCCTGCACTTAGATGGGCCCAGAGAGGTGCGATGGCTTGCCCGGGGTCACACAGC
GAGGCTGGGGGTCCAGCCCAGCCTCCTGCTCTGCTTGAAGAGGCTGAGATTCTAGAATGA
GGACTCCATTTCCCCAAGAAGCATGGCTCTTGGCCCCCGATCCTTGAGCTGAAGCCAGCT
CTGCCCCACCCCCCAGCCTTGATTCTGGTCTCCTGTCTGTTGACCCAGGGACTCAGCCGG
ACCGACCCCCTGTGGGGGGAGCCGGCGTTGTCCAGGGCTCGAACCCGCGGCCGCTCACTT
GTAGCTGTACAGCAGGAAGCCTTCCAGAAGGAGGATGTGAGTGTTGGCAGCGTCCGGCTG
CACGCTGACCCCGTGGGCGCGGGCGAACTTGTGGGGGCTGCTCGCCCAGGCGCGCACGGT
GCTCAGCATGGCCTCCATGTCCAGGGACTCCAGCACTGGGGGCGGGAGAGCGGCGTCAGG
CGGGGCCGGGGCACCGCGCGGGGCAGGGCGCAGGGTCGCCGTCCGGCCTTACCGTCCCAC
TGCTTGAAGCCGTCCTCCCCAACTGCGATTTGGTCCTGAGGCTGGAACAGAGGGGCCCAG
GCCGCGGGCTCAGTACCCAGCTTCCCGCCCGCCCCGCCCCGGGGTGACAGTCTCGGTGGG
CCCTGCCCACCCCGTCCCCCCGCAGCCGATGCCTACGGGCCACAGGCTGGCACTCGGACC
CCCTACCCTGACTCATGGGACTTTGCATCCATCACCCTATTACCCCTCACCCCTTGCAGA
GCACCAAGGGCCGGCTCAGAGCCCAATCAGAAAATGGGAAAGGGACATGCAGAGGGACCA
AGGCCGGGTGGCACGCCCCCTCGGGAGCCACGGTCCCCCCATCCACCCGGCGGGGATGTG
CCAGGTATCCAAGAGATGCTCAGTCAAGGAGGTCGCCCATCCCTCGCTCTCCCGGCAAGC
ATCAGCGCCGGGCCACCCGGGAGGGCTCAGGCAGGCGGGCCCCGAGTCCCCTTCTCCGGG
GGCCACCTCCCCTGCCAGCCCTGGGCGAGGATGGCCACCTTGAAAAAATCATCCTGGTGG
ATCACACAGCAGTTGGGCAGCGATCTGAGCAGGCTGCTGGTCAGCGTGGTCTTGCCGCTG
TTGGTCACGCTGCAGACAGAACATCGCATGAGGCCACCCGGGTCCCCCGCTCCGGCCCCA
TCCGGGTCCGAGGACCCCCCCCCCCCAGAATCAGACTCCAACACAAAAGCCAGAACCGCA
AAACAGTGGCGCTAAGGGGACATTTTTACTCATCGAGGGTCACAGCAGGCTTTCTGAGCA
GAGAAAAGAGGCCCAGACTCTGAAAATTCGCCAAAAAACGCTAACCCACGTTTAACCTCA
GTTCAGCCTTCCTGCCAACCCAGGAGGTAGGGCCATGAGCTGGTTTCTACAGATGGGGAA
ACTGAGGCCCCAGCGTGAGTTGGCCTCTGTGGGGCTGGAAAAAAATCACAATGTTAGGTC
ACCAGCAGACGGGGAGAGAAAAAAATGTTTGCAATAGGAAGACCGGGACTTCCCAGCCGA
ACCTGGAAGTGGTAGCCACTTTGTGAAACGAGGTACGGCATCGTTGGTAGCCGGGAAGAG
ACAAAAAAAAAAAAAAAGGAACAGACAAAAATAATAATAATTGGCAAACCAGGGTGACCC
CCTCGTGGCGGACTTCCAGAGATGTCTCTGGTTTTAGGGCCCAAATTCCCGAGTCCCCAA
GGCCCTTCAGTGCCAGGAAAAGCAGGACAGTCGGTCACCCCATGACAAAGAGGACAAGGA
CGTTTGACCCCTGGAGCTAACGAAGGACAGAGAAGGGTGGCCGTCAGGGCTTTCGGGAAA
CCAGTGTCCCCGTGACCCCATTGTCCCTGTTCTCGGTGTCAGGGACTTTAGTAAAGCTGG
GTATGGAAGGTCAGGGGTGGGGGACGCTGCAGCCCTTAAAAAGGGCCGATGGGGGAAGGG
GACCCCATATATTAAGGGGGACAGGTGGGAACATGACTGGCGTTCACTGGGGTGTCGTAA
AAGGCACAGCTCACACTCGGAGCCCGTGAAGAGGTGGCAGGACCCTTGATCAAATATAGT
GGGAATCCCAACAGGGTGACAGCAGAGCGTCGAACCCTGTGCAGGAAGGGCCTCCGGGTG
ACGCCTGGGTGGGCCATCCCCTGCCCCCAAGGCCTGCCCTGCAGCAGGCGTCCCCCGGGT
CCGCCCCCGCGCCTTAGGGGGCTGCCTGTGCCCTACAAAGTCGTCAGTCTCCACCCAGTT
TTGGGTTCACAAGGAGTCTAATCGGGGGCAAAAAGCGATTTCCATTTGCAAATTTAAAAT
CGGGCCCCCGTGCACAGCCAGCTCTCCCCGCCTCGGGGCAGGGACCCATCTCGGCCCTCC
GACCTTGGGCGCCGGGCCCCGCGACCTCAGGCGCCGGGCAGCCCTCGTTCGGCCCGGCCT
CCCCCACGTCCTCGCCCACACAGGGGCGCTCACCCTCCGATGCCCACGATGTGCTTCATG
TCGGGGGGACTCGCGCTCCGACTCCCTCCGGGGCACCTCGCTGGGCCGACCCGGCGTCAT
TGAGGAACACGCGCCTTTATAAGCCGGGCAGCCCGGAGGCCGGCCCGGGGGAGGCGGCCT
GAGGCGGGCGGGTGGGCGGGGGCTCCGCACCTGTTCTCACCCATGCAAATAGCTTCGAGT
CACCTTTTGCCTAAATTAGCCGGACAGGGGGGTGCGGGGAGGTGTCACCCCGGCTGCCTC
GGCCCTCCTCCTGCTCTCTCTCCCTGCCCCTCCACCCTCCCCTCCGAGCCAGGCTGCCCA
CGGGGCAGACAGCCGGCCACACGCCTTCCCTCCCTAAAAATATCCCGCCGTGTGTCCCCT
GGCCTGACCCCAACATTAAGATGGATCCTGGAGGCTTCGAGAAGGGAGCTCACCCTCCCC
CCACCCCCAGCCCCACCCCCAGCCCCAGAGGCCCCGCTGGGCCGGAACCTCCCTCCCCAA
GGGGGATGCGGCCAAGATGGGCTTAAGGTCCGCAGGGTGAATCCCAAGATAGCTTTGCTG
CGGCGCCCGGGCCCCGCCAGAAATCTCAGGGTGACACTGGGGGCTGTTCAGAGCGCCCAC
GGGAGGCCTGGAGCCAGTGGGTCTGGCCTCAGCGTCACAGCGGCCTGGGGGGGCTGGGGG
AGGGTGACCCCCCTGGTCTGTGCCCTCTGCCCCAGGGGGCACTGGCCCAAGTTCCAACAG
CAGCTCAGAGACGGCCGGGCTGGGCCCCACAGCCTCAGTGGGCGAGAGGCCCCTCGACCC
CAGATGCAAGCTTTTGGTCCCAGGGTCCCTTGTCACTCTTAAAAAGGACTGAGGACCCCA
AATGGCTTTCCTTTATGTGGATTATAGTCCCTGATAATACTGACCACATTATAGATTAAT
CAGAGGAAAATTTAGAACACTTATTAACCTTTAAAAATACTGAGGCAGCCACTGTGATCA
GACATACACTACAATTATATTATAAATGTAATATTTTATGAAAAGTAATGCTTTTTACAA
AATAAAAAATTTAGGGAGTGAGCTTGATAAAAATGAAACTTTTATGCATCAAGGGACATT
ATTAAGAAAGTGAAAAGATGAACCAGAGAATGGGAGAAAGTCTTTGTAAGTCATATATCT
GGTAAGGGTTTGAGATCCAGAATATATAAAGAGCTCTTACAAGTCAATAATAAAAAGACA
AAAGATTCTATTTAAAAATGGATTTGAGAATTGCTGGTTAAAAATCTCGTGAACACGATG
CCGTCTGTGTGGAAGCTGCAATAGAATGATGCACACCTGAAATTTATAGTGTTATGAGCC
AACATGACCTCAATAAAATAATTTTTAAAACAATCCTGGGTTTGAATCTTAGTTCTGCCG
GGACCCAGTGACTGGGGGACCTCACCTTTATGCTCCCACCCCCAGGTGGTTTTATGGAGG
CAGGTGGGGAAAGAGAGGGAGAGAGGGAGGATGCCCCACCCCACCCATCACTTACCTGCC
CCTCAGCGGCCGAGCTGCTGCCACAGGGCCTTTGCACATGACCATCTCTCTTCCCAGAAC
CCCATTCTCTTACCAGGCTTCCTCCCTCAGGTTAACTTTGATGAAACCATCATGTCTCAT
CTTTGATTACCCCTCCTCTCGACTCTGATATCCAAACACCGTCACCCTCCCTCCTCCCCA
GGCCCCAGATTCCATCCGCTCCCATCCTTGGAAACTGTGAGCCCGTCCCCTTTGGTGGCA
AGAGGGTCTTTGTGGCTGGGATTCCCTTAAGGATCTTGGGTGGGGAGATGACCCTGGATT
ATCCGGCTGGGCCCCAAATGCGAACACAGGACCCTATAAGCAAAAGGCAGAAGGAGAGTG
ACGCACACGGAAGAGGAGGAGGCCTCGGGACCACGTGGCAGAGACGGGAGGGATGCGGCC
ACGAGCCGGGGGATGCTGGCGGCCCCAGAACCTGGAGAAGGGGAACCGGATTGTCCCCAG
AGCTCCAGCAGGAGGGGGACCTACTGACCTTCGTCTCAGCCCAGGGACGCTGNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNGGAGCTGACCCACATGATGCCCTGTGTTTTGCAAGGGGCCCGTGGGA
GGGGGTGGTGGAGGTGCCAGAAGGGGGTGTATTCCAATTCCAGGGCTCTCCATATGGCCC
CAGTATCTGTTACCAAGAATTTACAGGGATGCCTTCTGTGGGTCCTATGGGGCTGGGCCA
AGGGGGACAAGTGTCGCACCCAGATAGAAGTCCCTGCCAGGGCATCACCAGAGAGGCTCC
TGGGGCTGGATCACGGGGCACAGAGGCTCCTGGTGCAGACCCGCCTGACCCCAAACAGCC
ACGGGTCCAACGTCATTAAAAAATGACCATCCCGTCGCAGAGCGTGTGATCCCAGTGACG
TGAAACGTCCAGAACGGGCAGATCCACAGACAGAGAGCGGGTTCGTGGGGGCCAGGGGCT
GGGGGAGGGGGCTGGAGAGTCACTGCTAGTGGGGTCGAGGTTTCTTTTGGGGTAATGGAA
TGTTCTGGAACTAGATAGAGCTGATGGTTGCGTAACATTGTGAATGTACAAAATGCCATT
AATGGTAAATTTAAAAAAAAATAGAGAGCGACCAGGCCCTCATCGAGCTCTGGGGTCCCC
TGGAACGCCCGCCCGGCCCGATCCGGCCCCCAGCCCCCTCCCTCTCGCCCTTTGTTTTCC
CGCCCCGGGCTCACCAGCTCTGTCTGGCCTCCAGGCTTTTGTCCTCGAGGGGCCTTCTGC
CCAGGACGCCTCTGCCCCCGCCCGCTGGCCTGGCTAACTGCTGCCTCCCCCCTGGTCTCC
GATCAGAGACACTTCCTGGGCCCGGCTGCTGGTCCCCGGTGAGGACCCAGCTCCCTGGGC
CAAGCCTCCCCGCTGGGCTGGGAGCCACGTGAGGGGGGCTTGGTCCCCACCCGACTCCCA
AACTGGGGGTGACACCCCATGATCCCAGCACAGCTCCCCCCTCCTCAGCCACCCCCCCCG
GCCCCGTGCAGTCTCGCCCCCTCCTCTCGAGACACCTCCTCCAGGAAGGACACCTCACCT
GACATCACAGGGCCAGGATGGCAGAGCCACCAAGCTGATGGTGACCTGGCGTGAACGTCA
CGCCCACGCTGGCATCCGTGCCACAAGTAGGTCCCAAAGTCCCGGGCGTGGACCGTGGGA
GAGGGCCCCTCCTGTGCTGGCCGAGGGCCGCCGGTCCCCAGCCGTGCCATGGGGCGGCCA
GTAGGGACGGGGAACTGGGCCAGGCCGCGGACCCATCCCTCACTGTCCATGGGACCCTGG
GCAAGCCACGTCACCTCTCTGTGCCTCAGTCTCCCCCTTGGTAACACGGGGGCTGTGCCA
GGTCAGACAGACTATTATTCAGTAGTGTCGTCATAATTGTGATTTGTAATAAGACCTGTA
TTTGGTTTCAGTCCCAGCTCTCAGCAGCCAGCTCCTAAAACCCTTGACCCGCCTGCGTGA
GCGGAAGGTGCATCTTTCCTCATGACATCTGGTCCTGGAACGGCCCCAGAGCATCGAGGG
GAAAGAAGCATCTTTCGCTATTGTGAGATGCCCGTCAGCCACACCCGGGTTTATGCTAAT
GAGGCGGTTTTGGGAAGACCCTAGAAGCACAGGACGGGGCTGGAGGCCAGGGGACCCAAC
CATGGGGTCAAGGGGCCCGAGCTCTCAGCCTCACCCTGACCTCCGGGGAGGGGAGAGGGG
CCGGGGGTTGAGTCCGTCACCAACGGCCAACGATTTAACCAGTGGTGACTACGCCCCAGG
GGACCTTAAATGAAGGGGTCCGGGGAGCTCCCGGGGGGGTGAAGACGGGAGGTGCCGGGA
CAGTGGCCCCCGGGGAGGGCGTGGATGCCCTGAGTCCCTTCCCCATGCCTGGCTCCGTGC
GTCTCTTCCATCTGGCTGATCCTGGCCTGTGTTCCTTATGAATACACAGGTGATCTCGCA
AGTGCTGGTCCCCTCAGTTCCGTGAGCCACCGTGGAACCTGAAGTGGGGGGGGACCCCTG
ATTTGTAGGCACGTCAGACACAAGTGCGGGTGACCTGGGACTCCCTACGTGCACGTGGCA
TCTGAGCCCTGAACCTGTGGGGTCCCCCTTAACTTATTATTATTAATCGCCAAATAGGTT
TGACCCCAGAGAGGATCAGGGCAGGAAATGAATGTCAATCACAGAGCGGCAGGGCCAGAG
GGTCATGGGAATAATGGAGCCGGCCACCCGTTCTGCGGACGGGAGACGGAAGCAGGAGAA
GACAGCCTGAGGTCATCCAAGGTCGTTCAAGGTCACCCAAGGTCGCACGGCATGGGGCAG
CCCCCCCCCGCCCCCCGTAAAAGATTTCCCTGGAAACAGACAAGAGCACAGACCTCCATT
CTCAGTGACATTTATTTCACATAAAAATCCCCCAAAGCTTGTGGAAATGGCATCTGAACC
TCACGACGGTCCGCATAACCAACTGTTTTCGTTTTTTAAAAACCGCAAAACTCGCTGTCA
GGGGTGGGGGAGGGGGCGTGTGAACTACGAGTTTGGTGGGGGGGATTATGACGACACGTC
CACGGGGCCCCACGAGGAAAGCCCAACGCACGCCTGAGTCGCTCGAGGGACGGGTGTCTG
CTGCATCTTGGCTGGAACCTCCCTGCAATATGATATTACCGCAAAGACGACCCCGCGGGG
GGAGGGACGCGGGGGGCAGTCTGCCTGGACATGGTGGCCCCATTTGGTCTCACGCCTGAG
GACAGGCGGCAGGCCTGGTGACCCAGCTCCCTCGGGGTCTCTCTCTATCCTGGAGGGGCT
GCTGTGGCCAAGCGGGGTCCTCGGTTCCACTTGCCCGTCGTCTGTGGCTGCTGGTGGTCC
GGAGGGGCGCTGGGTGGGCCCGGTGGTCCCTGTTGGAATGATGAGTCTGCAGGCCCCTCG
AGGGGGCCCCGAAATCTCCCCGTTTGTGTCATCTGTCACCTCTGCAGGCACTCAGTTGTG
GCGGGATTGGGGAGAACGCATGAGTTCCATCCCGGCTCCTTCTGTGAGCTTGGAGTGAGC
CCCCAGACTTCCAGGAGTCACCGCCTTCCTGCGGGTGGCCGTCTGGGGCCCTCCGGACCG
TGCGTGGGTCTCCGAGGGGCTGCACTGACCACCTGAACCCAGAGTTTAGGGCCCCGGAGG
GAGGGTCCCGATGGAGGGCAGCCTGGAGGGGCCCGTCTGCCAGCCTCTGCTGCGTGAGGC
TCCGGGGGCCACACTTGGGCTCAGAACACCGCCCCTGCCCTTCATCTGACATCTGGGAAA
CAGCAGAAACACAAATTTAAAAACCCCGTCAGGCCCCCAAACGCCCTGGCCCCACGGGGG
CTGTGCTGGGACCTGGAAGATGCCTGGCCCAAGCTCGCTGGGAGGCCTGGCATTTTTCAT
GGCGTTGGGGCAATTCCTCAATGGGCAGGACCCCCTCCCACATGGCAAAGTTGGGCGTCC
CCTTCCGGCGGCACTCACGCCACCAGCTCCCTCCTGCCATGGCATGGCCCCAAACACACC
CTCTTCGATGTCCAGGACCAGGCAGCACTTGACATTCCCACCGAGGCCCAGAAACGCAGG
CCAACTGAGCCTCGACGACACCCGCTAAAAAGCCAGCTGGAGGGACCCCACAGCGTGCCA
GCTCGATTCCGCTCAGAGTCACAGAAATAAAGACTCAGGATTGGAGGGGACCGCAGACGA
CCGCTTTCTGCAAGCGCCATTCAGCCGTTTCTTTAAATGCCCCCAGAGACGGGGAGCTCA
CTACCTCGAGAGGCCACTTGACTGGTGTTTGGACCGCATTAGAAAAAGTTTATCTTCCGT
CCAAGAGAGATTTGCCTCCTTTGAACGCAGGTGGCCATTGTGTCCAGGCCACCAGGATTT
CTTTTCCTGAGTGACCTTCGCAACGCTGCGAAATCCCATACCCTGTCTCTTCCTTTTTCT
CGGTCTGTATTTCCGGCACAAGCCTACATTAGAGATGGTTTCTCAGCCTCCGCTCTTGGT
GGGAGCCCCAGGGGGCTCATCCCAACCCCATTTTCAGGGGGGATCGGGGAAGTGGGGACG
GCTCATTCCCTCGGGAGGAGGTACGTTACAGATCGGGGTCGCCCTGTGGTGTGGCATCTG
AGTTAAAGGGGCTTGAGAATGTTCTGGATGGAGACGGGAGTGTATTTCTGAGACTGGAGG
ACAATGAAAAGCCACGAGGTCGAAGGCCGGGAGGTGCCCGGGGCCCCGCCCTGCGGGGGG
CTGAGCTCCCCAGTCAGATGCCCAGGGCTGCGGGGGCCGTTCTGGGAGGAAGGCACGAGA
ACAAATCCAGACCCGGCTGGGGAGTGGGCGTCTGTGGCTCCAACCTGGGACAGGTGACGA
GCAAGAGAAGGGTCTCGAACCAGGACTTTGTACAGTGGGAGGGGCCCGAGGCCACCGAGG
ACACACTGGCCACGCCCTGTGCTGCTCACTCTTCTCGGCCGGGACTTCATGAGTGTGGAA
GGACGGAGGGCTGAGAACCGGGTCCTTTTCCAGAACGTGCTAGTACCGCATCGTTAAAAA
AAAATGTTTCCAAGCAGCTAAAAAGGATGCTGGGCTTCAGAGATGGATGGAGACTAGAAC
CCTCTGAAGATGGGACTCAGGAGGAGGCGGGGGCGAGATCCGGGGCCAGAGGGCGTCTGA
CAGAGGTTTCTTGGCGTCTGGAATCTTCTTCGTGTCCTTCTCTGTCCTCACGTCACCTCA
GGACATGCTGAAGAGAGTAAAACACAGCCAAGTTACTATTGTTTTTAAAGAAAGTGGAAA
ATGCTGTTGCAGGTGCATGGAATCCAAAAGAATGACCTAATCTGGCTTTGGTGCACCCTT
GGTAGCAAGAAAGGCACCTGCCCTTTGGGGTCGGTCACCTGCCACTGACCTTCCAGATGG
GGTTCTGAAGAGGACCTCTCTTTTGGTCCAGCCTAAGAACAGGCCCTGGGCCGGTGCCCT
CAGTCAGACAAGAGGGAGGCTTCAACTCACCCATCCACTCACCCATCCACCCATCCACCC
ATCCGTCCGTCTGTTCATCCATCCGTCCAACCATTCACCCACCATCCACCCACCCATCTG
TTCATCCACCCAACAACCCAGCCACACATCCATCTGTCTGTTCACCCATCCATCCATCCG
TCTGTTCATTCATCCATCCATCCATCCAACAACCCACCCACCCATCCATCCATCCACCCA
TTCATCCATCCACCATCCATCCAACATCCATCCATCCACCACCCACCCATCCATCCACCA
TCCATCATCCATCCATCCATCCATCCACCCATCCATCCACCATCCATCATCCATCCATCC
ATCCGTCCACCATCCATCCATCCGTCCACCATCCATCCACCATCCATCCATCCACCATCC
ATCCACCATCCATCCACCAGCCATCCATCCAGCATCCATCCATCCGACCACCATCCATCC
ACCATCTACCCATCCACTTATCCATCCACCCACCAATCCACCAATCCGTTCACCCACCCA
CCCTATCCATCCATCTATACACCCACACATCCACTCATCTGTGTCCATCCCTCCATTGCT
CCCACAATCCCTTTTTTGTGTCTCTAATCATTAAACACGCTTCTGTTATCATCTCTCCCC
GGGGATTCCTGGGAGGGAGTCTGATTCTGCTGTGTGTTGTATCTGCTGACTTTCCCTTAC
GGTGGATGACTTCCTCACGTGTTCTGTGTCTGTGGGTGTGAACACCTCTCCAGAAGGCGT
GGATTGAGATGGTCTTGTCAGAAACGCACCGAGAACTTGCTGCTACTCAGTGTCCCTGAG
GCATCTCTGGTTCAAGATCCTTTTTTTTTTTTTGGAGGAAGATTAGCCCTAAGCTAACAT
CTGCTGCCAATCCTCTTTTTTTTTTTTTTTGCTGAGGAAGACTGGCCCTGAGCGCACATC
CGTGCCCGTCTTCCTCTACTTTATATGTGGGACGCCTACCACAGCATGGCACGCCAAGTG
ATGCCATGTCCGCACCACGATCTGAACCGGCGAACCCCGGGCTGCCAAAGTGGAATGTGG
GCACTTAACCTCTGTGCCACCAGGCTGGCCCCTCCAGATCCTTTTTGTTGTTTATTTCTC
AGCTTGGGGCTCCCTGGGTCACATGGGTGGCATTACAGTGGGCGTCCAGGCCATGTTACA
GATGGGAAGAGAATGTGTGATCAAGGGTCAACCTGCAAGTTCCAAAGAAAGGTCTGGCCC
TTACCTGGCTCCTGGGAGGTCACCTCTGAGTCCTGGGAACGTCCTGTCTTGACCTGGGGA
CCTTGGGTCATGCCCCATGGTCCATGCTAACAATGCAATTTAGAGGGACTGGAGGCTAAG
GCCAGCCACGCATATGTGACTGACCCCTAGTAAACACCATGGACACCACAGCTCGGGTGA
GCATCCCTGGTTGGCCACACCTCCTGCACTTTGCCCACATTGCTGTTGGGAGAATTAAGG
GCCATCCTGTTGCTGATTTTCCTCTGGGTCCATCCTTCTGCTGTAATAAACCATAACCGT
GAGCATAACAGCTCTGCTGCATTCTGTGAGTCCTTCTGGCAAACCACTGAACCCGAGGAG
GGTCTCCTGGATCCTGACACACGGCGAGGCCTTTCCTGGCATCTGGAACCAGGCAGAGAG
AACGCGACAGGCCCTGGGTGGATGGTGCACCCTTTGCTGAGCTATGTCCCAGGCTTGCGG
GGGCCTGGCTCCAGGTGGGCGACCATGCTGCTCAGCTCTGGGGCCTTGTGTCCACCCAAC
AACTCACCCACCCATCCAACCATCCACCCATCCATCCATCCATCCATCCACCCATCCATC
CACCCATCCATCCACCCATCCATCCACCTTCCATCCATCCATCCACCCATCCATCCACCC
ATCCATCCACCCATCCATCCATCCATCCATCCACCCATCCATCCACCCATCTACCATCCA
CCATCCATCCACCCATCCATCCACCCATCCATCCACCATCCATCCATCCACCCATCCATC
CACCCTCCCATCCACCCATCCACCCTCCCATCCACCCATCCATCCACCCATCGGTCCACC
AACCTTCCATCCAACATCCATCCACCATCCCAGAGGCGCCACTGCCCACAGAGACCAGCA
AACCTTGCCCCATCCCTCCAACCGTCCTCAAGTCGGTGATCCGACTAGCCATCCTACAAG
CGAACCACACATCCACCTAAGGATTATTATGTTCAACCATAGATCCAAACCAATAAAAGC
GGAGGCCCGGTGGGGGGGGAAAAGAGGTGACTCTCTTGAGTGCCTGGGGACCCGAAACTC
CCTTAACTGAAGGAAAAATCAAGGGGGACGCATGAGCACTGGATGGGACTTCAATGGAAA
AAAATTACCCAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCAGCGCAGGCTTTGG
GACGGGGAGGGGGAGTAACCCAGGGAGAGAGAGAGATAAAGTCAGAGAGACAGAGACAGA
CAGACAGAGAGAGGGGAGGAAGGAAGGGAGAAAAAGGAGCAAGACAGACAGACCTGACCC
CCTCACAGGCGCCAGGAGGGCGACTATCATGAAAACAGACAATGACAAGGGTGGCGAGGA
CGTGGAGGAATTGGAACCCTCGTGCACTGTCGGTGGGAGTGGAAAATGGAGCAGCTGCTG
AGGAAAACACTCCAGCGGTTCCTGGACAGATTGAAAGTAGAACCGGCATGTGATCCGGAA
TCCCACTTCTGGGGCTACACCCCAAAGAATGGAGGGATGTTTGCACAGCCGTGTTCAGAG
CAGCGTGATTCGCAGCAGCCAAAAGATGGAAGCAACGCGAGTGTCTAGTGATGGAGGATA
GACACACACAACGTGGTCCAGCCACAGCCTGGAATATTACGCAGCCACGAAAAAGGAGAT
CCTGACGCCTGCTCCAACGTGGACGGACCTGGAGGACGTGATGCTCAGGGACGTGAGCCA
GACACAGAGGGACACACACTGTGTGGTCCACTCACAGGAGGTCCCCAGAGGAGCCACAGC
CACAGAGACAGAAAGTGGATGGGGGGCCAGGGGCTGGAGGAGGGGTGGGAGTCAGTGTTT
CCTGGGGACAGAGCTGCAGTTTGGGGAGATGGAGGGTTCTGGAGACGGATGGAGGGGATG
GTGGCACAACCGTGTGAGTGTGCTTCATGCCGCTGAGCTGTGTGCTTAAAATTGATTAAG
AGGGTGAATTTTACATTATGTGTATTCTACTAGGATAAAATTTTTTTCTTAAAAAAAGAC
AGGATGGAAGGAAGGAAGGAAGGAAGAGAGAGGAAGAGAAGGAGGAAAAGTCCCCGAATG
GCACGGGATGGTGAGTCCCGCCCGCCTCCAGCCTCTCTCCCCTGGTGGCCCACGGCTCGT
CCGGCCTCTGTCACTATTAAATGACTCTGTGAAGCCGCCATGCTTTTGCTCATTACGCGT
CTCATCTGCCGCTATCACCCTCCCTGCTCCAGGACCCATTTTCCTCGCTCGGTGAGGCGT
GCCTCTCCTTCACCACTTGAAGAACCTTCTGGACCAGGACTCCATCTTATTCACCTCTGT
TTCCCACGAGGCTGGCCCAGGGCCTGGCAACGACACAGGCTTTTGACCCACCGAAAGCCC
CAACTCTCTCACCGACTTGCTGTGTGGCCTTGGGGGATGGCTTGCCCTCTCTGAGCCTTG
GATTCTCATGGTTACGCCACTAATGAAAAATGAGCCAATTAGATAGCAAAGGGGTGTTTC
TGGGTCTCCCAGGGGAGAGTAAGGAGCTTGTGTCCCCTCTGTAAAGGGAGATATTATTAT
TAATATTATCCTGGTTACCGTCATTAGTCTTTACGGAGCCACCATTTTCCCCAAGTGGCA
CAATGGCTGCCATTGCTCCTGAGATCTCACAATGACGCCCAAGGTGGCTATGAACTTTTT
ACTTGCCTAATGTCACCTGTCGGTAAATGGAGGAGCCTGGATTCGAACCCGGGTCGGACG
CCAAGCCCTCTAGGGAAGGGCAGGGGCTTGAGCCGTGTGCTTGCATGACATGGGTCCCTG
CTGAGCCGAAGCCGCCGGTCGCCCCCCCGGATTTGGGCCCAGCTCAGCGCCAGCCCCGAC
CCGGCCCTGACGAAGCCCCTGCACTGACCTCTCTCTCCTGGCCTTGAGCCGCTCCTCTTC
GTACCTGGAAGGGAGAAGGAAAAGCACGTCGGGCGCAGCCCTCCTCTCCCCGTGCCCGGA
ATTCCCTTCCCTCTGGAACAGACACGACCTCATCGTCACATCCGAACACACGCCAGGCTG
TGGAGGCAACAGGACAGCCCGCCATTCTCTTTTATGTTCCCTGCAGCCGCTTTACAAGCC
CCCTGCTTGGTTGGCATATTCCAGCATCGGGTGTAGACATGACTCAGCAGACCCTTTTTG
CCGGTTCAGCATCAGCGATGGAACCGTGCCCTGATAAAGCAAGGCCCGCATCCACGTGGG
CGGGTCTACACACCCTTCCATCAGGCCAGTTTTTCTGTAAAGGGCCGAAGAGGGGATGTT
TCCGGCTTGGCAGGCCAGTCTCGGTCATCGCGACTCAATTCAGTTGTAACTCAAAAGCAG
CCACTGATGACGCATCAATGGGTGCGCGTGGCTGTGTGCCGATAAAACTTTATTTATAAA
ACCGAGCCGGGGGCCGGGGCTCGCTGGCCCCCGAGATGCCCAGGGCCGCTGCCTTCTCTA
ATCTCACATACGCCTGTTTTTGCTTCCGTTCTGCTGTTTTCCCAACGCGCCTGGTTCCCG
GGCAGCCGTGTTTAGCTGAGCGGGGACGTGAGGAGCGCGGGGGGCGTTAGGGACTGAGGG
GGTGGCGCTCCCACGGCACAGGGACACCTACTGGAGCACGCAGTCCGGGATCTGCACGTG
TTCCATGGGGATGAGCTGCTCCAGGCCTTCCAAGCTGTGCACGTACTGGATCTTGTTGAT
AAACTTGACGCTGGCAGGATGGGGAGGAGGCAGGCGTCAGAGACGCAGCCCGCGGGCGGC
ACCCAAGCCACACGGAGAGACGGCACAGGGCAACGCACACGCGCCCTATTCCAGGGCGCC
CCGAGCATCTTCCCTCCAGCTTTTTGCCCTGCCCGATGCCAGCCTCCACCCCGCGCCCCT
GGGGGCTGGACAGAGCAGAACCGGCCCCACGGTTATTCCAAAAAAACCAACTTCAACCTA
ATTTTGGTGATACATAAAATCAACTTTTCTCAAGGTCAAATCAATTCCCCTAAGGATGAG
AACTATAAGGCCAAGAGAATATAACGGCCCGATAAATAATAAAATAATCAAGTCACAGTA
AAAAAAAAGTCAGGTAGAGGGGCCGGCCCGGTGGCACAGCGGTTAAGTGTGCACGTTCCA
CTTTGGCAGCCTGGGGTTTGCTGGTTTGGATCCCGGGTGTGGACATGGCACCGCTCGGCA
CGCCATGCTGTGGTAGGCGTCCCACATATAAAGTAGAGGAAGATGGGCACGGATCTCAAC
TCAGGGCCAGTCTTCCTCAGCAAAAAAAAAAAGAAAAGAAAAGAAAAAGAAAAAAAGGAG
GATTGGCAGCAGATGTTAGCTCAGGGCTAATCTTCCTCAAAAAAAAAAAAAAAAAAAAGA
CACAACAACTCCCGTGGGTGTCCAGATACGGGCTCTAGACACTCACCTGATGAAAGGCCG
GGAGATGGCCAGCACGGTGCGAATGAACCAGGACGGGTGGACGATGATCAGGGACTTCAG
GTTCTTCCGCAATCTGCGTGGGGGGCACAGGAAGAAAGATGAGCTCCCAGTGGCTCCAGG
CTCCTCCCGGTTTTCCGGGGCGGCCGTGCAGCCTCCGCAAAGCTGGGCGCCTTCGCAGGG
TCGTGGGAGCTGACGGCCGGTCCCGCCCGAGTCTTAATCCAGAGTCTGAGCTGTCGACCG
CGTGGCCACACCGCCGTCCCGTCCTGGAAGCTTTTCTGGGCGCCCCGGTTCTGGGTATCG
CTTACGGTCATGTTGAATTCATATGTCCCCCCCGCCCCGAATTCATACGTTCAGGTCCCA
ACCCCCAGGGTCTCAGGATGGGACCTTATTCGGGAAGAGGGTCCATGCAGGAGAAATTAG
TTCAGGCGAGGTCACACCGGGGTGAGGGGGGGTGGCCCTAAACCAATGTGACTGGCGTCC
TTATAAAAGGGGACCTTTAGACACAGACACGCAGGGAGAAGGCCACGCGAAGACGGAGGT
AGAGGCCGGGGTGACACTTCTACGAGCCGAGGACGGCCAGCGGCGCCCCGAAGCTGGGGG
TGACATGGGGCAGATTCCCCCTCTCGGCCCCCTCGGCCCCGGCCCTGCTGACCCCTCGAT
CTTGGACTCTGGCTCCCAGAAACGGGGAAGGATAAATGTCCGTGGGGCTTTGCTGCGGCC
ACGCCACCATTCAGAGCGACCTCGGCGCTCGGGGTCCCTGGTCCCCGCCGCCGGGCTCAC
CTCCTGTCAATCATCTGGTAACACTTCTTCAGCCAGCCGATGCCGGGCATCCTCCGCCGC
GGGGTGGCCCCATTCAGGTACACGATCATGTAATCCTCGGCCACCAGGAGCTCCAGACTG
CTGATGACGTACCTGGTCACCGGGCCCGGAGGACAGGGGACCCGGCCGGCGGGGCCCAGC
GTCAGGGAGCCCCAGCTCTCACGCCTGAGCACCCGTGTCCCCGGCCCCAAACAGGCACCC
ATGGCGGACGGTCCCCCGCCTCTTCCTGAGCGACTCCAGAAAAATCCTGCCCCTCGTTCT
CAGCCTCGAGTTCCCCATCTGTGCCTGTGTGTCCTTGGGCAAGTGACCCAACCTCTCTGT
GCCTCGGGCTCTGCACTGTAGAATGGGAGGCAACGGCACCTCCCCCGTGGGGTCCCGGGG
AGGGTGGGGAGCGCCCAGCCTCGTGGCTGCCATATAGTAAAGGCCCCGAAATTGATAGTG
GTGACCAGGGGACCCGGATGGAGGTCGGCCGGCGGGCCAGCCCGCCCAGCGGGGACGGAG
AACAGCCACTTACAGGAAGAGGTTCTCCATGATGTAGTGGTAGTCGGGGGAGCTGCTGTC
CGGGAGGAAGCAGGCGGCGAAGACGATGATGGCATTGAGACCCTCGCCGTAGTACCCTGC
ACAGAGGCGGCCGTGGGTGGCCCCAGGCAGAGACGGGCAGAGAGCCGGGACGCCGGCCAC
CCCGTCGGTGCCCGCTGGTCCACGCCTCAGCCCCGTGCAAGTTTCACCCCACCCCCTGCC
CTCCCCGAGACCAGGGCTTAACATCCCTGAGGCTCAGAAGAAGAGACCGAGGTTCAGAGA
GGGCCACTGACCGGCCTCCAGCTGGTGCCGGGAGGGGGCCAGGGGCGCGGTCTCACCTCC
GTGGGTCACCACCCTCATGTAGGGCCGGATCATGTGCAGGTCGATGCGGTGTTCTTGCTC
TCCAATGATCACCGTCCGCCACAGCCGTCCGTTGGCCGCGCTGCCGTCCTCGGCTGCGCC
GTCCCCGAACAGATCTGCGCTGTCCCCGGGCATGTTCTTGGCGGCGGCCACGGGCGTGTC
ATCTGGGAGCAGGCGGGGTGGGGGGTGTGACAGAGGGGATGCCTGAGTCGGGCATCTCGT
CCCGGCCTCCCGCCTCCTTCCGCTGCCCGTGGCCGCGTGGCCGCACCTCCCTTTTGTCCT
CCGCTTTGCCGACTGACGGCGTGTGGCGGGGCTGGGGGTGCTGCTGGGGGAAACGGCGGC
TCTGGGAGTCAAAAAATCACGCCTAAATCACAACTCGGGTCTTTTTCAAACTTCAGAACA
CAGGAAAGTGCTCGCGGGGGACGTCAGGCGGTCGACCTGGGTAGACCCCGTTTCTGCCAA
TGACTCGCTGTGTGGCCTTTTGGGCATTCTGTCCCTCTCTGGGCTTCTCAGGTTTTTAAC
TACTCAAAATGTCCCCGTCTTGCCCACCTTCCTTCCTGCAGTCTTCCCGCCTCAGGAAAC
GGTGCGGCCACATCCCGGCTGCTCAGAGCCCCAGAGCAGGCATCCCGGTCGCCTTCTGTT
CCCTCTCTGTTCCTTCCATCCCCGAGGCCACCGCCGCCTCCTCCTCTGGGGTCTCCCTGC
CTCCGATCCCCGCCACCGCCACCCGCTTTCGCCAGGCTACACTAGGGAACGAGGATGGGA
ACCCCAATCCGGTCGGTCCCCCGGCAGTTTCCCACCAGACTGGGAATAAAAGGTGACCCC
CCCAACCCTGCCCTGTCCCCTCGCCTCCTCCTTTGGCTCCCAGCATCCACGCGCAGCTGC
TGGGACCCTGGCGCGTCTCTGGTTTCCAGCACCGTCTTTGTGCCACGTGTGCCGTGGGCC
CCGTCTCTTCCCGGCCCGTCCCCCCCAGACCCCCCAGACCCTCAGTGGACACCCGGAGTG
GACGCCCCGCCGACTCTGGGCAAATCGGCTGGAGACACACCCTTCCGGTCTCAGAAAGCC
AAGTCCCCGGGGAAAAACCCACGCGTCCCCGAGCCAGAGGGGCCGGAGGCTCCGGGTGGC
TCCCGTGGGCGACCTCGGCCTCACCTTCCCACTCCAGCTCGTTGCCGTTGCCCAGAAACT
CGAGCGAGTCGGTCTCGTCGGGGGTCTCGATGTCGTCCACGTTGATGTCCAGGTCATCGG
GCGTGTCCAGGAAGTCGTCGGACAGCAGCGAGCCCTCGCTCTGGTCCAGGGACAGGTTGA
TCTCGGGCGCCACCAGCGTCTTGCGCTTCCGATGGGCCCCGTTGAAGGTCAACGTGTTGG
GAGGGGCTGTGGGGAAAAAAAAAAAAAAAACAGCAAAATCAGACAAAACGGGGTGACTTT
TCTTTCTTTTTCCCACTCCCCACTTCCCGCCCCGGCCGCCACGCGACGTCCTCTTGTGCT
GGACATTCACGCCGTCACCGTCCGCTCGTCCAGAGCCCCCTCGCGCCTCTGAGCTTGACT
CAGTTTCCCCATCTGCAAAAGGGGCTCGCGGGAGGTGAGCCGGGTCAAGGTCGCATGGAC
GACCCGCCCGCTAGACCCCGGGCGCCGGCCCCACTCTGGCCGGTGTCTGCGGTTACTGTC
GCCTCCGGGCGCGGCTGGCAGAGAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1096, 153483..153535, 175286..175364
1001..1096, 153483..153535, 175286..175364
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved