Equus_caballus Locus PABPC4
snOPY snoRNA Orthological Gene Database
Equus_caballus PABPC4
Equus_caballus
PABPC4
2
SNORA55
8623..8757
16524
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTTTTATCGTTTGGAGGGGCAGTCCCCATTTTAATTTGTTTTTCTTTTTGGAAATT
GGGAGCTTCCGATCGGGACCGCCGAAATCTACAAACTCCCCGGGAGGGCCATATTGTTTT
TGCGAGCCTTTTGTCTGTGGCTTTGCAGTCTCGTGCGAGCCGTCCCCGAACTCCTCTTGG
CGGTCCTCCGTCGCTCTGAGCCGACTCCCGCTTCCCTTAGCTTCCCTCTGCCACCTGTGA
GCCGCGGCGCGGGCCACGGCTCCGAGAAGAGCCCCTTTTGTCCTGTGGGGTCCCTGTAAG
AAGTCCTCCTGGCGGGGCTCGGGGTGGTGGGGGCTGGGGAGATGAACGCTGCAGCCAGCA
GCTACCCCATGGCCTCCCTGTACGTGGGCGACCTGCACTCGGACGTCACCGAGGCCATGC
TGTATGAAAAGTTCAGTCCTGCGGGGCCTGTGCTGTCCATCCGGGTCTGCCGCGATATGA
TCACCCGCCGCTCCCTGGGTTATGCCTACGTCAACTTCCAGCAGCCGGCTGACGGTGAGT
AGAAGCTATGTCCACACGGTCGTGGGGTCCCAGGGGACCCTAGGAATCAGCCTCCAGGCA
GGTCCCCACCCCCACGGAGGGGGCATCAAGACGGCACCTTGCCACGGGAGCCATAGTGGG
GAACAGGATGCAGGGGTTTGGAACAAGGATCCTGGCATCAGGTGACCGGAGTTTCAGTGT
TGCTTCCACTTGCTAACTGGGTGACCTTGGGCTAATCAGTGGTGACGGTGGGGTTGGAAC
CCAAGGAGACTGTAAAATGGGATCAGAGGGAAGTCACTGTCATCCCATTGTGTGTGTGTG
TGGTCCTGCTGCAGTGGGGCTGGGCTGTTAGAGACCCTTGCCTGGTCAGTGGGCATGGGC
TCAGGCCCCTCAGAGGCCTGCCAAAAAGGCAGGACTGTCGAAACACAAATCCTGCAACAA
TTTGTGATGGCAGGGTCACTGCCTCCCCCCCTACCTTTATCCTGGACTAAGAGCCTTTGG
TTTTGTGCTGCTAAGGGATCTTTCAGGGCAGGTGGGAAGCAGGGGAGCGATTCTCTGCGT
TCATCTTGAGCAGGCCCTTGTGTTAGCACCGCCAGAGCTGCAGGTGCCAGGCCAGCTCCC
CCTGTGCTGTGGAGAAAGGGTATCCAGTTAGTCTTGGGGAGGTGCTGCTTGGAAATCCAC
TGGGCTGGTGAGGATCGTTGCCTCACCTGTGAACAGTGCTTTCCAGTTGGCGAAACCGTT
CCTTCATCCCGTCTGAAGAAAATAGGATTCCTGAGAAGGAGAAGGAACTGCAGGAGGTTG
GAGGCTAAGCTGGGACCGCCAGTGCAGTGCCCTGCCGGACCAGATTGGGGCCTTAGCCCT
CAGAGGAGAGGTATGCTGCAGGCGTGGCAGGAGTGAGGCCAGAGGAAACCTAATCAGGGG
CTGCACGTGACTCCAGATTAAAAGGGAACAACTGTAGAGACCATTACTGGAGAAACAAGC
CATTCTATGGCAAAGGATCTCCGGGTCCCTATTTTTGTCCCCACTTTGTTCACTGTCCGT
GAAGCACAGAGAATGTCACCTGCCCAGGACTGGACTTGTTGAGAGACACCAGGCACTGCT
ACCATCGATTCAGTGTGCTCTGAGCTGAGTTGTGTCTGGCCACAGGGCACAAAGGAGGTG
GCTGAGTGTGGCCTTTTTAGCTGGGAGTAGTGGGTCCATTGGCTGTTGCCTGCCTCCTTG
ACTCTTCTGAACAAAAGTCCTGTCACTTAGAGATAGGAGCAGAAGCCATTGGTCAGTGTG
TCTGCCAACACATACCTCTGCAGGACCTCTACTTGCTATAAATAAGTGCAGCGAGATTTG
TCAGGCTAAGCTGACTTGCCTTCTGCAGCGCCGCCTGGAAATAGACAAGGAGCTGTGTTG
GAATGGGCTTCTTCACTGCTAATTAATGAAACAGTTTGGGGTCCCAGGCTCTGATCGCAG
CTGGCCATCACAAGTGACCTCTTCTGCACCTGGACTTTTCCTGACATGGATCTGCCCTGG
CTCCCCTTTCCCTGACCACCTCCCGTACTGAGGAGCCCACCTCGGGAAGGTGGTTAGAAA
TACTGAGTGAAAAGGAGACGCTCCCTTGGCTGACTGGGCAGCTGAGCTTGTGGAGGGCCA
GTTAGGGAATTTTGTCCCTGTTTGAAGTAAGGTGGTGCCTTGAGGCGGGAGAAATACAGC
CCCAGTCCCTGGATAGAGGAGATTCCGGGTGATGGCATTGTATAAGTCAGGGGAAGTGGG
CCACCAGCCCTGGGTCCCTGTTAGTACCAGTGAAGTGTTCCTGCTGGCGGGTGGTGATAT
ATTTTGGCTTCTGGTCTTCTAAATCCATGGTGTACACGTGGATTTGGTTGGGAAGCTAAG
GAGGTATCCCAGGGCCCTGGATGGAGAAGTTGGTTGGGCACTAAGGCGTTTGAAGACCTG
GAATTCCATTCAACTCAGATAAGGTCTTCAGAAGGCCTGGAAATCGCCAGGTACAGGGCC
CACCTGCACTGTCTGCTTAGGGAGAAAGGTGTTGCAGTTTCCTCCTCCTTGTCCTGATAA
TACAAAGAACATTTACATGTGTGACCATTAGTATTTATCATTTTGATGATTGAGGCTTTT
TCTGAGTCAATTTCTGTTCTCAGAAATTGAAAATACAAGAAACTGGGCTGACACATTTTC
CCCAATCCTTTGCTCACAGATTTTGTTTTGCCATTTGTCTCGCAGCTGCATTGTAGACTA
AAGGGCAGCTAGTTGGTAACTTCAATGCAATACCTCACTGAAAGATAATAGAAAATCTGG
TATTTGTTTTTTAATCACTAGTTAGCTGCACCACTGACCCATCCTGAACATAAGTTTGTT
CATTTTATAAAATGGATGATTTCTCTTGTCCCACCTGCTTCATGGTGGGTGGTAGGCTGC
AGAGTCTTTTATAAATGATAAAGCTTAGTCAAATGTAAGGTATTATCATTTTCCTGGTCC
CATAAGGCTCTTGAGCATGTCTTGCCTAACCCCCTTTCCCAACAAGGATGCAGACCCAGA
GGGTCTGGGACTTCCTGCCATGAATCAGAATCATTGGCTAGAACTTGTCTACCCTCAGTA
CCAACACTGGCTAGAGGAATCTGATGCCTTTTAATTTTAATAGAGTTGCCTTTTATCATG
CATTACCTTGAAAAGCCCTGGAGTCCTTGTTCCTGGGATGGTGGCAGTCACCTGCGGGAG
GTAAGGTTTTCTCTTCTTGACTGAACTGTGTCTTTCTCTTGCAGCCGAGCGGGCCTTGGA
TACCATGAACTTTGATGTGATTAAGGGAAAGCCAATCCGGATCATGTGGTCTCAGAGGGA
TCCCTCTTTGAGAAAATCTGGTGTGGGGAACGTCTTCATCAAGAACCTGGACAAATCTAT
AGATAACAAGGCACTTTATGATACTTTCTCTGCTTTTGGAAACATTCTGTCCTGCAAGGT
AAACATTGATTAAATGATTTCAGCAGAATGATTATGGAATCCTGAAAACAAGACAAATGC
TAAATGGGGAACTGCCCTAGAATTGGGTGGCAGGGTATGGTTTTTCAAAATGCTGGGAAT
GGCTCTGAAGCCTAAGAGTTCCCTCTAGCTGGTCTCGTGCCACAACCCAGCATAACCAGC
AGGTGCTTCTGTGTCTTCGTTGATTCTTCCCTTTGCCTGAAATATCCTTCCTGTTTTCTA
GTTTTGGAAGGCATCAGAAGGTTTCTCTTTTGGGTGGGGGTGGAGAGGTGGGGGAGGAGA
GGACCAGAGCATGCCTCTGGTTTCCAGGAAGCTGTACTCAGTCATTTTGGAAGCATAAAT
TCACCCTCTTCCTTCTGTGCACCTGTTGATGTGGAGAATTTTGTACAACTTGTGTGGCAG
TGGTTTGCATGTCTGACTCCACACTAGACTGAAATTCTGTTGTGAGCTTGGAAAATGGTT
CATCTTTCTGCAGACCATGGTGTTGCTCCCAGATCACTAAATGTTTTTGAATGAAATAAG
AAAACATTTGGATAGAAGCAGCCTAATAATGGCTGCCGTCTGCTGTGCTACCTGTTAGAA
AAAGCTTAGCTGCTGTGGTCTTCTGCATTTTGACCATGGACAGGCTAGAGGCCTCAGAAC
AGGAGGCCCTGAGTAGGAGACCACGTGGTTCTCAACTCTGGAGCTGGCCAGTGGCACTAA
AGTGGCTGCCTTGTCTTTGACAGGTGGTGTGTGATGAGAACGGCTCTAAGGGTTATGCCT
TTGTCCACTTCGAGACCCAAGAGGCTGCCGACAAGGCCATCGAGAAGATGAACGGCATGC
TCCTCAATGACCGCAAAGTGTGAGTGTCCCAGTCTGGAGCAACAACCATCGCATGAGCCA
GCCGTGGCCCCACCTCGGTATTAACTGGCACACACAAGGCGGCTACTGGTTCTCTCGGCC
CAAGTGTGGCCTGCTCCTACCTCTCCACTCCAGGGCTGGTGAGTCTCCCTGCCCGAGCTG
TGGCAGCCCTTTTGACTCGCCAAGGTGGGCTTCCTGCCCAAGCCATGGCCTGCCTGCCGC
CTCTCCCTTAAAAGCATCCGTCCGTGGGTTTTGTGGGCATCAGCAACTGGGGCTGACTGG
AAGGCAGCTCCAAGCCCACTCTGAGCAGGGGTCTTGGCCAGCGGCAGAGTGGAGAGGGCC
CTGGACTGACCAGGAGCTGTATATTAGCTGTGTGACCTCGGCCTTCCTGTGACTCAGGTC
TGTCCGTGGGGTCACTCGCTAGAGGTTGATGCCAAATTGTCCCCAGATCTCCACTTGGCT
AACTTATGACTCAGTGGCTTTCTAATATAAGGCTGGCTCCACAGTAATACTTAATTTGGT
TACAATGAAAAAAATCTCATCTCATTGCAAAAGACACTATTCATAATAGACCTTGTTGCT
TTGATGTGGTTATGACAGAATAGAGAGGGGGATCTTAGCTAAGCCACGCAAGGAGAGCAG
AAGGGACAGTAAGACGTGGCTATCATAAGCAAAACTTATTTCTGTCCTTTGTGTTGTTGA
ACAGACCTTGGGATGGGTTGCATCGATCATGTGTATGTGCCCAGTGGTCAGGTCTTCCAA
AGAGATCACTAGAAAGAAATCTAAAGACTTTCGATGCATGGATACATTTTTCTATGAAGT
ATAAACAACACCAAAATGAGTAAACTGAAAAAGCAGAGGCCACCTCTTAGTTCACTTCAG
CAATCTCACTGCTAGGATTAACCACTGTTAACAGTTTGGTTTGTATCCTTCCAGACCTTT
TCTATGCATTTACATAGATGTACAGAAATGAACGTTTTAAAAACATGGTCATCAGGTTTC
TGCACGAAGGCAGTGTGATGTGGTAGGAGTAGCCCTGGTCTGAGCCAGGAGCCCTGGGGC
TGGTCCTTGCAGGACAGTCTTGCCTCTTTCTCTTTCTGCTGGGGAGTTGGGGCGTCTCTG
AGCTTGGTCTCCTGGTGGTTGGATGGGGACTCGTGTTTTAACCTCTCCTGTCAGCCTTTA
ACCTGCATTCCTTTGGGCCCCTGGAAATTGGGTTTTGTTCCTCTGGATGATCACTGTTTT
TCATGGTTTCCTTTTAGGTTTGTGGGCAGATTCAAGTCTCGAAAAGAGCGAGAAGCTGAG
CTTGGAGCCAAAGCCAAGGAATTCACCAATGTTTACATAAAAAACTTTGGGGAAGAGGTG
GATGATGAGAGTCTGAAAGAGCTATTCAGCCAGTTTGGTAAGTAGGGTCCTTTGCCCCAT
GTGTCCCCTTTCACTGTCCACCAGACCTGGAATTCATCTCTTTTTACTTATTTAAGATAT
GAGAGCACCCAGACTCAGAAGTAAAATATCTTGCATGACAGAGGTCACAGGGTAGATAGG
AATAGACTCCAGGCCTTGGCTCCTGGCTTCATCCTACCTTGTCCCATCCCCAAGGCCATC
TCAGCAGCTTGGTCAGAATTAGAAGGCCGGGCATGGTGCCGCTTTCTTAGAGTCCATCTG
GGTTCAACAATAGGTGTGTGTCAAGTGGGTTCCTAGAGAAGCCTTCGTTCCTTGAGCTGT
GGTAGAGTGGTGTTACTAATAGTTCTGTCCTTTGGTAATAGGTAAGACCCTAAGTGTCAA
GGTGATGAGAGATCCCAGTGGGAAATCCAAAGGATTTGGCTTTGTGAGTTATGAAAAACA
CGAGGATGCCAATAAGGTGAGAGTACCACAAGGTTGGGGAAAATTGGTAGGAAGTGGCCC
CAGAGTGTGTGCAGGGCCAGCACGTGGAGTGGAGCAGGAATTATCTGAGTATCTGTAGTG
ATGCAGTCACTGTGCTCTGGAATTGTCTTCTTGAGGGATATTTGACTGTTTTCAGAGCTC
TTGGCACATATCTGCCGCCTCAGCGGTTTTATCCTCTAGGTTGAAACAGGACAGATTTTT
GTTCCCATTCATAGGTGAGGGAGCTAAGGGCCACAGGGCTGCTAATAACAGCACAGCGGC
TACTTGTGGGTGAAGCTTTGTGCTAGGCCTTCAATGTATATCACTTAATACCCACAAGAG
AACCTGAGAAATTTAGTGACAGATTATCAAGCTGGGCTCGTGTCTACCATTCTTATATTT
GTACAGCTGTACTATTTTTTCCCTATATCATCTGGACCAGTATTACCCATTTAAATATTA
ACCCCACTTTACTGATAAGGAAGTTTGGATTTGCTGAGTTGGCTTCAGAGACAGAATGAA
ATTAGTTTTTAGCCCTGTAGGAAATATACTTTCAGAATATTTGGTGGGATTTACAGACCT
CAGAGCAAGTCCGCTGCCTCTTGATTTAAAGACATGTATTTCCTCTTTAGGCTGTGGAAG
AGATGAATGGAAAAGAAATCAGTGGGAAAGTCATTTTTGTAGGCCGTGCACAGAAGAAAG
TGGAACGGCAGGCTGAGTTAAAACGGAAATTTGAACAGCTGAAACAGGAGAGAATTAGTC
GATATCAGGTGAGAAGTGGTCTTGGCACAGCCTACCAGTAGGGTTTTACTGTGAAATATT
TGCAAAGCGCCTTATGTTTAGTAGGCTTTCTCTTTGGGGACTTGAACTCTGCTCTTCCTC
TCATTTCTACAAAGATCATTAAGTTTAAAAGGATATACCTACAAGATACAGCAGTGATTC
TAGAACAAGGACAAGAGATTGATTTGTTCATTTAGGGACTCTGTTCTGGCAACATCAGTC
TGTTCTTAGTCGTGTAGGGTTCTTTTACTTAAGTGATACCCCTTCATTTGGAATGGCAGC
AAGGAGAACCCTGCCAGTGTGAGCAGTCAGCCAGAGCAGCTGTGAGGAGGATGGCTATGG
CGCGTGACTTACATCGATGGCTCCTATCAGAGTCTTAAGGCAGTCATCTCTCAGCTTTGA
GCCGCCAGCAGAATCCCCTGCGGGGCTTGTTAAAACACGGATTGCTGGGCCCTAGAGTTT
GATGTATTAGGTTTGGGTTCTGGCCTGAGAATTTCCATTTCTAACAAGTACCCAAAGATG
CCAATGCTGCTGGTCTGGGGACCACACTTTGAGATCCTGTCTTAGAGAATATATGGGGTA
TATTGAGGTGTAATTAATAGTGATTCTTTTGCTTCAGGGGGTAAATCTCTACATTAAGAA
CCTGGATGACACCATTGATGATGAGAAGTTAAGGAAAGAGTTTTCTCCTTTTGGATCGAT
CACCAGTGCTAAGGTATTTTATACTGAGATTTTGGGATCAAAAGCAGAAGTAGTTATCAT
TTGGAGCTTTATTGACATTCTTTCTCTGAGGGAATAGGATCTAAATTGTGTTTATTTCTG
AGTGTATCTGCCACATTATTCTAGTAAATTCCTCCTGGCATTCAGTTACCCGTCTGAGTG
TGTCCTCTGGAGGATGCCTTTCATTAGGTTAATATTGCACTGTCTCCCCAGCACTGGGGT
ATGGCGATGAATCTGACCCTGTCCTCCCTGCTGACCCTCCAGAGCACCTGAATCTTTCCC
ATTCTTTGCTGCTTTGTGCTGGTGTGGGGACAGATGGTGCTACAGTATGAGCAGAGGAAA
TCCAGACGGGTTGTTTTCCATTTGTCTTGGGGCCTGTCTCTACAACTCTGCCACACTCTC
TCCTTGAAGGAAGATATTTTGAGGACTTTGGGACTGGGGTTGGGAACTTCCATCCTGGTT
TTATAAAGGAGGAAAGGGGATCAGGAATTTGGTTTTTCCGTGTTTTACAATGTGCATCAT
TTGCTTGGTTTTCTTTGAAAATCGTATCAACTGAGTTAGGGTGAGTAAGTATGAACCCCA
TTTTAAAGATAAAGAATTTGAGTCCTTGAGCAAGAGAATGCTGGTCACATGAGGATGGTG
TACTGCGTGTCCTTAGTGCTTTGGGAGGGAACTGATGACATCTGAAAGTTTTGGGTCATA
GCTGATACAAATGCTAGCCCTGCTCAGCAGAGGTGCAGCAGATGTCACAGCATCTTCTGG
TCATGAGACAGGAGGCCAAGTGGGCCAATAAAGACTTGGCGAGGGGCTGGCCTGGTGGTA
CAGTGGTTAAGTGCGCACGTTCCACTTCGGCGGCCTGGAGTTCACTGGTTCGGATCCCGG
GTGCGGACATGGCACTGCTTTGGCACGCCATGCTGTGGCAGGCATCCCACATATAAAGTA
GAGGAAGATGGGCACGGATGTTAACTCAGGGCCAGTCTTCCTCAGCAAAAAGAGGAGGCT
TGGCAGCAGTTAGCTCAGGGCTAATCTTCCTCAAAAAAAAAAGACTTAGTGGCCCTGCCC
TGGCCCTTAGCTTAAGTTACGCACAGCCTTGGAGCATTATCAGTCGTAGCAGGGAGTTGG
CCAGGGTCCACCCCATGGAGTTTCCCGCTTCCTGGCCCCTTCTCTCTCATCTCCCCTTTG
TCTGGCCTCCGTCAGTGTGAGGAATAATAGTCTCTCCTACCAGCAGAGTAGTCAAGTTGG
CATGTGCAAGAAGAGAGCAAAAGAACCGTATCTTGAAGTTTCACAGGCACCATTTTCAAG
ATCATGATGTCACTTATTTTTCACACACCTTACTGGCCCACCTCATTGGTAGAGTTGTTG
CGTTGATACACATCTTGACTTCCATGTCCTCCACTTCAGAAGGCTCTCCAGACAGTGAGC
TAAAACACAAAAAGGTGCCAAGCACCCCTAGTTATGTTGCTACCGACGCTTCTGAGGAGG
TAGGCCAGAGAAAGCAATCAATAACCTTTTTAGGTAAGAAAAAAGCCATTTGTGAATGAC
TTAACTGTATGTGGAAAGACTGCCTGAACCAGTACACATGTGGCTTTGTAGCTGTTTGCC
TTAGAGTGTGTCATGGACGTGAGGCTCAGAGAGGGCAAGCAAGTGATGTGTCAGGTTGGA
TAGCCTAGACGTGGCAGGGCTGGAACTAGACTCTAGCTGCCTTTCTCCCCACTGGTCGTC
CTGCTATGTTATTCCCATTGAATTAATGGTGGCAGTCAGTGTTTTATAACTCCTTCCCCA
CATGTGCTTCGAAAGCATATCCTAACCCTGGTAAGAGCTTACTGAAGTTTTGTTCACCAA
GACATTGGGCAGATGAGGTCTACAAATAAATTGCTTGACGCTGCCGTCCAGATGGCTTTT
GGGATTCAGAGATAGCTGTGCTTCTGGGTGTTAGGAAGCACCTTTGGGTTCCTGGTTTAA
CCATTTAGCCGTGTCGTAGGGTTTGGGAACTTTCAAGCACCTGGGGATCTAACAAAGAAA
ATGCCTTGGTCCTTCCCTTAGTGGCTGTGGCTTAATTGGTCTGGGGTACATCCTGGGACA
GGGCTGAGAACCCCTGACCCAGACTTGGTAACTCTTGCAGCAGAACCCAGGTTTTCTGGC
TCTTAATAGTTGCCCCTCCCTCTCCCCCCAAACACACAGACACCTTTGTCTTAAGTAGCT
GGTCTCCTCTTGTAGGTAATGCTGGAGGATGGGAGAAGCAAAGGGTTCGGCTTTGTCTGC
TTCTCATCTCCGGAAGAGGCAACTAAAGCAGTCACTGAAATGAATGGACGCATCGTGGGC
TCCAAGCCACTGTATGTTGCCCTGGCCCAGAGGAAGGAAGAGAGAAAGGCTCACCTGACC
AACCAGTATATGCAGCGAGTAGCTGGGATGAGAGCACTCCCTGCCAATGCCATCTTAAAT
CAGTTCCAGCCTGCAGCTGGTGGCTACTTCGTGCCAGCAGTTCCACAGGTGGGTCTGCTG
TGTGTTCATGGCCCTTCAGAGCCTGCCCACTGACAGCTGCTCCTGCAGTCTGCAGTGGTC
GGGGAGAGGGCTTTTTGGATATCAGAGTTCTAGAATGTCCGTGTAGAGACCCTTCCAGTA
AAATGAGGAAGGACTTATTCGTGGTCACATACACACAGTGGTAGGTGTAGAGTAAAAGAA
TCCCCAGTAACTGACCCCGTCAGCTTTTGAGTAGAGAGCAGCTCTGTCCCACACAGATAG
CATAGGGCCTGGAAGTGAGGTGAGATGAGCTAGTTCTCTAATGTGGGTTCCAGTCCTTAA
AGTAAAAGGGCTTGGCTGCGCTTTCTTACAGGCTCAGGGAAGACCTCCATATTATACACC
TAACCAGTTAGCACAGATGAGGCCTAATCCACGCTGGCAGCAAGGTGGGAGACCTCAAGG
TAGGTGGTGGGGAATGGTCATGTGATCGCCCAGGATATACCTGTCCTGGCCTCCCCCGCC
CCTCCTCCCTGTCCCCTGGGAGGCACAGCCTAGGTTCTGCTCCACATTGTTCATCAGTGA
TGTGCAACCTCTGTCTTTCACCAGGCTTCCAAGGAATGCCAAGTGCTATACGCCAATCTG
GGCCTCGTCCAACTCTTCGCCATCTGGCTCCAACTGGTAATGCTCCGGCCTCTCGTGGCC
TCCCTACTACCGCTCAGAGAGTCGGTGAGCAAACTGGCCTTGAGAAGCGTGGCCCGGGGA
GGAGGGAGTCAGGACGACTAGGCTCTGCCCAGGGTTGGTCAGTTTGTTGAGCTCATCATG
TTTTTTGAGTCCTGGTTGTGTAATCTCAGCTGTGTGCTTAGGTAGGTACTTATGGAGCAG
AGAAACAATATAAATTCTAGGAGTATTTCTTTTAAGATTCTTTTCTCATCGGTGACTCAT
GTGAAAAAGGTTAGTTGTAGAAGTTTGTTGAATGACTACAGAGGCAGCCTGTTCTTTTGG
GTGGGGTTGGAAGATAGAAGGAAACTTTTTTACAGAATATGTCTTGTATTCCGAGTGGTG
GAAAGAGTTGTATGTTATCTGTTGGCTGCTCCTTGAAAGTAGCAGTAGTTGCCCCATGTG
TGATGTGTTGTGAACGTGCTTTGGAATTGCTCCTTCCGTGGGACGTGGCCAGTTGGACAT
CTGCTGCCAACACTGATGTGCATTTGCTGGTCTGTTGTAGGGTCTGAGTGCCCGGACCGC
TTGGCTATGGACTTTGGTGGGGCTGGTGCCGCCCAGCAAGGGCTGACTGACAGCTGCCAG
TCTGGAGGTGGTATTGGATGCACACAGAACGGGGAAAGATGGGATTTGACGGGCCTTTGC
CCAGGCTGATGGGCTTTAATTTTATTTGTTATTTTCCTAAGGTGTTCCCACAGCTGTGCA
GAACTTAGCACCTCGTGCTGCTGTTGCTGCCGCTGCCCCTCGGGCTGTTGCACCTTACAA
ATACGCATCCAGTGTCCGCAGCCCTCACCCTGCCATACAGCCTCTGCAGGTGAGGTCCAC
CAAACAGAATGCTAAGAGGATTTTCCCTGTTTCCGTGTGATTGAAAAGATGCCTTGCTTT
GCTTCCTTCCACAGGTATTAAATACCTGCTCTATGTCAGGGTGCCATGTCCTGTGCGGTG
ACACTGCCCTTGCAGGGGCTTTGTAGTGGGAGAGAGGGGTTTGAAATTGTTCTTCCTGAT
AACAGTTTACTCAGAAGTGCCCCAGAGGAGACAGCCAGTGCTTTTCTCCTTTTTACATGT
GTGCTCACTCAGCTTTTTGAGCTTTTCACATCCTCTGGCCTAGTTGATCCTTCGCTACTC
TGCAAGATCATTGGTACATTAAGGCAGGAGAGAACTTCATCTTATAGATGAGAAGTTCAG
CTTCCGACTTAAGTTGGGGTGGGGAGTTGGAACCAGATCTCAGATTTTCTAAGATGGAAC
TTGTTATCTCTAGAGCTGTTTCCCTCAGGCAAGCTAAGATACAAGTAGTTTATTGCAAAG
CTCAGTGGCAGTTTGCCTGGAGGAACCACACTCAGCCTTGTGGTCCGTAAACTGCTTTGT
AAGTGGGAGATTTCCTGGAACTTGATTCTCTGTGAAGTATTTTCTTCCTAGAAGGCCCTA
CTTTTAGGGCTGTGACTGGCATTGACATTACATGTTGACAGTTATCAGGCCTTTGATACA
ATAAAGACATTTGGTACAATAAAGGTAATGTGGGATGTAATTATAAGTGTTTTGGTATTT
ATACCCTTTGACCCAGTCTCTACTGGGAATTCACTCTAAAGGAAAATGGTAACTTTCAGG
AAAGGGCTACATGTACGAATGTTCACTGCACCTTATTTATTAACAAGGCTTCAAATTCTT
GGGTAACCTTGGGTAAATTATGACCATTATAACTTGAGTAAATTAAAATTAATTGATAGA
TGGTTGTCAAGCGTTTTAGGTTTTTCTTATTCGTTTTCCTTTCCTTTGAATAGCATGCCA
TTTTACTATAGTTGGTAAACTACATGACTCTCTTCCTCACCTGACCCCCTCAAACCCCCA
AGACTGAAAGTAGTTCCTTGACAGCAAGGACATCCACCTCCATCTCCTCTTTCATATGGT
AGACTTTCAGATGTTAAGTGGTCAGGCTCTTGATCACCGTCAAGTGTCCTTTCCTTGGTG
CTGACCCGTTGCTTCTGGTTCCCAGGCACCCCAGCCGGCGGTCCACGTGCAGGGGCAGGA
GCCCCTGACCGCCTCCATGCTGGCTGCAGCACCCCCCCAGGAACAGAAGCAGATGCTGGG
TGAGTGACCCACGTGCTTGCGGAAGAGGGGGCCAGAGCCTGGTACTGACCTGGACACCAG
GTCCACTCTTTACTGGGATTTCACCTGCTTTTTAATGAAATCTCTTCCCACAGGAGAACG
TTTGTTCCCGCTCATACAGACCATGCATTCAAACCTGGCTGGAAAGATTACAGGGATGCT
GCTGGAGATCGACAACTCTGAGCTGCTGCACATGCTAGAGTCCCCTGAGTCGCTCCGCTC
CAAGGTGAGCTGCTTCTCTGACCCTGGGGCTTTCGCTCACTCAGCTCGGGAGGACGAGGG
GCGGCCTCGCACACCAGGGAGCAGCAGAGAGAAGGGTCTGCTGCCCCATGACCTTCTCGG
GCCTCGCCTATGATTTGAGGGCTGCTGGGGTGTGGTATTTGGGAAAGTGGTCGGCACCAG
AGAGGGGTGGGAGGGGCTCTCCTCAGATATCACTGAGCCCCTGGAGATTTCTCACAGGTG
GATGAAGCTGTGGCGGTTCTGCAGGCTCATCACGCCAAGAAGGAAGCTGCCCAGAAGGTG
GGCGCTGTCACTGCTGCTACCTCCTAGACAAGGAAAAACCGTATGTTTGGCTATTCTTGT
TTTCTGCAATGGTTTTGACTTGCAAATATCTTCCTAAAAGATTAGGGGCTGTGTACAGAA
CCATGTTTCTGCCACTTAACCTGGTAACTTGGGCAGGCTGGCACCTGGATTTTTTTCCTG
TCATCTAGGTGAGTTAATATGGAGAAGAGAGGAGTACAGGTTGTAAATTATAAGGAGCAA
ACGACAAGAGCACCTGGTTGGATCTTTCTCAGGAATCACCTTGTTGGTCTGGAATAATGA
CGGATATATAAGGCGTTGTCATAATCACATCCCACAGCCTTATTTCTATGAGCATCTCCC
TGGTTTGGCTTGAGGTTGGTGAGGTTAGCTGTGTGTGCAGCTACTGCTTAGCTCTGGGAA
CACAGCAGGCCACAGGCCTTGGTGTCAAAGGGGGAGAGACAGTCACATCTGACTACAGTT
TCAGTGTGAGTGTTGCAGTTGACTTCTGGACTTGGGGGCCATGACATCTGTCTGCAGGGA
CTTGGGTGACTGAAGCTTAACTAGGACTTGTGGCAAGAACTGGTGGGTGCTTCCAGATGG
AGAGAGGGAACCAAATGAGCAGAGGCAAGGAGAAAGAGCATGTGGTAAGGGCCAGAGCTG
GTGTGTTGGTAGGGGTTGATTGGCATAGCCATGGCCCCTTGTCAAGGGTCTGAGCCCTGT
CATTTGGAGCTTAAGCAAGAAAACCACAGAAGCTTTGAGTACAGGATACCCAGGAACGGT
GGAGGGGGGAGCTTTATAGACAGTAGTTAGCCTCAGAAGTCAGTTGTTTTTAATCAGGGG
TGCCCCCGCAGGGGACATTTGCTAATGTCTAGAGACATTTTGGTTGTCACAGTTGGGATT
GTGTTACTGGCATTTAGTGGGTAGAGGCCAGGGATGCTGCTAAACATCCTGGGATGCACA
GGACAACCCTAATGGAATTATCTGGGCCAAAAGTCAGTAAGCACTGAAGTTGAGAAACTC
TGCTCTATAATTCCTTCTTTTATCAGCCAGAGATTTCAGTGAATCCCTGAGGGTCTTTTG
ATTATGTATGTGTGTTGATACTTTTCTTTTCAGGATTTCAAAGCCAAATAACCCCTTAAT
GGAATTCAGCTCAAGGTTTGAAGACTTCCTAGCTTGTCCTATGGACCTCAACACCACGAA
CCACAAATTGCAAATTTAATAGGTCATTTTGTATCAAAAGGTCAATTATGAAGCACCTAG
AATTTTTCAATTAAGAGAATATATTCTCTGGGTTCTGCCATGGCCCAGACAGTGTTAACG
TTTTTTTTTTTTTCTATTGTGGGTTTTGATTTTTTCCCCCCAGAAATTGGTTTTATTTGA
TGTACCCAAGTCTTAAGTTTCTCAATAAAGAAAAAAACCTCCATAAAACTGCCTCTGTCT
TATGTTTTCCTCTGACCACCATTTTATTCTATAAATTCCAGTTTTTACTGGAAGTAAGTT
TAGGATGTAGAGTCAAATGAAGTTCTGTATAGTTTATCGTCCTTTCCTGATGGTTATAAG
CAGACTATTTTGTGTTAGTAAGGTGTGCAGAACTGTCTCACTGCATTCTGTTGTGGGAGG
ACCCTTATATTGGGAACAGAAAAGACCTTGAGTCTGGCACAGGAAAGCTGGGGTACAGGG
TGGGGTTGACGTGTTGCAAGGATGTATGGTGAGAGATGCAGAACCTGGCCTCTCCTGTCT
TGGACTGTGTTGGTTGGGGTCTCAGTCCCCTCTCTTTCTTACTGCCAATTTATCCTGCAA
GCAAGTCAGCATATCCAGTTGCCCAGATTCTGCAACTAAGCTTTCCTGTGGCAATGGGAA
AAGGCTCAGGAGATAGGTCTGAGTGACAGTAGCGAACAAGTGCTGAAGTCCTAAGGGTTT
TGTGTCCCTTTAGACCTGAAAACGACCATAATCTGGCCAAGGTCACCCAGTCGACTTGCC
CTCCCTGCCCTCCAGCAGCACTTCCTTTTTCCCTTTCTCGAAACTTGGCAGGCTGTCCTT
CCTCCGGGCCTTACCCAGGTGTCCCTTTCCCTGGAATGTTCTCCCCTGGTTCTTGCCTCT
TGGCCGGCTCCCCCTTTTCCTTAAGGGTCTAGTCTCACCTTAAGTAACTGATCTAAAGGC
CCAGTCTAAAGTAGATTCCCCTGTTTCCTGACGGCCGCGGTTCATGCGACCGTGGACTGT
TTATTTTCTTTTAACGCCCGGCTGCCCCGCGCCCCACGCCCCGCAGCGCCCAGGCGGTGC
GGGCGTCTGCGCCTTCGGCCGAGGGGGCAGGGAGGGGGCGGGGCCCGGCTGCTGGCTTCC
GGCGGAAGAGCTGAGAGCAAGATGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1193, 3944..4137, 4883..4998, 6257..6396, 6761..6855, 7490..7627, 8257..8352, 10575..10847, 11191..11278, 11424..11543, 12040..12126, 12221..12348, 13525..13618, 13733..13863, 14097..14199, 15273..15524
1001..1193, 3944..4137, 4883..4998, 6257..6396, 6761..6855, 7490..7627, 8257..8352, 10575..10847, 11191..11278, 11424..11543, 12040..12126, 12221..12348, 13525..13618, 13733..13863, 14097..14183
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved