Equus_caballus Locus FAM49B
snOPY snoRNA Orthological Gene Database
Equus_caballus FAM49B
Equus_caballus
FAM49B
9
SNORA25
10001..10125
33466
TGGCATGGGTAATCTCATTAAGGTGCTAACCAGGGACATAGACCACAATGCAGCACATT
TTTTCTTGGACTTTGAAAGTAAGTCTCTTTAGCCCTTCACAGCTGGTGCATAATGGTAAA
GGTGAAAGATAATTATACTCACACCGCAGTGAAGGCCAGCCAGAATATTTGTTAATAAAA
TATGGGGATCAAACAAAGTTTGCATGATTTTTTTCTTAATCATAGGCAAACATCACCATC
ATATGTATAATTCTTTAGTTTTTCATTTGCTAAAATCATGTTGAGTCTGTAGCCAGTGCT
GTCCTTTCATTAGTCCATGAAGCAAGTAGCCTTATGATGAACATTCTAATAGTATGCCTT
AGTGACTCTGCCTAGCAATCTGTTTGCTTATAATCCGATGATAATTATATAAAAAATCAG
AATTGTGCTGCGTATCCAGAATCACTACTTTAAATAACCTCTACAAATTATTAATAATCC
AAATTTGGTTAGAAATATATGCTCTATTTAATGGCATACAGGCAGTAAGTTTAATATTTT
GCTATTTTAGCGTGAAATGCAAAGGTGAGCTGCGGCCAAAGTCTTAATATTTGGCTTTGA
AATAAATTGTTGTTTCAGTGCAATATGAGGATTACATGTGAATAATTATTGATCAGAAAT
TTCTTTTTCAGAAGACTAGCACTATTGGAATACTTACAGAATTTTTCATTATAAGGCCAT
TAATGAAACTTGTCTTGGGAGAATTTTGAGAAGAATTAGACCAACAGTTGTGCCATTGTG
TGCAGAAAATCCACATTTCACCTCTAGGTCCTACATATCAACACCTTGAGAACCCGGTTT
GCTGTCTGCCAGAGCACAGTCTGGGTAACCTGAAGGACGAATTCATGGCCTAATGAACAT
TTTCCCTGTTATTATTTTCTAAAAAAAATAAATTTCAAATGTTCTTTTTTATAAAGGGAT
ATTTTCTCTTTTCTCATTCTTGTCTTGACAGGTACCTTAACATGGGGAATCTTCTTAAAG
TTTTGACATGCACAGACCTTGAGCAGGGGCCAAATTTTTTCCTTGATTTTGAAAGTGAGA
AGATGATTTTATATCTATTTCTCTTTGCCTGCAGTAGACTGCGTTTGTCTTGCACTAAAT
GAATGTTTCCACTTTGCCATCTTTTTAACTGCTTTGCATGACTGAGCTATGAATTGTTTG
AGTAAAATTTCTGGTGCCTTTTAGAACTGGAAGTCATATTCTGTAGACTAAATTGTGATA
AAATGTTTTTACTTGAATTTTTTTGAGATTCATATCTGTTGGACATTATAATTTGAGATC
TCTAATGAAAACATTTGAGATTCTCTAATGAAAATATTCTTATGAAAAAATTTTGATGGA
AAAGACAAATGCTACTTCAAGATTTGTTAATAGAGGCACTATTTGGGGGAAAATTTATTG
CAACTGAGAAAAATTGACTAGGTTTCACTTACTCTGTGTACCTATTGAAGTATTTTAAAT
ACAAATCTGTTCATGAAGGCCATTCAAAGCTCAGTAATTTGGGCATAATATTAAAAGGTA
AGTGTGAACCTGAATTATTTAATCTTTGCAGATAATTTGAAAAGTGGAGAAATTCATTAT
ATGCATTTATTTCAGGAATTCATTTTTTTCTAACTCTAAATAAAAAGAAAAATAATGGGT
TCACAGACCTTTAAGTAATTTGCCTTCTGTTTGTTTTATGTTGCATGACCTATTGTAATA
TGGTCTAAGAGTGGCAGGTAAGTGTCATTGACCCTCGTGCATGTTGAAAAGCTTTTGCTT
TTTTGGCTGTCAGTATTGCTTTAGCTTGTCTGGTTGTCAAATTGAGGACAATGATATTAA
ATTGGTGTTTTAGTGTGAATGTTGCTGTTTTAACTGATCATAAGAAAATTGTTAGGAAAG
GGTGAAGAGATAGCCCTGAAGTTATAAATCATGTGGTCCCTTGGATTTTTATCTGAGATT
AAAACATTTCAACAAATTTTCAAATACTTAAAATTTAAGACCTTTTCTGGTTTTAAAAAC
AAAATAAAGAAATTCCTTAAAATAAGTTCCCAGAAAGTCATTACATTTTTCATCAACTTC
AATTTAGTTTATGTGATATTATACAATTCATTCTATTTTATGAATAATTTAATGTATTTT
TTCTTTAAACCAGGACAATTCATATGAACACATCAATTTATAGCTGATCTCCATTTTATG
AAATAATTTGGTCTCTGATATTTTTCTACTTTGATTATGTTTCTATAAGTGTTCTGTTAT
AGTTTGGGTACTGTGTGTAGACTAGTAATAGTAATGTCAATATCAGGACCATATTAAATT
GTTGGGTTTTTAGGGGAAAATGTTATTTAAATGAATATTTTCTTGACCCTTCGCAACAAT
TTAACCGGGCTATTTTAAGTGCATGTTTAGCATGAATTTTAATCAGCTTGGGGATGTTGA
GCAGATTGCTGACTTGAAGATTATCCTTTCAGATGAGGCAGCTTACATTAGAGCTATACT
TTAGTTTATTTGCGTCTGTTTCAATCTTGGTCTTGTATATCTTTCTGCTCTTCTGTCTCC
TTTTTACTCTTTGTCTCAAATTCTTTACATTTGCAGAATCTTGGCTTTGATATAGTCAAG
ATCTTGTTCAAGACTTGGCACTTGATCTTTTTATAAATGTAGCATTATTTTGTGGTCAAG
TGAGAAGCATGAATTTACTGTAGTATTTAAAATATTATTTTGTCTTGGTTTACCAATCTG
TGGGGGTTTGGATCATTATCCTTAAAATTTAAATAGGTAATTTAGTGGCAGGAAAAGGTT
AAAATTGCTAACTGCACCAACAATAGCCACAATGAAGATCCATATATAAAGTGTTAACTT
CTTAATGGCAGATATAAATTAAAAAATGGTATTTGTTGACTGTATCAGCCAATGTAGAAC
TTTTGAGTTGACACTTACTGGTATACTGTAAATGAAATTCAGTGCAAACACACTATATGT
AGACAAGAGTTTGCCCACTATTATTTCTTATTTAGATTTTTAAATGTTTGCTTTTGAGTC
TGACATTAGAGTTCTCTTAATCAATTTTACCTCTCATCTGGATATTTGCATATTTGTCTT
TTTGGAAATATGCATTTGTGAAAGTTTACCTTATCATTAGGCTACTGTAGTGACTTTAGC
CCATCAGGTGGGTCCTCTCTTAAACTGTTTTATACCAGACTCAAAATGCGAATACAATTA
ATTTGCCAGTTCCTTATGATTACTGAGAATAAAGGCACATCTCTCATTAAATAGAGTACT
TAGTACTTAATTGTTTATTTTTAGATGAACAGTGATATTCAGGTTACCAGAGTAATTTAG
TTTTACTGTTTCCGTCACTCTAATTGGTTAAATCTGGCTTATTGTGTCTCCATGGTTGGG
CAACTATAGAAATAATTCCATACAGATAGATATACTGGCATTTTGTATTAAGCTATATAC
AAATTAACTATCCTAGTAAATTTAAAACATGATTTAATGGAATCTTGTAGTTTACAAAAT
GAAGATTATATCTTTAAAGTAAATTATTACTCGCGTAATTTATGCACAGTCACACACGTG
TACTGTTTTTCACTTCAGTTCAACATACATTAATGGCTTGCCTCCTGTATGCCAGCCAGT
GGGAGGTGAGGATGCAAAGATAACTAAGAAACAACCCCTGCCTTTGGGGAGTTGTCAGTC
TAGAAGGATAGATAGAAATGCAAACGAGTAATTTCCTTTGCATAATTTACTTTCAAGATT
TAGATCAGGAAGGGATTAACTTTACCTAGTAGTGAGTAGATTGGGCAGCACAGAAGACTT
TCGGGTGGTGACATTTGAGTTGGGTGTGGATTAGAATAGTTCAGGCTAATTTAGTGAAGG
ACATTGTAGAAAGAAGTAACAACATGTACAAAGGCTTAAGGCGTGAAATGACATTCTGTG
TTCAATGAAACATACTGTTAGCTACTCTTGAGGTGCTAGAAAGAGGGTCTTTTCCTTAAA
ACCAGTTGCACCTATATGATAAGATTTTATTTTAAGAATAATGATTCAATTAAAATATAA
GGCCAAAACTACCCCATAAAATTTGGCAGCGGTTAAGCTGATGAAGTTATATAAAAAGCA
CTGAATTGGGGCCTATATATCCTCTTCTAGTTCTTGGAATTATTTTATGACATTGTTAAT
TTATAGCTCTTTCTGATGACAAATCTTTAGCCTGAGTAACTACTATGTCTATTAGTTCAC
TAAATTGTGGTTCTCGGGAGAAGAGGGACTACCGTTTATTCTCGTGTCCCTTCCCAGTCG
TGGCATAGTGCTTTGTAAACGAAAGTAGTTCGGTATTTGTTAGTTCACCTTGATTTGCTT
ATCTCCAGGTAGACCAAAATAGAAAAGTAAATGTAGGTGGTCATTTGTAAATGAGAAATA
GAATCTTACTTTCTTTGACTCTTTGTATAGTGCCTTTCCATTTAGTCATACATTTCCTCT
AATTCTTGTGTCTTTTATGTTACCTGTTTCCCCCATCTTTAAAAATATTGATACTCACTC
CTTTAGTCTAACTTTATTTTCCCATTTTTACCTCTTGCCTAGTTTAGGTTGTTTGTGCCC
TGTACTTTGAAATATCTTTATTCTGGTGGCATTTTCTTATATTTATTTTTCTAAAATGAT
ATAGGATTATATTTTTCAGAGATAAAAATACATAATAGCCTCCTTTAACTCATGCTGGAG
CATATTTATATCTCTATACCTTCTCATTCATTCAACAAGTATTTATTGTAAGAAGTCTAC
TAAGTACTGAGTTTATAGTGTAGTGGTTTGTACTGTACGTTGAGGTCCCTGCCTCGATGA
AACTTACGGAGATAGATCGTAAACATTTACTGAATGAATGAAAGCAAGATTAAAGCAGAA
AAAACACTTTTCACAATTATAATTTTTATGTGACTTGGTTTTTATTATTTTCCTTTTGTA
GCTGATCTTTGCCCCCATTTGTACCATAACAGCATCAATTTTAGCAGTTATTTTCAGTGA
CTCTTCCATAGGAAACTGGGGGAAATTATTAAAATATTTAATTTTACCTTCAAACAGTAA
GCACAACTGAAATATGCTTTGATTTCCCTTGAACAGTTTTTTCAACTAAGCTTGATGAGA
AATCAGTCATTCTACTCTCAGTAGTAGATACATTATTTTGCAATCAAATGAGTGTCCTTT
TGGTAGCTGGCTAAGTGGTACATTTTTCTTCAAGTAATAAAATTTTTCGTTCTTTACTAT
GAAAAATCAAAGTGACAAGTCTTGTTTGCATTATATAATATCATTTTTTGAAAAAAATGC
TTTATTCTGTATAGCCTTTTGCCCTCCCTAGTATCACCCTTTTGCATGACTTGCTATCAG
TAAAGTAGTGCTTACCTGTCTGCTATTTTCTGTTTGTCTTCATTTCTATAGCAGTCTTCA
GCAGCTTTCAAAATTTTAAATGTGACTTTTCTGTGACAGTCTAAAAAATGTTTAATCAGT
GTGGTGCTGGGTGTTTTTTCCACCCTTAGGGGAAACTGGAATTTTCTCCTTTATTTTAAA
TTTCTTGGTACTTATTAAACCTTAAATAATTATTAACCACTTCCAAGGTCTATCTAAACC
TCCCTGATAATGTTTCTTTTGTACGTAAGTCTCAGTGTCACATTTTTCCGTTAACAACTA
GTCACCACATCAAAAATATGTAGTTTAGTATTTTTAAACTTCACACATATCTTTTGATAT
ATAATAGTCAAAATATTGTCCTTTGTCATGAATTCCCACTTCATGAATTCAAACTATGAT
ATGTGTCTACTATTGATGTTATGTCTGTAGTTTCACAATTCCATAAGAAAAAGTATAAAA
CTGCTGTTATTGCATGTAAAATGTATTTTTCTCTACTGCATCTGGTGTAAGTATAAAAGT
TATGAGGTATACTTTTTAAAGCGTCTGTCTAACTATTACTTTGGAGAATACGATCTGGCT
AAATGTGAGAAAATATTACTGCTGAATGATAAACCCTGATTTTTAAAGAACCATTTAGCT
ACAATATCAGTATTTGCTCCTAGTAATACCTTTATGGCTTTGGACACAGAGTCTTTTTAA
TTTTTCAGTTGGCTCCTCTTGTGTAATTATTTTGTCATAGTATTTTCATTAAAAAAGAAA
AGACACATGATTTCTGAAAGGAAATTTGAAAAATACGGGAACAGATATGAGAACACAAAA
TCTTAAGTCGATTTTGCATGTAAATGTTACTTTATTATTGTTGCCATAGTACTGTTTTAA
ATATGTTGAATTTAAAATTTGATACCGTAATTGTTAATTTAAAAAAGTCTATATTTTTTA
CTAATTGGCAGGTTGTTAGGTGGAATTGAATTATGACGTGACCAAGCACAAATAAAGTTA
CAGATTTTAGGCATGTTGACTTCTAGTTTCATGTGTGAACTAAGTTTCTTTAGATTTTCT
AAGGAGAGGAGGAAATAGATCATTGTGTATTTGTAGAGAGGAAAGGAGCCCTGCAGAAAA
ATCTAGGTACTAATTTTATATGATTGGGTAAAGAGATTTATCAGAAATTTTGTAAATTCA
GTTTATAAATTTGATCTGCCTCCCCCAGCCCCAGAAGGGAAAATGTTAGCATAGAGGTGT
TCTGCCAGCATAATCTCTCTCTAAAACATTACGCTAATGGTAATGTTTATCATTTTAAGT
GCTTCCTGCCTTATCTCTGATACTGAATGTGGTCTTTGAAAGATTTATGAAAAACTCAAT
TTCCTCATGAAGCTCCCATTTCTCCCTCCAAAAAATAATCAAATGTATTAAATAAAAAGA
TTTATCCTTAGAGAAGCAAATGACCAAGTTAATAAAAGCAAGATTTCTGTTACCTCGAGG
CTGGCAGAGAGAAATCCAGATTTAATCATCTATTAACCTCTGTTTTGTGGCTAACACCAC
AGGTGGTGGAAATGCCCATATGTTTGTGTATCTGATTATGCTTTTTATAACTATGATTCT
TGCTTCATTTTTCTCTCACTCAATCTCAAGTATATAACAACTCAGTTTTTGCTTTAGTAT
TTCAAAATTTCCGTGGATAGTATTGTAGCTTAAAGTGTCTAGTTTTCAGCAGCTTAGTAA
TTCTGGAGCAGTTTCATGATTGAACTCCTCTGCACAGCAGTCTTGCCCTGGTGTTAAGCA
GCAGAGTTCATTGGTACAGGATTTAGAGTGGTCCCTAGAAGAGGGGAGCATGTGAACACT
CTTCTTTTAAAACAGTTCTTCATTATTTATATCAAAGGTCAGTCATTAAAGTGAACCTTA
TGGGGAAAAAAGTAGTTTCGATCTTAAACCATAGGTGAGCAAGATAATATTAATCAGCCT
TTCATTTCTGTAGTATTAAAATAGCTCATTACTAATGCGTTTGCAGTCATTTTGATAGTG
ATGAATGTAGTAGAAAAGGTGATTAACATGATCACAATTTAAATTTTGAATTATAATTCT
CAAGTTTATTTAATATACCAAGTCATGATTTGTAATTTAAAAAAATAACGTTTGGTGTTC
CTTTGCTTCTTTGTGATATTTACAAACTTGAGGCTAATTATTCAGATGTAGAATTGTGGA
AAAGTTATTGATCTTTTCTAAGAAGTGCAAAGTTAACATTGAAGAAAATGTTAGTCATCT
TTAGAAATTTGGATTGTTAATTGCTTAGAGTTATACATGTAGTAAAAAAATCACGTGACT
GTAAGTTTTCTTGTGCTTTCCTGCTGTTTAGATGCCCAGCCTACAGAGTCTGAGAAGGAA
ATTTATAATCAGGTGAATGTAGTTTTAAAAGATGCAGAAGGCATCTTGGAGGACTTGCAG
TCGTATAGAGGAGCTGGCCATGAAATACGAGAGGTAAAGCATAAACATTTTCTGATAAAC
TAAAACTCACTGTGTCCCTCTTGTTTTTAATCTCTGTTGTTTCCTATACTTTAGAACTCT
CTGTTGCGTATTAAGTATTATATTTAAAGGAAGATCACTTGCGTTATTTCAAAAGTGGTT
GCAGTGGTATAAGGGTAACAGGAAAACAATGTTCTATAAATAGGTAATTTATATATATTA
AAGAAAAATTTATTCTTTTGGTTGTTCTCACACCTGAAATTTATAGTATCCATGGCGGAC
TATATTGTACTTTTTTTGGAGGAGAGGCGAGAACATAGCTCTGTGGCTTTTTGTTCTGCC
AGTCTATTTTTTGTGCTTCTCCTAAGCTTCCTAGGAGAAAGCTGAAATCATCTTTGCAGT
TTGGACTCCTCTAACCCTGTCTCACGACTTTACAGCACAGACCAAATGTTGGTGTGGTCT
CCCTCAATTTTCTTCTCCCAAACCTCTGAGCTCATCCAGATTTCCATCTGTCTCTTTTCC
CATTTCTTCTGTTTTTTCAGAAGAAGCTATGTCCCTACTTCTTACCAAGTCTAACTTCTC
TACCTTTGTTCTCCCTCCTACTCTGGAACTTTACTCTTCTAATTATTCCTTCTCTTAATC
ATGTCTTCTATCTTTTTTCTTTTATTGACTTCTTCCCCTCAGTGTGTACACCTACTCAGG
TGTCCTATCCTACCCAAGGAAACTCCCTGGCCTCTGGACCTTCTCTTTCTCTCTTATTAC
CACATTTCCTGAGGGCATAGCCAACACTTTGTTTCTTCATTTTCCCTCACCCTTCTGCTT
CTATTATTCTTCTCCATAAAATAGAACAAAAGTTATCAAGGATGAATCTGGTGGATTGAC
AATCTATATCCAACCTCATTCCTCTAATGATATTTGGAGTATAGTGAAGGCAGAATTAAG
TACAGGCACCAGAAGATGATGATTCAAGAAATGTTTTGGACTAAGGGGACACAGGTTTTC
GTGACTGACTGGATGTTTAATATAAAGGAGAAGGGGAGGTTAAGTGATTCTGTGGTTTCT
AGTTTAGGTGAGCAGTTGGTGATCCATTAAGTGAGGGAAATTTTAGATAATGTGAATTCC
ATTTTTCACCTCTCCTGCACTGGATTGCTTGTTCCCTGAATGTCTTGCACACATACACTT
CCTTGCCTTTGTTTTTGTCTGGAATATGCCCTTCCTTGTTTCTTTTCCTGTTCAATTCCT
AGCCTTCTTTCAAATCCCGAAAATCTCCTGCTTCCCCCTTCCTCTTTTGCCCTAGCAATT
TGCACACGTTTCTTTTATGGTAGCCATCACTTTTTTTTTTTAAACCGCTGATATTTGACG
TTTCTCTTTCCACCACTGTGCCTCCAACTTGAGGAGGGTGAACCTGGTCTCTGACTAATT
TTTGTGTTATCAGCACCTGGTGCAGTGCTTGTAAGCAGTTAGCGGCTGTTGAAGAAATAA
AGACAACAGCTTTACACTAATCTTGTCAACATCATTAGCTTAGGTAAAACCTTAACATCT
CAGTAAAGCAAGGCATGTAACAATTTCTGTGGAATTCAAGTTCTCTGAACATTTAAACAT
ACTTTGAAAAATAAAACGTTTATGGAAAGTAAAGGTTTAAATGATCAAGCAGGATCTTAA
TTTACTAATTGGTAAATTCTTCTTTCCCTATAAGTCACACCAATTCACAAGTTGTTCTAA
AAATGTTTCATAGTGTCTCTAAGTTAAGTGTTAGTGCTAAAAATTATTTTTCAATTGTTC
ATCAGTGTTATATCATTAAACTTCTTTAAAGTTTGTGTTATAAATGAGTTCTTATCATCT
GGTTATACTTATCTCCCATAAACAATAAAGAAAAAATAATCTCGTTCATTATAGAGACAA
ACACCATTACTTATTTGATTTTTTTTTTTTAAGTGGAACTCTTAGGATTTGTAAAAATCT
TCCCAAGTGGTAGAAGGGTTACTCTGCTTATGTGTGGGAAGGCTCACTATAATAAAAAAT
AGTGTTTTCCCCAAAGTCTTTATATTAACTTAATTGAGTACATATTAAGATTTAGTTGTA
ATCTTCTAGAAGAGAATAAAATAACAGAAAAGTTTATGTATAGGTCATTTCAAAGAGGGC
TTATGGAGCTGTGAAACCAGGAGCTCTTAACGCTATGACCAAAGATTGAGTTCTCCATAG
GATGCCAGTCAGTCAGTAGTGCTGTGTTTCCTGAGGAGATACAAAATGTGGCAACATATA
GTTCATTCACAGTATTCCTAGATTGGACATGTGAGAAAGTAAATTAAGGTCTCAAAGTTA
AAAAAAAAAAAGTTTGTATAGAAAAATAACACTGAAGAACACTGAAACATAACAGGAGAA
TAAAAATCAATGGTAAGAGATTCACCTTATCAGGCTTTGAGAATTATTACAAAGATCTCA
CCATTAAACAGTTGGGTAAAGGAATTAAGGACAGAAAAATAGGTAAATAAAATATGTGAG
CTAGAAACTCGTGTTAAAAAACAATTTAAATCTTTGATAGATGAGGGATAAATGTGTATT
AAAGCAGTTGAAGAAATTTTCACTGAGGAAAGCATATCATTTTTTGGGCTTATCTGTAAA
CAGAAAGATTTCTGAATAGTAGAAAAACAATTTAAATTAAGAAAGGAAGGTACAAATAAA
AGCAGAAGATATATAAAATATGCAAAGAACAGATAACACCCCCGTATGTGTCACAGGTCA
GTGTAGAGAGTTAATAGACTTGGTAGAACAACCTTTCTACCTATGAAAATGCACAGACAA
TAGAGGATGTTCAGATTTGCTCCTAAGTGCCTATCGCTGTCAGGTTTTACTGCACATAAT
GATAAATTGTTAAAAGCTCAAAATTGGTTAGTTTATGAAGAAACAGGTTGTCCTAATTAA
TGCAAGTGGTATTGTAAAATGGTTGTCCTTTTGGAGGTCAGTTTGGCAATGTGTAAAATA
AGATCTATAAAATTATTTGTACTCTTGCACCAGATATTTAACATTTTAGAAAATATTCTC
AGAAATCACACAACTAGAATATGCAACTATGTACCAGGGGGCTTTGGGGAGAAGAAGGGA
AAAAAAAAAAAAGATTGGCAACAGATGTTAGCGCACGTGCCAATCTTTAAAAAAAAAATT
CTCTGAAAGACTACCATTCAAGAGGAAGATAAATGTAAAAAATTTTATGGCCACTTTATT
CATGGTAGTAAAAATGTGAAAGTAACTCATAGAAGTATTTTGAGGATAAAGTTAGATATT
CCATGAAGAAAGCATAGCACAGTGCCTGACATGTAGAACATACATTGAGTTTACCATTAT
CACTATGCTAATGATGTGGAATGAGATATATTTTGTTTAAATAGCATTTTGTTAAACATG
ACTCTAAAATAGAATAAAAGTTAAGATAGAATCTATTAAATAAATAAAGCTTATTCTCTA
GGATAAAACACTAGAGAGAGAATGAGAACTTTCCACGAATGTTTTGTAATATCCATAACA
GTTGTAACAGCTTTGAAAGTGAGAGAATACTGCTCCACGACGACGTTACCATTGACATTT
ACTAAGTGCCCTTTGCATGCTGGTCTATAAGGGGTGCTGTACCAAAAACAGTATCAAACA
GCAGTCAAACTGGTGTGAAAGGAGAATGAACCAGAATTAAAAAGAACCATAAAATGTTGT
CATAAAAGAGCAGCCAGTGTCTTCAGTTCTAAATCCAGGCAAGACAGAGCCAGGGAAATA
GTTAACTCTACTAAGGTATGAAAATAGGTGGCATTTGCTAGAGTATTTTGATATGGCATG
AGTAGATATTTAGAAAATCATTTTTAGATCCTTGTGAGAAAAGTTGGATAGGCTTCTCAA
GAGAGGAACATTAAAAAATTTTTCTGTTTGCTTATTTCCTGAATAATAAATAAAATAAAC
AGATTTTTACTACTTGATATAAAACGTTGCTGAGGCTGGGCTTGAGGCTAAAAGGAGTTT
TTTTATATACATCAGGACAATAGCACAGTCCCTTTGAAATATTCAGTTTAGCTTGTTTGA
AGATGTTAGAGAAAGCAAGCCAGGTTGTTGAAGAAAGCCTTGTTTCATAAAGGATTAAGA
AAAGCATCTGTAAGAAAAAGGAAGATGAAAGCAAGAAAATATATTTGGGGAGCAACCGTC
TGTGTTCACAAAAGATTACCTATGGTTTGAAAGACCAGGCAAAGAAAGAGGCATATTCAT
GTTCATATTAGAGTATCTAGATTGTTTCATTTTCTCCCATTTCTGATTTGAAATTAGTTT
TTCTTCATCTTATTCAGGAAAGCCTAAGAAAATTTGGATTCCAGAATAGGATTTTAGTTA
TAGGGAATAAGAATCTTTGACAATTTCTACGTCACATTTTTTAGGTTGATTTAGGTTCTT
AAGTGTTTGGTAGGTTTTTTAAAACTAGTTTGGACCCTACAATTTGAAGTATTGAAAGTT
TCTTGGCCTGTTCCGAGAGTTGGCGTCTTGTTTCATTTATTGCCTTACTTTTTTGGTTGC
CTTTTATTCCACTAAAATAATTCTTAGAGAACTACTAAGAAAGTCTGTCTGTGATATGGG
AAACAATATAAAGTTGTTTCTTTTTGTGACTCTAAAAGTATCAAAGCATATTTAACGAAC
ATAGAGTGTGTCGTTTTTTATTCCGTTATATCCATATCCATTGCAAGGGTGACTAAGAGT
GTGTTATAGCAGGTTTAAAGTAGCCACAGAGGGGCCGGCCCGGTGGCGCAGCGGTAAAGT
TCGCATGTTCCACTTCTCGGCGGCCCGGGGTTCGCCGGTTCGGATCCCAGGTGTGGACAT
GGCAGCGCTTGGCAAAAACCATGCTGTGGTAGGCGTCCTACAGATAAAGTAGAGGAAGAT
GGGCACGGATGTTAGCTCAGGGCCACTCTTCCTCAGCAAAAAGAGGAGGATTGGCNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAGTTAGCGCAGGGCTAATCTTTC
TCAAAAACAAAATAAAATAAAGTAGCCATGGAGTTGCGAAGCTGAGCATCCCTGGGTCCA
TTATTCCTTACTTTATAGATTATTACCAGGGTTTCCTCCATTTGCCGAAACCTGTATTTT
AATGTAAAAATAACGTTGTGATTTTTTAAAATCTAACTATTTTTATTCTTTGGATTTTGA
AGGCAATCCAGCATCCAGCAGATGAGAAGTTGCAAGAGAAGGCATGGGGTGCAGTTGTTC
CACTAGTAGGCAAATTAAAGAAATTTTATGAATTTTCTCAGAGGTTAGGTAAGTTGAAAG
TTTTGTAATTACTTCTCTAGTGAAAAAGACATTTATTGACACCAGAACTTATTTAGAGTA
TTTTGTGTTCACATTGCTAAATTTATGTTACATAGGTAAGGCCAGTTTGTTAGACTATAA
GGTTTTAGCATAATCGTCTTACCATCCTTATGAACCCAGGTCTTTAATTCACTTAGACCA
TGTTCGTTGACAAATTATAACTTCCACAAGGAAATCTCTGATTTCTTTGCAGCCTAAAGG
GTCCTGTTATGAGAAACCACTTGGTAGAATTTCTCTCCAGCTCTACAGCAGATCCTTTCC
CATATGTGGGAACTAATCCTCAGGTTCCTGGGTTATTTAGAATTTTGTGATCTTAAAATC
GTTGCTGATTATCATCAGTTCATGTATCTAAAACTGTACATGATGAGAAATAGGAAGCTA
ATGACATACCTAGAGCTGTCTACGGAGTTACTGAAGCCCAAAGAATTCAAAACCGTTTGC
TTTTTCCCTTTCCTGGGAAAAATGATTCAGAGATGAGAATTGTGCCTTCAATACAATAAG
TAAGCAAAGTTGGAATTCCCTTGCTTGGAGAAGGAAGAAGGCAGAGCAGGTAAGATTGAG
CTGCTTCTATAATTTGAAAGACATAAATTGGAAGAGTTTTACCTGGTGAAGTTGTGGGCT
TAGTGGAAGAGCGGCATACATGTATGTCAGAAATATGAGACATTTAATTTTAAGTTATTG
ACACATGGTTATGTTTTTGCATGATTGGCCTTATTTACCTTATATACACTTTCTACCAGA
TGCGTGACTGTTTTAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTTCCACTAAGCCCACAACTT
CACCAGGTTTTTTTCTTCCAATTTATGTCTTTCAAATTATAGAAGCAGCTCAATCTTACC
TGCTCTGCCTTCTTCCCTCTCCAAGCAAGGGAATTCCAACTTTGCTTACTTATTGTATTG
AAGGCACAATTCTCATCTCTGAATCATTTTTCCCAGGAAAGGGAAAAAGCAGAAATTCCT
AATTAGTTGCCAGGTTTAAAAATTGGTAATTATTCGAGTTTTATATTCTCTTGTTTTTTC
GAAGTCTGCAGTTGCTTTGGGAAAATCAGTAGCTTACGCAACAATTGATCAGTTGATCTG
CGTCTCATTTTGCCAGAGCTCAGTGGCAAACCATCTCTGTGCTTATTAGTTAGGACATGT
GCTTTCTAGTTGGCAGGAGGTCCCTATCACTTGTTAGTTTTTTGCATCTTGCCCTTCTTA
TACCTTTATATTAGCTACTTGGCCATTTGTGTGACTGTTTTAAAATTAAAATTCTATTTT
AAAAAAAATGCCTATGTTTTAGAAAAAAGTAAGAGAATGGCTCTATTTTCTTAGATGCAG
TACAAACTGTTAAATGTAAAGACAAATAGTGGCCGGCTCCGTGGCTGAGTGGTTAAGTTC
GTGCGCTCCGCTGCGGCGGCCCAGGGTTCGGATCCTGGGCGCGGACATGGCACCGCTCGT
CCGGCCACGTTGAGGCGTCGTCCCACATCCCACAACTAGAAGGACCTGCAACTAAGATAT
ACAACTGTGTACGGGGGGGTTTGGGGAGATAAAGCAGGGGGAAAAACAAAAAAGAAAGAT
TGGCAACAGTCGTTAGCCCAGGTGCCAATCTTTAAAAAAAAAACAAAACAAAACACAACT
GAATTATAAGAATGATCCCTGCCTTCAACAGGATTATATCTGTGTAGGAGAAAGAGATAA
ATTACTAAAAAAAAAAAAAAAAAAACACAAATAATAGTGGAGATAGAAGTGTTTGTGTAA
ACTGTCTTTCTTACTAGAAATAAGAATTGTAAGTTATTTTCCCAAGCATGCCAATCAGTT
CTTTCATACTATTTGCCTTTCAATCAAATTTCTCCGTGGTCTGTAGCCTTGTAACCTCAG
AGAGCCTACGTCTTTTAATCTTGGTTCTCTTGACTCCTACTTATTTAGAGTTTTTCTTTT
GTTGCTAATTCCTAGCTGCATTTGAAGTTAAATTGCTTTGGCTGATGCTCGGGTCCTATT
CAAGCTTATCTTGGTCTCTTAGCATTTGCCAGTAAAAAAAGAATAATTAATAGGCCAAAC
CAATCAGGCTTTACATGTTTTCTTATATTTTAACTATTGGAGTTAAAACAGGCTAGTGGT
GTGTGTTCCATCATGGTGTTGTATTCCATATCAGCAGAGGCATATAGTAATAGGGCAGTT
GATAGCAAAAAGCTATCAATTGTTATGCTGTCATGTGGGAGCCTTGTGTAATATATTTCA
TTTTTGTAGTCTAGGGGCTTCTGTAAAGTTAGGAGCAAAGTACAAATTTAAGATCTCTTG
GCCAATAACCTGGTTAATAATGTTTCCAGTTTCCTTGCTGACATGATGCATATCCTTGCT
TGCATATGATAGAAACTCAGTGTTTGTTTAATGAATGAGTGAGTGAATGCGTGATGGATT
AATGATTATACACATATGATCTAGCAAATATGGGTTGGGTATGTAGGAGAAGCAATAATT
ATGGATTTTAGGCTTTGGATGCATAGTGCCCTATGTTTGAATTCTGGGTATGCTGCTTAT
TAGCTGTGTGGTCTTAGTCACATCACTTAAATTCTCTGAGCTCGAGTATCCTATCACCTC
CAGTCTGTTGAGCCCTCTGCTTTATATACCACTAAACCTCTCTTGTCTCTTCTCTTCCTA
CCTCTCTGCTGAGCCTGAGATGAGGTTAAGCACCATAGATAGCACACAGAGAACCACACA
GCTATGATGATGTGCATGGTCCTTCATGATCTTGCAATCCCAAGGAGATTGTTGCTTGGC
CTGAGCACTACAGATGTACCATGGGGTGCAATCTAGAAGAGGGACTCTGATCCCTTGCCA
ATTTGCATATTTATAGAGGCATCGGGAAGGGATCACTTGACTAATTTGGAAGATTCTGAG
CTTTGCCGACAGGGTTGAAACTTGCGGGCCTGGGAAACATCAGATACTTGCTTGTTTCAG
TCTGAGGCCTTCCCAGTTGAGGTGGCTGCCTGAGGGAGGGTTGTGTGACAAACTGCTTTG
TGTTTCCTCAGTCTTCCTCCTGTTCTAGGGACTTGGCTGTAGGGACTGCCTCTAGGAGTC
ATAATGAGTGAGTCTCTCCAACATGTTGACTCCTTTTCACTGGGCTAACTTTATCAAAAT
CTACTCACAAGGTCCCAAAGTGCCCACAATAATTGTGGTCATGTCTCTTGGTGTTTTCAA
TCCCCTACAGTTCACATCCTTTGGATTTTCTTCTGAGGAGTCAAGGACTGGTCTTTGATA
GTAAATGGATGGCAGTGGAGATTAAATGGCTCTTGTCTCTTAAAGGGCAACTTTCTGCAA
AGGCCTTCTCTTCCCAGTCATCCAGTTGTTTTCCCTTCTTGTTCTACCTTTTGGCCTAAT
CTGTCTTTATTATTTCTCCCAGTTCTTTTCTTTGCAACCTTCTTATATAACTTTGGTGTC
TGCACTGCTCTACCAGCTCATTTCTTCCAGAAATTAGGGCTTAGCAGTCCATTAATTTCC
TCCTTGTCATTTACCTTTTCTGCGAATCATAACCACGTGATTTTGTTTTAGGAGCTTCAT
CAGAGAGAGCAGTCTCTATGCCATCTCTTCTTTGACCTCCCTTTCTTTCCAACTCAGCCA
GAGACCTGGGCCACCTTCTGGGATCCTCAGTCTTTGATTCCTCTCTTGACTCAGGGCATT
GTAGGCTGGTAGGACTGTCTTGTATCAGCAGAGGCCTCCAAGGTAAGAGGCTGATCTAGC
TGCTTCAAAGGCAGATAAACAGTGTTCGCATCTGGAGTTTCCCTATTATAGGTCTACTGT
TGAGGGCTTCAGCCATTCATGGACAGACGTTCTCCAACTATGGTCATTGGCCATCCCAAC
TCAGCCAAGAGACCTGACTCTACCCCTTGGAGGGGGTCTCCCATTCCCCAAAGTGGTGGA
ACACTGTGAATGGTGGAATTAACCTTGAGGCTTGATAAAACCTTGGAAATGCTCATTTCT
TTTTTTCTTTAACAGCCTGTAACAGTGCTGATGTTTTGGGCTTTTTAAAAATGGTTTTTG
AGGTTGCCATATTTCTCAAACTTTGCTTTCCACTTACATTAACACTGACACGTGGAATGA
ATATTGAGAGAAGTGAATCATTTTTCAAAATAGCCAAAAAATGTTTCTTCTCTTAATTGA
TCTTCTTCACATGCTGTCTTGCACCTCTATAAGCCATCCATACTCCTTAATCCATTCTCC
ACATTGCAGATGAAGTGGAGTTTTTAAATGCTAATTTGATGATATCAATACCATGCTTAA
ATAGTTTTTGCAGGGACGTTAGGATGACAAGGCTAGGGTGTTTCATATAGCACACAAGTT
ATCTGCATGTTATTAGGCTCCTCTCCTTTTGGCCCTCTCTCTCCCACTTGTATTGGTCTT
CTTGCAGTTCCTCTGCTATGTCCTGCTCTGCTCAGTTCAGGCTCTGGCTCCCCGCCCTGT
CTTTTTGCAAACTCTTGCTCATCCTTAGTGCACTCCACTCTCAGCCCAGATGTCACTTAT
TCAGGGAGGTCTTTTCCTGAACCTTCAACTAGGTAAGGCCTCATTTTTATACCTTTCTAT
TGTACCGTGTACTTCTCCTTCTTAACACATATGACAACTGTAATAATTTGTCTTTCTTCT
CTCTCTGTAATTAGGCTCCATGAGGGCATAGGGCTTGTCTGTCTTCATCTCTGTTTTTTC
CCCTATGCCTGGCCTGTAGTAGACAGTCAATATATTTTCTGACTTTGTATTAAGAAAAGA
TAATAGCTATCATTTGGAGTTACCATGTGGATTACAGATAATGTCTCTGAAGTGCCTGGC
TCAGTACCTGGCGCATGATAGACGCATGAGAAGCGCCTACTATTGGTGATAATCCATAAA
TTATTATTTTTTAAGGTTGCAGAAGGCTAGGTAGAATATTGCTTTATATGAGAGACACAG
TTTATTATGGTGGAAAAAATAGAGCTGTGGAGTCAGAAACACCTGGCATTTACTAGCTAT
ATCTTTGGGGTCTAACCTCTTTGAAACTCAGTGTACCCATCTGTAACGCCACATAATAGT
TGATGGTGAAAGTTAAATGAGAGACTAGGTTAAGCGCATAGTATGGTGTTATTCATAATT
AGGTCTTCATAAATAGTAGAGCTGGTTTTCTTTAAGTTGAGTTGATGATCTCACATAAAT
TTATGATCATTAATATTTGTTTGTTAATTTGACATTTGTTCATTATTGTCAGATTGTTGT
CTAACTCTGTAAGCTTGTTTTCTCTGAATAGAATCTAGCATTTTTTTCTGATTCTGTAAT
ATGTATCAGAATTAGTTTTGATTTCTGTAATTTTTTTGAAGTGAAAAATTAGTATTTTCA
TTTTTAAACACAATATTTATTAGTCTGGCATTCCAAAAATAACACTTGTTTCAGTGGGAC
CATTTTATTTATGTAATGCATTAGAATGTTTATATTAAGGTCCTGAAATACCAAGCTCTA
AGACACTCAGGAAGCTAATTATTAAACCAAGTATTTTGTGTCCTTTAGTAGCTGAAAGAA
AGCAGTTTGTGTTTATAAATAAATAGCATATTCAAAGTATGACAAGTTGGTAATTTGTTC
ATAGCCATGTACAGATTTGATTGTGGACCCAAAGCCATTTTGAAGTTACTCAGCTATAGG
TAACAAGTACCATTTCATAAAAATCAACACTGTGTAGAATGGTGAAAGTAATATAAAATT
TGCCCTTTGATCCTGGTGTTTAATTCAAATTCACTTTCTGCATTATTTTGAATTTGGGTT
TACAGAATTATAAAGTTGAATTAGTCCCCTTAAGGCTTTTATTCTGTTAAATGGTATTCA
GTTGTAGTGATTATATTTAGCTAGTGTGGCTTTTAAAGAGATCTTACTTTTATGGGAAGC
AAAATTACATTTATAAATTGCTCACTTTTTAATAAACAAATATCAGAGAGATACAAACAA
CTTAACAATTTTATCTTTTGTTCTTTAGAAGCAGCATTAAGAGGTCTTCTGGGAGCTTTG
ACGAGTACCCCATACTCCCCTACCCAGCATCTAGAGCGAGAGCAGGCTCTTGCTAAACAG
TTTGCAGAAATTCTTCATTTTACACTCCGGTTTGATGAACTCAAGGTGAGATTTTCTTCT
GGCCCTGATTGTTAGGAAAATCATGAGTCTTTCAGTGCACACTGGGAGGAAATGCCTGGA
GACCTTGTTAAAATGTGTTTAAATGATATCTACTGATCCTTAAAAATGGAAAACTGGATG
TAAACATTGTGCAGATCTCTTGATATATGCACAGCAAATAGCAAATGACTGAATATTCGG
TCTTCATTTGACTTTGTTTCAAAAATCTTCTCTGAAATAATACTGACTTTTTCTAATATT
TTTTTCTTTCCTGCTCATCTCTAATTTTTTCCCAATATTCTTTTATATAAAAATGTTAGG
GTATTTTTTTTCTCTTTCCCTCTCTTCTCTCTTTCCCTCTCTCTCATTCTCGTTGTTTCC
CTTTCTCTTTCTCTCTCTCTCCCTTTCTCTTTTCCTATCTATCTATGTGTAAACGTCCTA
TTGTTAGAAAGAGTGAGTGTAAAGAAATAAGCACTGGCTTTCCTATCAGGAGCCCTGAGT
TCCACTTCAGGCTCCATCACAGGATCCAATCATAAGGCAGGTCCTTTAACTTTTCAGGGC
CTCAAGTTCCTTGTCTAGAAAATGGAAGAGCTGAATTCATAAGTCCAACATTTCATGATT
CTATCATAGACCACCATTCTCTTATTAATGTACAAGTGGCTTGTATATAAAATTTTAGTC
TGTTCAGTTGCTCTGTTGACCATATATACATGCTTTTATTGTAATAATTCAAAACTAGTG
CCTACGTATTCCTTTTTGTTCTTATTTGGGAATAACGTTTTTTGGTAAACAATCTTTTAG
TATTATTACCTGAAATTATTGAAAGAAGGAAAGTATACTGACTGTGACAAAAAAAAATAG
TCTGCACAATTTTATATGTTCAGTAAGGACTGAATAAAGTGTTAAATAATTTAAGTGTGA
AGAGCCATCTTAGAGGATACCAGTTTTAGTTCTTAAAATGGTATTACAAATTAGGGAATG
TTACTTAACTGGTTAAAACTGTGTTTAGTAGATTTTTCACTTAATTTTTACACTATCATT
TATACATAATACCTTTTTCTTTCACAAATGTCTTCTGTAGATGACAAATCCTGCCATACA
GAATGATTTCAGCTATTATAGAAGAACGTTGAGTCGTATGAGGATTAATAATGTTCCAGT
AAGTTAATGCTTTGAATTACTGGGTGGTAATAATAACCCAGCTCTTTATTTATTGTCTAT
TCTTTTATTTGTTCATTTGCTCATTCATTCAGATAAAGTTAAAGCTAGTAATAAAGTTAG
TAATTATGGGCAACCACAGCTGTGGGAAGAAAGAGCAAAATGTAGTAAACCATATGGTGT
TTACCTGTTTTTCTACTTAGTCCGTTAAATTCCCATGACTACTTCAATGAAATTGCTTTT
TGTCTGTATAACATTGATAGTTATAAAATTTCTCTTTATATTCCCATTTTAACTGCACAA
AAATTTTGTGAGTTAGTACTTATGAGTTTTTTGTCCCCATGTTCTTAGAATGGAAGAATT
CTAGAGAGAAACTGACCTGGGATAGAAGTACTAACATTGGCAAGGGGGGAGAGCAAGGTC
ATGGACTTTGAGCACTTCTGTGCCCAATCTGGTTCTTTGAGAAAATGGATTCTGTGCCCG
TTCCTTGTCTAGCATAGCATCTCTTCTCATTTCCTTAGGCTTGTTAGTCTCTTGACTTCT
CATCTTAAGCTATTTAATACCCGTTTCTACCTCTAAGGAGTCACATGCCACGAATAAAAC
CTTAAATAAGGAGAAAGTGTTATCTTTTTCTCTAGGTATTTTGAGGACCTATATCATACT
AATAGGTGTGAAAAATAGAGAAATTTCTAGGATCAGCCCTAGCCTCAAGTAGATAGTTTA
ATAAAGAAATACTATGTAAATATGCAAGGAGTGGTAGGTGGCATAAGAGGTTGGAAAAAA
GTACCAAAGGATACTGTTCATTTTTTTTTTCATTGAAAAAATATTTTCTGAAGTGGTTTC
TCTAAGATAGGCTCTGGGTTGGAGGAAAGATTTCTCTTCCATGAAGCATCTGTTGTTTGC
ATCAGTTTGGTTTTGCATAGACCAAGTCCTGCTGTGAGGCTGACCTTATCGTCTGTCTTT
TTTATACCCACCATATAAAATAAGTAAAAGCAAAACACCAGTCCTCTATGACAGCCATCC
TGCCATCACTCAAGGCCAAAGACATTAAAGTCATCTTTGTACTGTGTTTAACCTTCAGTA
ATTATAAGTAAATCCAGTCACTGTCAAGTGAAATCTCTCTCAGATCTCTTCCCTGTCCCC
CTCTTCATCTCTTAATACTTCTATCTCAGTTGAGAGCCTAATTCTCACTCTCCTGTTGGC
AATCATTCTGTAGCAGTAGAACTCATTTTCTGACCTAGAGTCTTTTCCTTTTTGGTACAG
TCTGCCCACTGTCGTCAGTTAAGTTTCTTTAGAAAATTGAAGGGCCGGCTGGTGGTGCAG
TGGTTAAGTGCGCACGTTGTGCTTCGGAGGCCCGGGGTTCGCCGGTTCGGATCCCAGGTG
CGGACGTGGCACCACTTGGCAAGCCATGGTGTGGTAGGCGTCCCACATATAAAATAGAGG
AAGATGGGCACGGATGTTAGCTCAGGGCTAGTCTTCCTCAGCAAAAAGAGGAGGACTGGC
AGCAGTTAGCTCAGGGCTAATCTTACCCCCCCCCCCAAAAAAATGACTTCATTTCTTATT
CCTTTCTTCTGACACTCTAAGTGGCTCCCCGTACTTAGATACGAACTTAAGCTATAGTCT
CACCCCAATCTTCCTTCCCAACCTTATCTTTCACTAGTTGCTGCCCCTTATTACACTGAA
TACATTGAATTACACGGAATTACATTCTGCTAAGTCATTGGAGGACATGCTCCTCCCCTT
GACTGGTTGGAATACGTTGTTTACCTGCCCATCTTCACTTGCCAAAGCCTGACTCTTCTG
TGCGTCCATTTTAGTTTCTTCCAGTCTATCTAACTTAATGTTTCTGTCACCCGCCTTTTC
CATCATTATCTCTTAGCATGTTATTGTGGTTGCTGTGTGGATTCTTGTGTGTTCCCAGTG
GAGGCAGGGTGCAATGTCAGTCATCTTCCTATCTTCCATGGAATTTAGAACAATCCCTTT
TATACGTTAGGCAGCCCATCAAGGTTTTATTTAATTGCTTAATATCATTTAAAATATTTT
AAAGGTTAATCTTTTAAAAAATTGCTTAATGTCATTTTTAGTATTTGTGTTCTCAAAGAA
TATTTAAGTATTATGTGTACTTGAGGGTCTAAAATATAAGAGTATTTATTAGATTAACTT
AACAAGCGTTAATGAGACAGGCACTCTGCCTAGGTTCTTTTATAAATGTTACTATATTTA
ATACTTTATGAACTGATGCCAAGTACTCATATTTTCCACACAGGCAGAAGGAGAAAATGA
AGTAAATAATGAATTGGCAAATCGAATGTCTTTGTTTTACGCTGAGGCAACCCCAATGCT
GAAAACCTTAAGTGATGCCACGACAAAATTTGTCTCCGAGGTAAGCCTTGTCTAGGACGT
TGTGCTTTGCCTTGTTACTCTCCTGCCTGTCTGCATACATGATGACCTCAGCAAGTCTCA
TGACTTTTAAGTCCCATCCCTAAGCTGATAGACTCCCAGTGTATACACTGAGTCGTGTCC
CCTTCCCTGACACCCACATGTGCACATCTACCTGCCTGTTTGCAGTCTCTTTGGTTGTAT
TGTTGACACCTCAACGGTATCATGACCAAATTGAAGTCTTGATTTTTTTCCCCCACCAAC
TCTGCCCTTTCTCCAGTCTTTCCTTTCTCAACTAACAGTAACACTGTACAAGCAAATAAG
GGTTATAATTCTAAATTCTTTTCTTTATCTCATCCCCTATATCCACTCCATCAGACAGTC
TTAGTGGCTCTCCCTCCAGAATACACCCTGAATCTGAAAACTTAACCCCTGTCTTGCTAC
CTCTCCAGATCAGTCTACCATCCTCTCACCTGGAGTACTGTGTTAATGTCTGACTGTTCT
TATCTCTTCCACTCTTGCCCTGTAATCTCTTCTCTAAAGAGCAGCCAAATAATCTTAAAA
CATAAACCACATTCCCTTCATCCTCTGCCTAAGATGTTTGCAGTGACATCCCAATACCCT
TAGGATAAAATCCATATACCTCATGGCCTGTGAGGCCCAGTCTGCATGTTGCAGTTGTTT
CCGTCCAGCTAGAATGTAAGCGCCTCTTGGGAGAATGGGATCTTGGCTGTCTTGATCCTA
GCTGTTTCCCTAGAGCTCAGAACAGTCCCCGGAATCCAGTGCACATTTTACAAAATTGAC
CGGAGGAACCAGATTTTAAAGTTGCTAATTTTTCGTGTTATGCTGAGTTTAAATTCTGCA
TAAGTAATAACTGTTGGTCACTTTTACTTTTTTTGTTTTCCATACACTTTACAGAATAAA
AATTTACCGATAGAAAATACCACAGATTGTCTAAGCACCATGGCTAGTGTATGCAGAGTC
ATGCTTGAAACACCGTGAGTATCAGCTGATCTTTTTCCCTTTAACTTTCATGTTGAAATG
TTTGTCCAGATATGAATATGTCATATTTGGAAGGTGGAAATCAAGTATATCCCACGTATC
CAATGTTAACATATGAACAAAATTAAAATAATTTGACAGCCTAATGTAGCTTGTGGTTAG
GTATGAAGTACAGCTGGTTTTCAGGTGCCTCAGACCAGTCAGACTAACTTAAACTCTTTG
GAATGGGGATTTTGTGGAGCTTTTTTGGGTGTGGGGGATGAGTTTTGGTTATGCTTCTCA
TAACCATTCTCTCTCCCTTTTCACTAGAGAACCTTGCCTGTTTGCTAGAGAGTTAGAGTT
ATTCTCCTTGTCCTTTTCTCTCAGTATTAGTTCTCAGTCTTCAATTTTTTTCTTAAACAC
TAACCTAAATTCTCTTCTGGGTTTCTCCTCTCCCTCAAACCATTTATGGTGTGCACCACA
AAGTTTTCTGGCTGGATTTTCCTGACAGCAGGCAGAAAAAAATCTCTCCTGGATTCCTGG
ATAATATATGGTTTTACTAGATAACTTTTGTTTTTGTGGAGCTTTTTATTTTCCAAAGCA
CTATAATATACATCATCTTACTGGAAAACCTTATGAAGTAAGAGGGCAACTACTCAGCAT
CATCATCATTCCAATTAGGGGAGCAACCTCCTGGGAAATGGAGGGACTAATGCACAGTGG
ATGACCCCACACATGTGCCTGGATGTCTCTGTTTTTGTTCTGGACTTTCTGCCATGCCAT
GCTGCCTTCTGTATAGACAAAAGTTCTATTTTCTTTTTCCCAAATGAGAGAAGAATATGA
TTAAATTTTAGCAAATTAAAACTCAGTAATACAATAATGTGTTTAGATCAAGATCGCCCC
TAAATTGCAAAAATACTTGCTCTGTTAAGCTAGTAACTTTTTTCATCATAGTAATCATAA
TAGCCTTTACAAAGCGCCCATCCCCAACTTGTACTTTGGGGCTACTTTTAATTTCTCTAA
AATTGTCTGACCCCTGCAGGCAGAATGGGTAGCATACTAAGGTGTGTATAGAGACCAGAA
TATGTAAATGATAGCTGTTCCACCCACCTCATTTCTCTGGGAATCTCATGCAGAGAAGGA
GGTGGTGCACAATGTTCTCTCTTTTAGAGATCAACAGGATACGTCTTTGAGCATCAGCTG
AGAGTTGAATCAGCTCATTAGTTTGTGATGTGCTTCATCCATCCATATCTTTTCTACCCT
CCAGGGAATACAGAAGCAGATTTACAAATGAAGAGACAGTGTCATTCTGCTTGAGGGTAA
TGGTGGGTGTCATAATACTCTATGACCATGTACATCCAGTGGGAGCATTTGCCAAAACTT
CAAAAATTGATGTAAGTTGTATTGTTTTATATAATTCCCAATAATTTCCATACATGGAAA
TCATAGACTTTTATTTAAAGAGCTGGCAGACTGCACTCTGTTGCAGAACTCAGGTTTATA
GTTTGTGATAGTGGTGGATTTTGGTCTCCTCTACTCTCTTGCAGTATTACTTACAGCCTG
TGTACAGATGTAAAATGATTGAAGGATAACTGTATTGTTTTTCAGAGTATCTCCATGTAG
GGAAACCTCATACTCATAAGTGGTCCTGCATATTTGGCAACGTAAATAGATAATCAGGCA
TACGAAATTTTTTTTTATTGTATCCTTTCATTACTTTGGCTAAAGCCCATTTCAAACAAA
AGTGTATATTAAAAGTCAGTAGAGGTGCTCCAGTGAAGAAAGTTGAAAACTACATATTTT
CCCTCCTCCCCTCAATCATCATAAATTGTGGCTATAGCCTGGGTTTCTCTGTTTTGTCAT
TTCTCTCCTCACCTTGTCACATCTGGTTCATCAGAATTATCACCAGTGTTTGGTGAGAAT
TGTGTCCAGTTTCCCTTTCACAGCTAGTTCAGGCTCTTAGCATTTCATAGGTAGATTGCT
GATTGCTAGCTGGTCTTCCTGCCTTCATTCATAGCCATCCTATGTAAAGAGAAATGAGTT
AGTATTTATTGAGTGATTACTGGGTCCCAGGAATTTTGCATTTGTTCTCCCATTTAACTC
TGAAAATACTCGTAGGATGTAGGTGTTATCTCCCTCGTACTAATAGAGAAATTAAAGCTT
AGGGAAATGAAGTAGTATAGTTGCTAGTGAATGATAGAGCGGGATTTTGAACTCACATCT
CCATGGCTTCCAAAGCCTGTGGTATCTCTGCTATGCTGTGGTTTTTCACAATAACCAGGC
TCATCTTCCTTACGTACCATCTTCGTTGAGTTGTTCCCTTGTTTAATAGCCTGTGACAAG
CCCCTGCTGCCGTCCCCATCAGTTCCACATGAGTGCTCCTGGCTTTCCAGGCCCCTGTAC
GCTCCCCTGTGCGAGTCGTCTCAGCCCTGCAGAATTCTGTCCTCTGTGTGTGATGTACGT
CATTATTGTTGTTATGGCGTTTGTCTGCCTCTTTTCCTTGCCAGCGTGTCCATTCTGTCC
TTTCCAACGTTACTCAACACCTTTTCCAGGAAGTCTTCCCTTCGCTGACCCTTAGTTTCT
CATGAGTGTGGGTGGTGCTTCAGTTTGACTGATTGGGTTCTCAGGAAGTTTTGTTTGGCT
GACAAACTGAAAATAACAACACTTGGGTAGATTTTTTTTTCTTCCTGTTCTAAGAATAAT
TATTTTGACATTTCTAATGTGTAATTTCTTATGAGTTCTGTAATTATGGTGCTAGTTTAA
GTATTACTGTTTTGAAAGTGAATGTTAGATGAAAAGAAAGATGTTTCACCTTTTCTGTTT
CCTTTTTTCCTCAGATGAAAGGTTGTATCAAAGTTCTTAAGGACCAACCTCCTAATAGTG
TAGAAGGTCTTCTCAATGCTCTCAGGTGTGTATATGTACATGTGCATGTGTATAGGAAAA
GTTTATGTAAGAAAATGCTTCCAAATGTGAATAGCGCAAAGGATGTGAACATAAATGTTC
CATGTAGAAATGCAAAGATCTTGTTTTGCTCACTGGTAATCTTGCTTTCAAATGTTGGTT
ACAGGATTTTTATAATGAAGTGGTGTGTGTGTCTGTTTACATAAGTGAGAGTAGCAGTTT
TGTTTCTTTGCTGAAGATTTTGGCTTTCATGTTTTGCCTCTCTTAAAGCAGAGATGCTTA
TCGTTTATTTTTTAATGAAAGTAATACATGCTAATTATAAATAAAATTCATCAAATACAG
GAACATTTAAAGAAAAAGAAGTCATATTATCTCACTATTTTGGAACAAACTGCTGTTAAC
ATTTTGGTATATGTTCTTGTAGAGGTTTTTTCTTTACACTTAAAGATAGTCATAGGTTTA
TATAGTAGTTATCTTTTTACAAAATAATACCATACAAACTGTTTTACAACTAACTCTCTT
CCCTTAATATAGTGTAATTACATTTCTGTGTTCAGAAATACAGATCTCTATTATTTTTGT
ATATTTTGTATAGTGAAAAAACAGTCATTATTTGAGGTCTTTTCTCAGCATAGACTATTT
GATTTAGCTAAGAATGAAGGAATATTTTTAAATGAAAATCTCAACACATTATAACATCTT
GACTACAGAGATTTAATTGGTGATATAATTTCCCTAACATACAAGATGATTTGCTCATTA
CTTGATTATTTGGGGTTTACGCACAAAAATTATATGAACACAGAAATATTTATGTAGTGA
CTTTTTGAGGCCACAGGCCATCTTTGCGTTTCACTGCAGTGCATTGTAGTTCACAGAATA
GAATGAAGTGATTTCCAATTCACTGTTATATTCCCCGCATATTTTGTGAGCAAAACAGAT
TGTATTCCTCTTGAATACTTAGTCGCACCTGGTACGTCATAAAGTGAAATCTAGGCTGCG
TCATTTCAGCTGAGTGGAACCATCAAATGATTTTATTAAGGTTATGAGAACTATTCTGTA
AGCAGCGATAACCTAAATAATCTAAATGCACATCGGAAAGATTAAGGGACATAGTAAAGC
AATTAAAAATTCTTACAATGTTACGCTATTTCATCCATTTCAACCAAGTCTACTTTTTAG
AATTTTTTACTCCTGAGGTTTTTGCAATGCAAACTTCATTGGTTTTACCAGTATTTATGG
TGGTGTGAATCTTTCCTACTTGGTCCCCTGCTGAACGAACGCCCACTGGGTCCAGGCAGC
CTGACTTCTCCCAAGCCCTTTTCTTTTGGATTGGTTAGACTCTGAAGCCGGCAAATGACA
GGAAATCTTTTTTAACAAGTAAGAGAGAATTGAGATTCAGAAGGTTTTAGTGTTATTTCT
TTACCTTGAAGGGACTATGCTTAAAACATTAATTTAAAAACCCAAGAGTTTACTTTTCTT
TTTTAGAGTGTAAAGGGAGGTCAATGTCTTTTTCTCTAGAGTTGGGGCAGAAGAGGGCAG
TGGCAGTGAGTGAGCGATGGAGTTGAGGGCTCCACGCAGCAGTCTGTGAGGGAGAGGGGA
GGAGAAGCAGCAGTGAGGCGGGAGCTGCCGGCACTTCCCTTAGGTTTTCTTTTCAAATAT
AGAATGGAGGGGCTGGCCTAGTGGCATAGTGGTTAAGTTTGCATGCTCCACTTCCGCAGC
CTGGGGTTTGCGGGTTCAGATCCTGGGCACAGACCTACATACCTGCTCATCAAGTCATGC
TGTGCTGGCATCCCACATGCAAAATAAAGGAAGACGGGCACAGATGTTAGCTCAGTGCCT
ATCTTCCTCAGCAAAAAAATACGTATATATATTAAAAGTATATATATTTATAAAAACTAA
AAATTCGAAAATGAAGGTTTTTTGCAGTGACAACTCTTGAACTGTCTGTATTCTTAGTGA
CCATATTCTGTGTCTGCTTCTTATTTTTTCACCTGGAAAGTTCTATAAGGCTAATTAGTT
TAGTTGATGCTGTGGAGTGGTGGTTATAATTAGTAACATTTTTATATCACTGTCAATGTC
CAGCGCAATTTTATATGTAGGACTTATCTTCACCACAGATAACTCTGTGAGGCAGGTGTG
GCTATGGGGTGTTGGAGGTGTCTCCGTTGTACAAAAGAGTTACCTTAAGATCTGGAGAGA
CTAAAGATTATACAGCTAAGTAAATGTTGGAGCCTTTTTTCAAATTCAGGATTTCATTCT
TGAAATCCCAAATACATGATGTCACACTGTTGAGCCTTAAGTTTGCTATGTACTTGAACT
TCAGTGTGCTTTGGAATCGCCTGGGTGGATATGAAAGATGCACACTCCCAGGGCACCACC
TCCAGAGCGTCTCTTCCTTGGGTCTGGCGTAGGCTCAGGCACCTGCATTTTAAATACACG
CCCCGGCTGACGTAGGTAATGCTGATCCTTTGAGAAACACTGCTTAAACTAAATCAACCA
GCCCTTAGAGTGCTTCACTCAGAGCAAAGGAGATACTGTTAAGAAAGCATTTTGTAATCC
CAAAAGTGCTGTGCAAGTTTTAATTGTTATTTACACCTCTACAAAATGGAACCCCTTTTT
GCTGAATTACTATTTTTTTTAGTGAGTACCCAGTTTACTAGAGATGTTCACTCCATAGTT
TTCCTAAGAGCCAACAGTTAATAACCAAACTATTTTAAATGTGAGTATAATTGTGCATAT
ATATATTGTTTATTTTGAATGCTTTTCTGTAGTAATTATGTAGTACCTCCAGCTTACAGT
ATGTGATTATGAGAAGGCAACAAGTTATGTCTACATTTTACAGGTGGAGAAATGGAACCA
AATACCTTTAAGCATAAGAGGAGAGAGCTGGAGCTGGGGGGTTAAAGTTCAGTGCTAGAC
AGTTGCCTTCTTTATTAAATTTAAGAGTAAAGGTAAATAAGTTTTCCTTCAGTAGAAGAG
TCGTATGCACTTGGGAAAGGACTTGTTTTTTGTGCACAAAGTCAAATGATGCCATACGTG
TTCATACATTACTTTCACATACCTCAGACATTACTGGCCTTTTCCTGATGCAGTGTGGTG
ATGTCATAACCTCCATTGACTCTGTCTGGGGAAGGATCTGAGACCCGTGGAAACTCATGA
CCACATCCCATGGAAGGAACGAGAACTTGTGCCTGAGTAGAGAGAAAAGCACTTACAACT
TTGCACGGTCACAGTACCTTGCTGAGTAGTAATACTTTTAAGTACTCTGTAGTGGAAATT
TTGTTATTCATGTTACTCGGCTCTTTGCATCATCCAGTTGTACAAAAGAGGGGGGCGGAA
ACAGAAATGAAGGGATGGATGTTGAAAATTCTTTTCTCCTGACATCAGTAGGATTATGTG
TAGCTATGTATACTTTATCTGCACTTGGTAACTGAATCACGGGTTAAGTCTGCTGCGTCA
CCGACCTCTTAATTAATATTCCTTTATGGATTTTCATTTCCAGCCTGGCTGCTTACCTCC
TTATGTTCCAGCCACAAGTTCTTATTTAGCGCCTGTCATGTGCCAGGCACACTGGGATCT
GTTGAGTAACGTGGGAACAGTGGGAAGTGGGAACAGTGGGAAGTGACTTCCAAGTAAAAC
TGTAGAGAGTATATCAGATACTTTGTTTCTTTACCTATCCAAACAGTTACTTGAGTATAG
GTCCTTTCTTCAGTTTTTAAAATTGATTTGAAATGAACCTAACAAGAATTGAGTTTTAAT
TTCCTTAACACAGAAAGGCTATCTGTGTGTACCTGCTTAAAATGATATAGTCCTTAAAGA
TTATTTGTGAAATTCTTGTAAGCCAAATTAACCAAACAGCATTTAGTTCTGTCTAAATTA
TCTCCAAAATGTATCCCGCAGTCAAGCTTTTGAGCACCTGTTTCCATTGCTGCTGATCTG
GTCCAAGCCTTGGTCATCTGTCTCTTAGACCTTTGTCATAGCCTAGCCCCGTGCTTGGTC
CCTCTGCTTCTCCTTCTGCTCCCTCCGGTTCTCCCTCAGCAGCCAGAGTGATCCTTTGAA
AACATAAATGAAATCACACAGCACTTCCCCACTTCATGTCCTCCACTGGCGTCTCTGCAC
TTCGAAGAATCTCCAGACTCCTCACTGTGGCCTGTAGTGTCCCTGTGACCTGCTCTTTCC
TGGTCTCTGTGGCCCCATCTAGTACTTTCCTCCTAGGTTTACCCCTTCTGGAGTATTCAT
GTGTTATCATCTTTCTCTGTCTGCTAGGTTGTAAGCTCTGGAATAGTGCCTAACACGTAG
TAGGCTTGCTTATTGAATTTCTGCCATGTAGAGGAATCCTATGGTGAATCTTCTCATAAA
ATAATCACTCTTAGTGATTCTTTTTTGGATTCTTTATTTGGATTTATATGCTTTATAGCA
AAACACCTCTGCCTAGAAGTAAGGTGCTGAGAGAATTGAAGCGTGTTGGGATGTGACGGT
TACAGCTGTAGTAGCTGAGCTGACTTAAATACAGAATAGAACAGGGGTCAGCGAACTTTT
CTCTAAAGGGCCAGAGAGTAAGCACGTGCTTTAGGCTTTGTGGGCCACATGGTTTCTGTC
ATAGCTGCTCAACTCTGCCATTGTTCCAAGAAAGTAACCCTAGAAAATACTTACATGAAT
CAGCATGGCTGCATTCCAGTAAAACCTTTTATGTAAACACTGAAATTTGAATTTCATATA
TTGTACATCTTAATATGAAATAGTCTTCTTTTGATTTTTTACCCTAGCTATTTAAAAATG
TAAAGTATGCTTAGCTTACAGGCTTTACCAAAAACACAGGTGGTGGGCTGGATGTGGCCT
GCAGGCCGTGATTTGCAGACTCCTGGCTGTAACAGTTAGTTCCTGTGGGTGACATGTCAC
AGCTCATTGTTTACTTGAGAATTGAACCAGATCGATTCAGGGAGGTAAACAGCTAAGGTA
AGCAGCTGTTGGGTGTTCTGTGTGAAAAGCGGTAGGGAGGCTAAGGTAGGCAGAACCTGA
ACAGGGTTAAAGCTGGGAGGAGGCCTGATTTGTGAGAGGTGCCTTCCCTGGCTAGTTGCT
CATCTTTGGTAGTTTAGAACTCAATGCAGGTAATGTTGTCGTTTTAAATTCCCTAAAATC
GATGTCCTTTTTACTTTTAGGTACACGACAAAACATTTGAATGATGAGACTACCTCCAAG
CAAATTAAATCTATGCTGCAATAACAGTTCTGGAACAAGCACCTGCTGTAGACAAAGACA
GTATTCTGCAGTGACTGGGAATGCACAGTTTTTAGTGATTGCAATTCCTCTCTCATTTAC
TCTTGCTTTGTATTTCTGTCCTCTGTTCCTCCTCCCTCTTTTTTAATCATGTTCTTGTTC
TTAAGACTTCTTTTCTGTGCCAAAATCAGTAAAGTTATACTCTGAAGGGACATTGTCCTT
TCAAACAGGCCATCTAAGGCAGCTAATTATGCATTGCATTGGGGTCTCTACTGAGAAAAA
TTCTGTGACTTGAACTAAATATTTTTAAATGTGGATTTTTTTTGAAAACTAATATTTAAT
ATTGCTTCTCCTGCATGGCAAAACTGCCTATTCTGCTATTTAAAAACCCTCAATGACTTT
ATTTTCTACTGCCGCTTTTTTCATGTGCAGCCAAAATGAAAATGTTTAAATTAACTGTGT
TGTACAAATGGTACCCAACACAAACTTTTTTTAAATTAGTAAGACTTTTGTTTAAAGTTT
TAAGTTTGCATTTTGACTTTTTTTGTAAGGATGTATGTTGTGTGTTTAACCTTTATTAAC
TAACGTTACAAACTGTGATGTGTGCGTAGAGTATTACGTATGCATGTTCATGTTTAAAGA
ATGGCTGTTGATGATAAAATAAAAATCAGCTTTCATTTTTCTAAGTGTGGCTTGGTTCAC
TGATGTTTGTTTTTAGGTTTCTAAAGCTTTCCCTGTGTCTATTTTTATGGAATGCATACA
CTCATTGCACAATTTTCCCTCCTTTTAGGGGGAGCTGGGTCCTTTTAATAGTATATTTCT
TCATTATTGTCTCTGTACACAGTTTTGCTTTTAAAATCTTGCTAGTTGCAGTGAGACCAG
CGAGCTTATCATTAGCTTGACTTTTATTCTTGGTTTAGTCTTGTCTGGATGTAGTTGTAG
AAGGAAAAACGCCCTCTTCCTTGATTCCTGTTTCCCGGGAAGGCAAGGGCAGCACCTTGC
AGCAGAGCGTGTGGGATAAGCACTGCCCGTAATACCAGGAGGCACTTCCCAGGGGAACTT
GAAGTCCGTGATCGCACTAGTGTGGAAAACTAGCATGTGTGTTATTTTAAGATCATAAAA
GCTTAATCATGAAATCTGAATGTCATCATTGGGAGAAGCTTCTTAAAGATTGCTTAGTCC
AGCCATGCTGGTTGTTTAATGAGAAGAGTTTCTGAGCTGTGAGACAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1073, 7771..7892, 13142..13247, 19468..19604, 20680..20757, 23023..23139, 24054..24133, 25384..25510, 26954..27024, 32180..32466
1001..1073, 7771..7892, 13142..13247, 19468..19604, 20680..20757, 23023..23139, 24054..24133, 25384..25510, 26954..27024, 32180..32240
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved