Equus_caballus Locus ENSECAG00000012597
snOPY snoRNA Orthological Gene Database
Equus_caballus ENSECAG00000012597
Equus_caballus
ENSECAG00000012597
24
SNORA28
2780..2905
6555
CGGGGCTGAGTCAGGCTAATGCTGCATTGTGAATCATTACCCGTGCGGGCGGGGCGGGG
CGGCCCGGGCCGCGCCCTCGGCCGGTTTCGTTTCCCCCCGCCCACTTCTGCGCTCGCGGA
GGCCGGGCGGCGCACATGGCGGGGCTGCCGCGGCCCGGTCCACCCGCCGCCGCGGAGCCC
TCGCGAGGGTGCGCCTCCGCAGCCCCGCCTCGCAGGTGGTGCCGGGTCGGCCTTTACACA
CCGGAACGGAACGCCCGGTGGCCATGGGGACGGGAGCGAAGGTTAACTGTGTTTGCGTAG
GGGAGAGAAAGGGAGGAGAGGTCGAGGTCGGGTCTTGGGCGATCCTCGAACGCACTCTGC
TCACTCCAACAAGATAATGTTCCGGTGTATTATGAGAGTGGTTTTTTTTTTTTATTTTTG
AAGTAAGCATTTGTTGCCTAAGTAACAGTTTGGTTATTTTTAAAGGACGATTTCTGTAGT
TTTCTGTCTCAAAATGATGGCTACTATGGGAGGGGGAGAGTATTTGAGAAGTGTTTTTGG
TAGTACGGGCTCGGTTTGGGAGAGAAGTCATGTGTTCATTTTCCAGCCGTTAAAATATGG
GTACTTCACCGAAGCACACCGTTGACATGCCGACTGTCTTTGGTCTGATGGAAACTCACA
GTAGCTGAAGCAGCAGACTTTGGTTTTTTGAGTCAGGCATCTCCCAATCGGAGTCACGTC
TTAGTCAAAATGGAGGCCTTTTATGTTGCTACAGGTGTCTTGTGTTATATGGGAATACTA
GCTATTTTTCACATGAACTGAGATACATTTTAACACCGGAGAACTCGAAATAATTAACAA
GAACGCGAAGGGAGGCGTTTCCATGCAGGAATTATGTTAAATATATTGGGGTTGTGTGTC
CTGCTTTCTTTTTCAGAGCTGTTGCGCAGCCATTGGTACCTGTATTGGGGAAACATAGCA
TACAAGCAAGAAGCTTACAGCCTCAGTGGCGAAAATTTTTTCATGTCAGAGACCGAGAAC
TCTTGCAGTCGTTTATGTCATCCCTTCTTCTCCAGACAGAAGATACCAAAAAGTTGCAAT
CAAAGATCTCTTCATCTTATTGATAAAGCCACTAATAAGCCAAAATGTCTGTCAACGTCA
ACCGCAGCGTGTCAGACCAGTTCTATCGCTACAAGATGCCCCGTCTGATTGCCAAGGTAA
TACTGATGGTCATTGTAATAGCAAGTCCTAAGTTCTTTTAGCGATTGCATCTCCTGGGGT
GGACAGTGGAAAATTAAAATTCTTATTTCTTTTAGGTTGAGGGCAAAGGAAATGGAATCA
AGACCGTTATAGTCAACATGGTTGACGTTGCAAAGGCGCTTAATCGGCCTCCAACGTGTA
AGTAATGGGTCTTAGAGAAGTCTGAAGAGATATTTTAGCGATATAGTCTAGATGATCTTT
GATTTATTGCCATTAGTACATGTAAGTACCCGAGCAACACATTTTTTAATCCAGTAATTT
GGAAACAGTGATGCTTGCATAAGTGTGGATGTGTAGCTAAAGATTAATTTAGATAACTAA
CGAATCAAACCATTTTTTTAAATAGATCCCACCAAATATTTTGGTTGTGAGCTGGGAGCA
CAGACCCAGTTTGATGTTAAGAATGACCGTTACATTGTCAATGGATCTCATGAGGCGAAT
AAGCTGCAAGACATGTTGGATGGATTCATTAAAAAATTTGTTCTCTGTCCTGAGTGTGAG
AATCCTGAAACGGATCTGGTGAGTGCCTTTGAAGTTTCTGTCAACAGGGAAAAAAAGTAT
ATCTGCTTTTCTGATTAGTCTTGTGATATCGCCAAATCGTGTTCCTGAGAATGCAGAGCA
GACTGAATTGGAAATAAAACACAGAAGCTCAAATTTGAGATGTTTCCATACTGACTCTAA
TTGGTTTTTTGGTTTTTTTTTTTTTTTTTTTTTTAGATTTTATTTTTTCCTTTTTCTCCC
CAAAGCCCCCTGGTACATAGTTGTGTATTTTTAGTTGTGGGTCCTTCCAGTTGTGCCACA
TGGAACGCCGCCTCAGCGTGGACTGATGAGCGGTGCCATGTCCGCGCCCAGGATCCAACC
CAGTGAAACTGGGCCGCTGAAGCGGAGTGTGAACTTAAGCACTCGGCAACAGGGCTGGCC
CCTCTAATTGTTTTTTTAAAGTAGATTACTTTGTGAAAGAACATTCTTTTGTCTGTTAAG
CTGGTGTTTTAGGGGTCTTCTGATGGTTAGATCACACTATGTTCTTCACAGACTTTTTAT
CATATATTATGGATGACATACTTGTTTTTACTTTTTTGGCAGCATGTCAATCCAAAGAAG
CAAACAATAGGTAATTCTTGTAAAGCCTGTGGCTATCGAGGCATGCTTGACACACATCAT
AAACTCTGCACATTCATTCTCAAAAACCCACCTGGTAAGTCTTCATGATGAATTTCTGAG
GTCTTAAAGCAACTGATTGTTGGAAACAAAATAGTTTCTTTGTTGCTATGAAAGTGGAAT
ATAATACTTATAATCTTTGTATCATTTTATCAAATCTGACTTCATTGAGAGATGTACCGT
TAAAGGTGAAAAACAGGCTGCCGATTAAACTCTCTACCATACCATCAATTTTTAAGACAT
GCTAATTAGGGTGGATGAAATAGGTATTGTAGAGTAGAATGTGTGATGGGATCCCGACAG
AGAATCTGCATCTAGAATACTGTGTTGTAAGCGGGGCGGGGGCTTGGCTGGTTAAGTATG
GAGAGCTCTTAGAGAACTGCAAGCAACACTCTGTGGCAGATGATTGAAAATGTCTGACAC
AATTTGAGCTTGCTATAGCAAGAAAGTCTAACCTATTCCGGTGTTCTCTTCTCCGTGAGA
CGAGCCGTTATATAGACTCAAACAGTGTTCTAGCTATTGGCTGAAGTACTTGCTGAAATA
TGCTCTTGTTCAAGTTCGTGAGGGATGGAGGAAGAGGGTCTTGAGTGCCAATCTTACCCA
GCTACCTAGTCTTTTGAGGTATCACTGCTTCATCGTAGTCTAACCAAATTGTTAATGCTA
CCATATTTTGGGAGGCTCCCTTCTTAGTCTCAGTTTCTTACCTATGAAGGTACAGTGAAT
GAATTTGGTCTGTGAGTCTTGAGTTAGGGGTAATGTTGTGTTTGAATGTGGTGTCTGAGT
GGAGGGTTTTGAAGCAAAATGGCCGGGCTTCAGATGTTCTGGCAAACAGTGTGGTGTAAA
ATAAGCCATGGTACTAAACTTTTACTTCCCTTCTGTTTCTGATAGAGAATAGTGACAGTG
GTACAGGAAAGAAAGAAAAGGAAAAGAAAAATAGAAAGGGCAAAGACAAGGAAAATGGCT
CCGTGTCCAGCAGTGAGACGCCGCCGCCGCCGCCGCCAAATGAAATCAGTCCTCCTCCAC
ATGCTGTGGTGAGTGCACGGTTGATGGTATGGTAGGCACCAAAATTGTGTAAAATATGTT
TGGTTGAGGTAGGCAGAACTTCAAGGTAACATTGCGAACTTAACCGCTCGGCCACAGGGC
CAGCCCCTGAGTGTTTTTGTTTTTATAAACAGGAAGAAGAGGAGGATGATGACTGGGGAG
AAGATACAACTGAAGAAGCTCAAAGGCGCAGAATGGATGAAATCAGTGACCACGCAAAAG
TTTTGACGCTAAGTGATGATTTGGAAAGGACTGTTGAAGAACGGGTCAACATTCTGTTTG
ATTTTGTTAAGGTAAAACATTTGTTTCAAGAACGGTTCAACATTTTCTTGACTGATAAAT
CACCTTCGTGCCAGCTTTGGGCTTTTGGCTAGATATGTTACTTTAAGCTGGGTACTTGAT
AGCTTTAGAGCGAAATGTGCCTCTTATTTCACTGAATTGTTTGCTTTCGTTTGCAGAAAA
AGAAAGAAGAGGGTATTATTGACTCGTCTGACAAAGAAATTGTTGCTGAAGCAGAAAGAC
TGGATGTAAAAGCTATGGGCCCTCTTGTTTTGACTGAAGTTCTTTTTAATGAGAAGATTA
GAGAACAAATTAAGAAATACAGGCGCCATTTTCTAAGAGTAAGCAAATTGTTTTACGTTC
ATACATGAGATTAGAGCTGTGTGAGCTTGGAAACAAGCAGCACTTTCTCGCTGCTGCTTT
TGTCATCCTGAAAATGGAGATAACTGACCTTCCATGTATGTAAGTATCTGAAAAATGTTG
TGCATAGTCCCTTATGGATAAAGTAACACAGAGGTCTTTGTGTATTGACCTTTTTGAACC
ACTGTTTTGGGGCCACAACCTTAATGAACAATCCTAAGGCAATGAATATACTTGGATATT
AGAATTGTCAACTTAAAACGTCTAAAAAGCTTGTTAACGCCAAGATAATCTATTTGCAGT
TTTGTCACAACAACAAAAAGGCTCAGCGGTACCTTCTTCATGGTTTGGAGTGTGTGGTAG
CAATGCATCAAGCTCAGCTAATCTCCAAGATTCCACATATCTTGAAGGAGATGTATGATG
CAGACCTTTTGGAAGAAGAGGTCATCATCAGCTGGTCAGAAAAGGTGGGGAATGTATCAA
CAATTTGCTCTTCAAGATCAAAGGTATTGAGACAGCTGTTGGGCTTCTTTGGAAGAAGTA
CCTTAATACTGAGTCACTTCTGTCTACATTAGAATACAGCCCCTGTGCTTGACTGGTATA
ATTTGTAGGTGATTCCTACCATGTCAGCCTTCTAGTAATAACTGTTGAGACTCCTTAATA
TTCGTTTGCCGAATTATGAATACGTTTTTTGTTGAGGTTTTAAGATTAGGATGTGACCCA
GTTCCCTCGAAGAACTCAGTATGGGCCGTTAGTAGATAACTCAAATTATTTTTTAGATTC
TTCGAACTAAGAAAATTGTACTGAACACTTTTTAGGCCTCTAAGAAATATGTCTCAAAAG
AACTTGCCAAAGAGATTCGTGTCAAAGCAGAACCATTTATTAAATGGTTAAAGGAAGCAG
AGGAGGAATCTTCTGGTGGTGAAGATGATGATGAAGACGAGAATATTGAGGTAAACAGTG
GGGAGAGTATTGAATACTGTGTTAATGATGGGTATTTGAGAATTGTAAAACAGCAATCTT
GGGTCGTTTCAAATTTAAAATTTTCAGGTTCAATAAAATACAGTCTCAATAATTTGGAAA
ATCATATTAATAGGATGGTAGAAATCTCTCCTACCCCCAGACATTATGATTCCAAATAAA
TTTTGTCTGAGTTCCCAAAGGTTTAATTAATGCAAGTGAAGTAGAGGGTGCTGGTAATCT
GTAAAAATGAATAAGATACTGTTGGGCTATGGAGAGGTTTTAGTTTTTAAGTAACAAAAA
CTGTGACATGAAGAATGATAGCTGTGTCAAAGTAATTTTTCTTCTTTGTTGATCATTAAT
TTATATTGCTATTTTTATAAGCAGATTTATTGGGATAAAGGTTTGTGATAACATTTGTTT
TGTCAGGTGGTGTATTCAAAGACTGCCAGTGTACCGAAAGTTGAAGCTGTGAAGTCTGAC
AACAAGGATGATGACATTGATATTGATGCCATTTAAGGGGTGGGTGCAGCCCAGCTTAAC
TAGAATGCTGCGAATCTTTCTGCGTCATCAGCCAGAAGTGCAACATGTATGTGTAAAAGC
TAAAATAGCTTAACATCATGCTACACTTTCTACTAAAAATGTATTGCTGTGAGTGGTCTG
TAATTAAGCCCAACGAGACATCTAGGGAGTCCATACACATACCAGTGAGCAGATATAGTT
TGCTTATTTATAGCATGTTTCTTTTTGAAAAATTAGTGGTGGACACATTTGGATCACATT
TATACAGTTATGAAAATAAAGATTTGATTTTGGTCATTCTTCAGATTTTTGGCTCTGAAT
GACTTAAGCTGAAGTAATTGGCTCCTTTAAGAAATGTTGCACCATCATTCAACCTGAGGA
TTCTTGGAGCCTGTTAGATATTGTTAGGTGCTGAGGTTGTAATGAGGTCTTTAGCAGAAT
GTAAACTTAAACTTATTTGTAATTACTTTATTCAGCTGTTAAGAAATATAGTACTTAGAG
GTTTTATGTCTCGTCCCTCACATTGGCATCTGGTAGGTTGCATTCTTCCCATGCCAAGGT
GAACTGATAATTAAATGACAGTGCAACACCTTTATCTTACAAACAGTAAAAAATGACTTG
AGTGTCCTATAAATAATTTTGAGAGCAGGTTTTGAAACTTGAATTGTGTTCTTTCAGTCC
ATGTACACTTGGCCCAAATTGTAGTCTTTGAAGTCATGTGCATTGCACGTTGGATGAGCC
AGGGGAATTATTACATTAACAAATAAGCATTTTATGTGTATGTAGCTGTTGCTTTGTACT
GGGAGAAAACTCTCTAACTTCGGGGTGTGATTGAATACTAAACTATAAGATTTTATTTAG
GGTAAGGAGGAAAGGGTGCACTTAATCTCTAGTAAAAACTGAGCATAATTTTTCACCTTT
TACGGTTTAAATTACAATTTGAAAATGTTAAGACATTGTATCTTTTGTTCAGTGGATTTA
CCCTGATACTGTGGTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1195, 1295..1376, 1585..1757, 2322..2433, 3285..3427, 3572..3730, 3896..4057, 4379..4543, 4895..5029, 5466..5555
1124..1195, 1295..1376, 1585..1757, 2322..2433, 3285..3427, 3572..3730, 3896..4057, 4379..4543, 4895..5029, 5466..5552
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved