Equus_caballus Locus ENSECAG00000015089
snOPY snoRNA Orthological Gene Database
Equus_caballus ENSECAG00000015089
Equus_caballus
ENSECAG00000015089
2
SNORD46, SNORD38, SNORD38
1375..1478, 2294..2363, 2899..2967
4288
TCTAGAAGGATAACCAGACATGAACGTCCAGCTGCTGGCCATTCCCACTTACATGAGTC
ACCAAATCTCAAAAAGAACATGTTCAGAACAGCTCCTACCTTAGCCTACCCCATCTCAGT
AAATGGCATCAATATTCATCCAACTGATCAAGAGAGGAATTAGGAATCTTTGACACACCT
GCCTCTCCCTAAACCCCCACGTCCACACTATCACCGAACCCTTAAACCAAAACCCAAGTC
CCGCACTGGTTTACGTCCCCGCTGCCTTCCACCCTTTCCAGCGCGCCCGCAGCTCTCATC
CTGGACGACAGCAAGAGCTTCTAAAACAAGGCTTTTCAAAGCGTAAAGAAGGCCAGGCTG
CCCCCTCGGCTGCATCCCACGGCTGTGCAGCTCAGCCGACAGCCGCCGACCCCGCGGGAC
TCGCCCTCCCAGCGCCTCCCCAGGGCTCCGGCGCTCAGAGGACGCCCCGGCCCCGCGGGC
CCCGAACGCCACCGCAGAAACTTAAGTGAGGCGCCCGGAAATACGTCAAGGGGGCGGGAC
GGCCGTTTACAAACCGGGCCGTGACGCGCTGCGTTTTCTCTTTCCAGCCGGCGCCGAGCG
ATGGGTGAGTGGCGCTCTGCGCGGGGCGCGGGGGAGCGAGGCGAGCTCCATCCGCGGGCA
TCCGGCCTCGCGGGCAAGCTAGGAGTGCGGGCGCCCCGAGCCCCCGGCTGCCTGCAGCCC
CGAGGCGGGCGGGGCTCGGGTTTTGGCCCCGAGGCCCGCTCCGGAGGGTGCCGGGGCTGC
GGCGGCCCGCGGCCCCAACATGGCTGCCGCGGGAAAGGGTCCGGGCCGGGCCGCACGTGG
ATGATGACACCTTAGTGATGCTGTGGACTGCCGAGTGCGCAGTGGGGACGCCAACCTTGG
AGAGCTGAGCGTGCGGCCTGCCCGGCGCGGGGGTCGGGGGCTGGCTAGGCGACCGCCCCG
GGTCCTGGTGGCTCAAACGTCCGCCCCCGCTCCCACATACAGGCATCTCTCGGGACAACT
GGCACAAGCGCCGCAAGACCGGGGGCAAGAGAAAGCCCTACCACAAGAAGCGGAAGTATG
AGCTGGGCCGGCCCGCGGCCAACACGAAGGTGCGTGCAGGGCCTCTGCCCGGGGGCGACC
CCTGCTCTGCGTGTGGTCTCTGCGTCTTTGTCGGCTCTGTGACTTGTTATGGGGACTGGG
TGGCCTCCTCACTTGGACTTTTTGGGGTTCTCCTAAAGAGACTGCACGGAGACGTGCTGT
GTCCGAGGACCCGAAGGGCGCCTGCAGGACGCGGCTGCTCACGTGAGAGTCAGAAGCCTC
TTGCATGGAGACTTAATTCGCAGTGTCTGGAATCGGGTTTTTCTCTGTCGGAGGTGACTA
GAGTGATGAAAAAGTATCCTTAGGTGTGGTTGTGGCCGTCTTGGTCACCTCTGTGCCACT
TGCCAATGCTAGGACTTGTCATAGTTACACTGACTGTCGCCTCCCGCCGGCCCAGGTTCC
TTTCCCTCTCGTCCTGCTCTCCTGGGTCACCGAGCTCCTGTCTCCTTGTGTTTTCCAGAT
TGGCCCCCGCCGCATACACACAGTCCGCGTGCGGGGAGGCAACAAGAAGTACCGGGCCTT
GAGGTTGGACGTGGGGAACTTCTCCTGGGGCTCCGAGTGTGAGTGAGGCTCTGCGGGAGT
GGGTGGGAATTCAGCGCCTAAACCTTTCTAAGCTTCAGTGAGCGCTTTTAGCAGGAAGTC
CATGGTCCTCCAGCAAGATATTGAAGTGTCTCCTTGTTGAAAGACCTTGAGGTTGTGGTC
GCTGGAGAGTTCTCTCCATCCTGTCCTGTCTCTGAACTCCTACAGGGATTGGGGTTGAAT
CTAGAGACTATGTTTGTGTGGTCGCCAGCCACCTCTGGAAAGATGGGTTTGTGGGAGATG
AGCTGATGCCCCTTGGCTGGGTAAAGGCTTAAGAGTTCTCCGTCCCTTAGGCCCTACCAG
GACGGGGGAGGGGGAGCAAGGCCAGCTGGCCTCGGGCTTATCTGACTTGACTTCTGAATT
TCTCCTGTGAACAGGCTGTACGCGCAAAACAAGGATTATTGATGTTGTCTACAATGCATC
CAACAACGAATTGGTCCGCACCAAGACCCTGGTGAAGAACTGCATCGTGCTGGTTGACAG
CACACCGTACCGACAGTGGTACGAGTCCCACTACGCACTGCCCCTGGGCCGCAAGAAGGG
GGCCAAGCTGGTGCGTGCTTGGGGGCCAGCTTCCTGCAGGGGTGTGGGTGTGGGTGCCAG
CCTGATCCCAGCTGCCTTGTGATGAAAACTGTCCAGTTCTGCTGCTGAAGGGGGAGAGAT
GAAAGCCTTTAGTGCTGACGAAGGCGGCCAGGGGTTGGGGTGCGTGGGGTTCCAGGCTGC
GATGACGTTCCCGTCCCTGACCTGGGGCTTGGGGAGCCCTAGCTAACCCACTTGTATCTG
CTTTGTTCAGACTCCTGAGGAGGAAGAAATTTTAAATAAAAAACGCTCAAAGAAAATTCA
GAAGAAATACGATGAAAGGAAAAAGAATGCTAAAATCAGCAGTCTCCTGGAGGAGCAGTT
CCAGCAGGGCAAGCTTCTCGGTGAGATGGCTGCTGCATTGCGGGGAGAGGGGGTCCCGAG
ACGAGCTGTGCCCTCTGCCTTTTTTTTTTTTTTTCACCTTTGCCTCAGTTCTTTTGACTG
CCAGCCATGTGGTCTAGAGGGTTCTACCAGGAGGGTTTAATGATAATAGCATACCAGCAC
AAATCAGAACGTTCGGTCACCCCGTCAGTGTTAAACTGAAATGGGAAATGGTGGGCAGGA
GTCCATAGGCCTGAGCTTGGCCTGTGCCTCTGAGTTTCAAGAGTATTTTGAGAAGCCTGT
GCCCGGGCTGAGGGGGCTGTCTCAGTGATGAAAACTTTGTCCAGTTCTGCTGCTGACTTG
AAGTGATGATAAAGTCTATCTGAGAAGACAGTGGGCTTCATGCCTGTCCCCAGGATACCT
GAAGCAATGTGGACTTCTAAGGGGATCCATAGGTCTGGGGAGGGCCGCATTGTCATTTTA
CTCTCTTGCAGCATGTATCGCTTCCAGACCAGGCCAGTGTGGCCGAGCAGACGGCTATGT
GCTCGAGGGCAAGGAGCTGGAGTTCTATCTGAGGAAAATCAAGGCCCGGAAAGGCAAATA
AGTCCCTCTGGTCCTAGCTCACATAATAAAGGGGTTTGTTGTTCTCTGTCCTGTGTTATG
TCGTCTGAACGTTCGCTCGGCACACTGGAGTCCCCAACTCCCTCTCCCTGAAGGCCAGGC
CTGTTGTGTGTTTCTGTAGCAGGGGGAACATTTCTCACCCTAAGAGCTCGTTTTCAGGCC
GAGCAGAGACTGTATGAAGGAGGTATCCCAGAAGTGGGGCCCCCAGCAACATTGGGCTGT
TGGCTGGACCATGATTGGAACCTGAAGCCACACTGCCTCTGTGAAGGTGGCTCTTTTAGA
GATCCTGTACCCTTATGCGGACCTTGGTTCTAAGGGTTTGGTTCAGTTTTCAGCCTGGGT
TCGTGGATGGTCTGGAAACGTTGGAATTGGGTTCCTGCATTGTTGAGAGCAAGTTAAATA
CATGTTTACATAGCCATGTCGTGTCAGCTTTTGGTTTTTTCTTGAACCCTACTCCTTTCC
CCCCTAATCACTCATAAACAATTAAGATTACCAGTGATATTGCTACATCTCCAAGGGTCA
GGTATCTTCAACTAAGCTACATTGTTGTCTTTCGGCATGTGAATGTGGTTTATGCTCCGT
CTTTCTAACGTTAGCCTAGACCTCCTTGACACCTGCACTTGGATATCTGAAAGCTCAGCA
TGTTCAAAACTGATCACATTCTTCTTTCCCTTTTCAAACACTTTCTCACCAATTCGATGA
CAGCCAATAGTCTTCTTGCAACTGTGCTGAAATCAAACTCTTGGGTCTTTCTCAGCTTTA
TTCTTCTACTCCCATATCTAATGGCACCAAGATCTTGTTGATTCAACCCCTTTTTTTTTT
CCCCCAACCTTTAACACCACCTCTCCCATTCTGGTCACTTTTTTGCATCCTAGTTGCTCT
CAAGGCTGCTTCTGTTGCCCCCAATGCAATCCCAGCAATTAGTGGTCATTTTAAAAGATC
AGATTTTTGACATGAGAGCTTCCCACCCCAAAATCCTTAGCAAACTTTTTCCATAGTGAT
CACCTTGGCCTTAATGAACACATGCTCACTTGCTGTTCTCTTCCTTTTTTTCCCCCCTGC
TTTATTTCCCAACCCCCCAGTACACAGTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1108, 1558..1657, 2054..2229, 2470..2599, 3071..3288
1049..1108, 1558..1657, 2054..2229, 2470..2599, 3071..3177
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved