Equus_caballus Locus RPS3A
snOPY snoRNA Orthological Gene Database
Equus_caballus RPS3A
Equus_caballus
RPS3A
2
SNORD73, SNORD73
3243..3315, 4744..4815
6428
GAGGCCAGGCCGGGGGTGCAGCGGGTAAATTCGCATGCTCCACTTCAGCGGCCCCGGGG
TTCACCCATTCCATCCCAGACCGACCTAAGCACCACTTGGCAAGCCATGCGGTGGCAGGC
GTCCCAAATATAAGGTAGAGGGAGATGGGCACAGATGTTAGCTCAGGGCCAGTCTTCCCC
AAAAAGAAAAAAACCTGTTTTGGGATTAGTTGCAAAAATTCAAAAACTTGTGGATTTCAC
ACAAAAAATTCCCAACTTTTCTTGAAAAATCAAAATGTCTGGGAACACTGGATCCATAGT
CCCTCAGGGAAACAATCGGCTGAGTTCACTCCACTTTTTTTTTTTAACTTTATATCACGG
TATAAGAAACATGGAAAAGTCCACAGATAAGCGTACAGCTTGATGGATGTTCACAAAGCG
AACATACCCCACTAACCAGCACCCATACCGACAAGCAGAACATTACTAGTATCCCCAAAG
TTATACTTAAGTCTACTATCTTATGAGGTAGATTATATTACTATCTCCATTTTAAATACG
GGGAAACGGAAGCACAGACAGGTCACAAGGCTTAATATTGTTGAAACTAGCATTTGAACC
TGGATGTGCTGCTTGATTCCAAATCCCATGCTCTCGAGAAAACAGTTTTGAAAGTGAGAT
GGTGAGTTCAGCTTTGAGCGACGATGAGCGGGCGTCTCCTTCCACACAAACTCATTTCCC
GGCGTCGGAGCCACGGAAACCACCGGCAACCAGAAGTCTGCACCTCAAGCCGCCAGCACC
CGCGCCTCGGGAGTGCAACCTCCCAGCGAGTGGCCAGCAGCGTGCTGCGCGGTCTCCCCA
CACGGGAGGGCGCTGTCACAGCCACAGTCGGAAGAGTGGCGCTTTCTGCTGTCCCGATAT
TCTTGAGGACGGAAGAACGCAAGATCGCAGGTCACGTAGACGGCGTGCCCCGCCCCGTAC
AGCCTAAGTTCTCGCGCGAGTTGCACTTCCGCCCTTTTGGCTCACTGAGCAGCGTCATGG
CGGTGGGAAAGAACAAGCGCCTTACGAAAGGAGGGAAAAAGGGCGCCAAGAAGAAAGTGT
AAGTGGCGACTGTCGTGGCCTGCCGCTTTTTGGGGTGCTGCTGGAGTCGGCGGGCGGGTT
CTGGGTCGCGGCGTGGGCCGGATGGCGAGGATGCTAGTTGGATTGCGCGGGCCGTGCCGG
GGTGGTAAACGCCAAACCGCGGCCTGGCGGATCTGGGTGCTGGGTCGCGGCTGTTCGGCT
GCCTTTCCCCTGGTCTTCTGGGTCTTCTCTCCCCTTTTGAGCCAGAGTGTCGTCGCGACT
CGGGGCTGGCATGTTTTTGTATTGCAGGCCCAAGGGCCTCGTAAATTCCACGGGTAATAG
ATGCCACTCCAAGAGCTGGAGTTGAGGAAGGTACTTTTCTTGTGCACCCACGAGCCTACA
CTCCTCCTCTGCTTGAGCCGGGTGGAACCTGGGAGCTCCTCATAGGCTCCCGTGAGGCCC
TGAAGAGCCTGGGTTACCAGTACGTGTCTTCATGTACTAGTAAAGTTCAAAAGACGTGCA
TGTTATTTGGAGGCAGTGCTGCCTATGTAGTCAAAGGACCGATGGGAGTGGGGAGTGTGT
ACGTTTGTGGCATAATTTTATCAAAGTGTCCGGTTTGTGCAGTGAAACACGTAGTGGGAA
GATCTACATTTACATGTGTGCCCCTCACCTCGCTGTGTGAGAAATAGTTTACTCTTGTTT
CTACATGTCAGTTAGCTCTTTAGATGACTAGAATGAGGAAAGTTGAAAAAAAAATCAAAA
ATTACGTGATCTGCGATAAAACTTAAGCATTTTTTTAAATCCAGGGTTGATCCATTTTCT
AAGAAAGATTGGTATGATGTGAAAGCACCAGCTATGTTCAATATAAGAAATATCGGGAAA
ACGTTAGTCACGAGAACTCAAGGAACCAGTGAGTATCTTAATCTTGGTTTGTATTTTTCT
TGAATTGAGACATGGATGTATCTTGGTCTACTGTTGGTCCTGTCATGGGAGCTTTAAGGA
AACGTCAGCTGTTGGTTGCAGCTTTGGACCCTGTGGTGCTTGTTTTTGGTACAACACTTG
TAGAAGCAAGGTGGTGCTTTTAGAATTACTAAGAAAAGGTGCATGAATAGTTTTGAGCTT
CTAATGAGCACTGTCAGTAAGTCATTGGTGTCAAGATGGACTTGATTAACAAAAGTTAAG
GTCTTTATAATTTACCATTTTCTAAGCTCAACTTTATGCATGGGCATAATCTTTGTTGGC
TTGACTTTGCTTCTGTGGTTCCTAATGTTAATAAGACAATTGATTTCTTGTTTTATAGAA
ATCGCATCTGATGGCCTCAAGGGTCGTGTTTTTGAAGTGAGCCTTGCTGATCTGCAGAAT
GACGAAGTTGCATTTAGAAAATTCAAGCTAATTACTGAGGATGTTCAGGGCAAAAACTGC
CTAACTAACTTCCATGGGATGGATCTTACTCGTGACAAAATGTGCTCCATGGTCAAAAAA
TGGCAGGTGAGAACAAAAGTTCCGTAGAGTGCGTGGTGCTGTGGCTGGCATCACCAGGAA
GGCCATGGTGTGATGACAGGAAGGAGCAAATCATGCAGTTGAGGTTTAGATTTCATTTTA
ATCCTTGATGTTTTCTTGCTGTTGCTGAGTGCTGACTCTGGGATTGGCGCTCTTGAACTT
GAGCAACAGCTGAGCTGAGCAAGCCGTGTTCCTCTTATTTATCTGTTTAAATTCAGTTCA
AGATTTAATACTGGGCTATCATCCAAGTTTTCTTGCTGCCTGAGTTAGTGGCTGGTTGGG
GAACATCTAGGTGCAGGGGTGCGGGTTTGCAGTTTTTGCCTATCTTCAAAATATCTTTGG
ACCTCGAAGTTCAGTGAGTTTTATAGTGGAAGGGTGGAGTGGGCTAGTCTTGATTACCTC
TGGCAAGATAGCGTAATAAGAGTGGCAGAGTCTCTGGTGTAGGGTTGAAATTTTGGCTTC
ATTTCCCAGTTGTGTTCTCATTGGCAAGTAACTTAAAGCTTGCTAAGCCTTGGTTTCTTT
ATCTGTAAAATGTAGGTAAGAGTATCATCTCACAGACTTAGGAGGATGAAATACAAGATC
CGTGTGAACATGCTTAGCATAGAAAGCATTTAGTAAACAATAGTAGTATTACAGGAAATA
ATAATTACCTTGGTTCAGATGTGTCTGGCTAACCACCCAGTTTGGGGATGTTTTGTATAC
GGGAATGAATGATGACAAGATGTTTCGGTCCCAGATGATACATACTGATTATACCGTTAC
ATTTATTTCTGACATTCCCCTAAGATTTTACAGTTGCATTTCTGGAAATATTTAAGGTCT
TTTTGCTATCATTATATTCATTTTTTAAACTAAGGTATAATATTTACAAAACGCAAAGAA
GGCAATTCAGTTTTTGTCACTACTTAAGATTGTTTTTTAAGTTTCAGCAGTACTATGGCT
AATTATTGATATTTTTATTCTGTTTTAGCTGTGAAATTGAATAGTTAATCCTCAGCATGG
CTTTAGTTTGGAATATAAAGGACATTTAAAAATATGTGCATTTTAGTGTTATTGCAACAC
TTCACCTATTCAGAGCGCACGTTTTCAAAAGATGGAGAGTAGATGTCCATATTGTAGAGT
CTCTTAGAACCTATTTTCCTCTTATCTTGCCGAGTTGTACAATTGATTGGGGGCAAGGGC
AGGCTGTTAGAGGCTGGCATGTGTGCAAGGTGTGGGTGGGTGCTGTTTATAGTGATAGTG
AGGATAGAGAAGTCACCTAGAGAGGAAGAGGGAAGACACTTGAGAGGACTTGGTATTTAT
TTAATTAGATGTGAAGGATAGTAAGGACTTGGGGTATTTAATGATAAGTTTACTTCAAGA
AAGTTAATTCTAGGCTTTATACTGTGTAATCAGTACCTGACCTTCCAGCTTTTTTATATT
ACAGTTTGAGGGATAAAAATCGATTACATTAAAACCCAGTGTAGGGCCGTCCCCGTGGCC
AAGTGGTTAAGTTCGCGCACTCTGCTTTGGTGGCCCAGGGTTTTGCTGGTTCTGATCCTG
GGCGCGGACATGGCACCGCTCTTCAGGCCATGCAGAGGTGGCATCCCACGTGCCACAACT
CGAGGACCCACAACTAAAATATACAGCCATGTACTAGGGGTACTTGAGGAGAAAAAAAAA
CAGTGTATCTGACGCTATCTTTTTTTCACTAGACCATGATTGAAGCTCATGTTGACGTCA
AGACTACCGATGGTTATTTGCTTCGTCTGTTCTGTGTTGGTTTTACTAAAAAACGCAACA
ATCAGATTCGGAAGACCTCTTATGCTCAGCACCAACAGGTCCGTCAGATCCGGAAGAAGA
TGATGGAAATCATGACCCGAGAGGTGCAGACCAATGACTTGAAAGAAGTGGTCAATAAAT
TGTAAGTGTTTCTTTTTCCTCACACAATACAAGCCTGAATCTCTGATGATCCCTCAGATG
AGGAAAAGCGTATGAGACAAGGTGGAGTCAGATCTGTGCTTAAATCCTGTCTGAAACCGT
TTAGCTACATCCGTAGAAATAAAAGCATATTACGTGCTCAGTAAATGTGATTTGGTTTCT
TTATACTTTTTTGGATGAAGCTATCTCATGGCATTTAGTGAGACTTGAAGCACAGGAAAT
GCTCTTGCCTTAATTGGAAAATACACTGAGTAGATGGAATCCTCCACAAACAATAATGTA
TGGGAATAGATGATGACAATGTGTTTCGGTCCCATATGATGTCCGGTGATAAAACTGTTA
ACATTTTTCTGATGTTCCCATGCAGTTGACTAAGAGTAATGGAAAAGAAATAAAGCTTGG
ACTCAGAAGGTTCAAATGTTAACTTTACTACTAATGAGCTGTATAGTTCAGATCATTTAA
CCTTCACGTGTAAAAGGGGCAATAATAGATTATTTTACATGAGGATTTATGTGGGTCAAA
TGAGGTATTATATGTGTAGGTTTATTCTAATGTCATTACTGGTTTGCAGGATTCCAGACA
GTATTGGAAAGGACATAGAAAAGGCTTGCCAGTCTATTTATCCACTCCATGATGTCTTTG
TTAGAAAAGTAAAAATGCTGAAGAAGCCCAAGTTTGAATGTAAGTGAAAAATCACAGGAT
TCCTGAAAGAAAAAACATTATTTAGTGTTTTGTTTTTGTGTTTTTGAGGCCAGATGGCTT
TTTTTTCTGTCATGCCTATATAGTATTGAAGACCATTGTTTCAATATACAGTGTACTATA
ACTAACAGAATTTTTTCTTCCTTTTAGTGGGAAAACTCATGGAGCTTCATGGTGAAGGTA
GTAGTTCTGGAAAAGCTACTGGGGATGAGACAGGTGCTAAAGTTGAACGAGCTGACGGAT
ACGAGCCACCAGTGCAAGAATCTGTTTAAAATTCAGACTTTTGATGGAGACAAATTAAAA
AAAATCTTATTTGTGATATTTTATTTCTGGTCGTTCTTTTCAAATCGTCTGACAGCTTGG
TGAATCAGATCTTCTTAATTGATAAGTCTGGTGGACTTTTCTGACTTGTTGAATGAATGG
ATTTTATCCATTGCTCTTAGATACTAAGTAGCTGAGAAAGGGTAGTGATCTATTTTAGAG
CTGTAGTGATCAGGAAGCATTATAGATGGATAATAAAAGGAACGCTTTCTTTACATGGCT
TAGGTTTTCAGATGGTTCTCAAACCGCCTGGAAGGCTTATTAAAACAGATTGCAGGACCC
TGCCCCCAGAGTTTCTGATTAAGTAGTTGTAGGGTGAGGCCTGAAATTTTGCATTTTTAA
CAAGTTTCCAGGTAATGCTGATGGCCAGGGATGACAGTTGAGAACCACTCTACTAGACTG
ATTGAATAATGGAAAGGGAAGAGCCCATTGGCTTTTTGTTTTTTTAATCCAAAAGCTGTC
TTTTTCCTCTAGCTGTAAAATGCCGCACTGTGCACCTCCCCTGTGAAGCTAAACTTGGCT
AGAGAACTTGTTTATTGGTCTTTTAGTAAGGGGGCGTGTAATGCTGCCTACGGTCTAGCT
TTTCCTTCTGTAGTCCCTCACCTATTCTGTTCTATAACCCTTCTCTCAAACCTCCAGCGT
TCTAATTCTTGCTCAGCTGATGACCTTAAAATCATGAAGAAAGTTTAAAGTAGATGAGAA
AACAGCCTCACAAATTCCCATTACTTCCACCCTGTCATGTATACATGTGTTCACATTTTC
TGCCTTCCCTCTTGTCATTGGGTGAGTAATGCTAGGACATTTGAGCATTAGGTCCCACCT
CTTGCCTAAGCAAGTTCATGGTTCCAACAATTCTCACCTTTATCAATATTCCTTCTACCA
GTCTCATCAGCATACAAATGAATCCTCTACCCTTAAAGATATCACCCTACTCAGCCACTT
ATATCAAAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1077, 1844..1947, 2338..2525, 4232..4440, 5029..5138, 5307..5428
1016..1077, 1844..1947, 2338..2525, 4232..4440, 5029..5138, 5307..5425
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved