Equus_caballus Locus RPL30
snOPY snoRNA Orthological Gene Database
Equus_caballus RPL30
Equus_caballus
RPL30
9
SNORA72
3588..3721
4983
ACTTGTCTGGTTAATTTCACGTCAAAGTGGGACACACATTTGAATAAACTTTAATTGTG
AAGTGACCTACAGTACAGACCTGGGTACTGACTCTACCTCCGATAATACACTAGATATGG
AAACTTGAGAATAAAAACGTCACTTATCTCAAAAGAGTTTTTGTGACTATCAAATAAAAT
AGGGGAATGGTGTAGCACAGTTCCTGGCACAGTTAGCCCCGCCCCCCGCCCCCCTTTTTT
GGTTGCTCCTCCTGATCTCCAGGGCACGATGACACGCGAAGTAGCTTACCTACTGGTCTG
ACTGGACTTTTCATTTTTTTTGGTGGTGGTGATGGGTACTTTCTGAGCCTAATATTTTGA
ATGATCCGCCCCTGGACATTTATGTCAAAGTCCAACGTTCACAACAAAAAGATTTTTTTA
ACTGGACCTTTTTATCGCTCTCTGCAAATTCGGCTTACAAGTTCACACTAACACAGCCAC
AAGAGTTGAGTTTGGGGGAGCCAGCGCGCGGCGCCACCGTTCTCCGAGGGATCGGCAACT
TGGGCGAGAGCAGGAGTGCACGCAGCTGCTTCAGCCTGGCGGAACTGACGGACGAGCGCA
GACCCGGAGCTGCCGCGCACCGGGGTCCTCCCGACTCTCTCCAGAAATGAGCAAAGCGGC
ACTAAGACCGTGGTCCAGCCGCAGCCGCCTCTTCTCGCCACGCCCCCCGCCTCACCCTCA
GTCGGCTTCTCCAACTCCTGCCAGTCTCGACGTCCCTCGGTTCCTCAGTCCACAGCTCTG
CGCAGCAGAGTAACACAGCGCCTAGACGCCTAAGGCCGGCAGCCGGGCGAAGCGTTCGCC
GCAACCGCCACTCTAACTAGCGGATTTATAGCAACCGGCAACACAGCTCCCCTTCTTGCC
CCGCCCCCTCCGCCTTCGATTTGCTTCCGCTTCCGGTCCTGGAGTCCCGGCTTTGCGGTG
AAGAGCTTTGCATTTTGGGAGCTCTTTCCTTTCTCGCTCCCCGGCCATCTTGGCGGCTGC
TCTTGGTGAGTGGGCTCCAGCAGGCCGAGGTTTAGGCAGCGCAGGGAGCCCCGCGGGTTG
TCGTTTGGAGCTGCGGCTCGTAAACTTCCTGTGCTCTGTATGTTTTAGGTTGGGGGCCGT
CCCGCACCTAAGGCAGGAAGATGGTGGCCGCAAAGAAGACGGTGAGTGAAGCGGGCCAGG
GCTGGAAGCCGATTCACGTGGAGAGATGAGTCTCGGCCGGGGCGGGCAGATCTGAGCACA
CCGGGGACACAGCGTGCCCACTGGCCATTGGAGGGTCTCGCAGGGAACCCAAGAGGCCCT
CTTAAATGACTTGGGACCTTCGACTTCGGAGGTTTATTAAGGGGCCCGGCTTCCAGAAAG
CTGGACCCAGTTTTGAGCTGGTGACGAACAAGGCCTTCACATCCGTGTTAAATGTTTGCT
TTGTAGAAAAAATCGTTGGAGTCGATCAACTCTAGGCTCCAACTGGTTATGAAAAGTGGA
AAGTACGTGCTGGGGTACAAGCAGACTCTGAAAATGATCAGACAAGGCAAAGCGAAACTG
GTCATCCTCGCCAACAACTGCCCAGCTTTGAGGTAATCCAAGGGACCTGAGTATGTGTCG
CCCACTGCACGTTCTTCGTGAGCGAATATCCAGGAGTGTAAACTACATGCAATCTGGGTA
GCAGAACTCGGTTTTATTTAAATTTGTTTTACAAGAGAAGGCTTTTAGAATGACTAATGG
TTGCTATTGTGGTGGTTGGCTCTTGATCCCCTTCTCCCCACCGTGTTCTCTCCTTGTGAA
GCGTATCCTTGGGGGAAGTGTATGGCAGAGAGGGTAAACCACAGAACGTCAAAGTTTGAG
TATTTGTTATTGTGTGTATTTTGTGTTCTGCCTTTTTGGTCATTCTTTTAGCTTTGAAAC
GCTTTAAAAGTGCTTCATTGTATGAACTTATTTCAGTGTAGAAAAGCTAGATAAGAAAAG
TTCAGGCTGGCCAATGGAGCTGCAGGCTATCATAGAATCACCTAGTTCATCCCTCTGTGT
TAATTCTCTGGGCCAAAGTTTTTGCTTGACTCCCTGTTTGGAAATTGAACTCAGTTGGTG
GTGTAAATAAGTTAAAGAAACTTGGATCTTGAAGAATTGTAAGCCATATAATCAGTCCCC
TACCCGCATTGCTTTTCTCTGGTAATGCGTGACCTGCTCACAGCGTTTTGTATAGGGTGT
CTGTTACTTAACTGTCAAAGCCTGAGTGCTCTCTTCTCCATCCCATCCCGTTTTTTGGTC
TTATTCCAAACCTTCTATGGCAGTGGTTCTCCAATGTGAATGTGCATACAATCACACGAG
TCATCTTGCTAAAATGCTGGCTCTGATTTAATGCGTCTTGGATGGGACCTGAGATTTTAC
ATTTCTAACAAGTATCTTGTGAAACTACTGCTGTCTGTGGATCCACACTGAGCAGTGGCA
AGGTTCTGTTAGGACTCCCTTCAAATTTGTAAAACCGTTAATATCTACCTACTCAACTGA
CACAGAAATGTTAACTCTGGGCTAAGTAATATCACTCCCCATCTAGGATTCAGAGCACCA
GAGGGTGAAAATGGGTTACCTTTTAAAGATAACAGGGTTTTGCATCCTGGATCTTCCGCC
TGTACTGTGCCTCAATTTTTTCATTAAAAAGAATGGAGTACCTAATATTTTAGAGGTTGT
CATGGCAGTTAAATAATGTAAACTGTCTAGCATGTAGTAAATATTAAGTAAATAATGCTT
TTATTTTCACCCTTCCCTCTTTTCCGTTGAGCATAGATAAGTGTCTTAAATGTAGGTATT
CAATGGATGTTTGCTGGTTGTCCCATCCCTTGTAAGGGATCCAAGGAAAGATAGTTTGTA
TTGGCTAATAGATATGATGATAATGTTTTTAAGAGTGGTGACTGGCTTAGTTACTGTTTG
AAGGCCTCATCAACATAAAACTAAGAAGTAGTAACATTTCATCTGTCAGTCACTTGGTAT
GGCATTTATTTATTTGTCTTTTGGTTTCCAAAGGAAATCTGAAATAGAGTACTACGCCAT
GTTGGCCAAAACTGGTGTCCATCACTACAGTGGCAATAATATTGAATTGGGCACAGCATG
TGGAAAATACTACAGAGTGTGCACACTGGCTATTATTGATCCAGGTATGCTTTTTAAATT
ATAAGTTTTCTTCCTCTACAGTGTAATACAGGTATTGTTTGCTTTACAAATGTTTTTGGT
TCCTGAGTTCACACAGTGAGAATTTGGATATGCAAGGGATTACCTGTAGTTTTATTTTAC
AAAGAATTGATAATGAATGTCAGTACACTATAATTGACTTTTCTTAAATGGTTCGATAGT
TTGAGATCACAGATTTTGTTTGATGAAGCACCTAAGAAATGATGATTTATGACCTTGGTA
AAGGTGAAATTATAAAAGGGGAGAACAATCAGGTGAAATAGTAGAAGGTAATCCTTACTG
GCTGCCTGAGAACAGAGAGGTAAAACTAAGTTGAGAAGAAGTAGTGCCTACAAATACACG
TACTGTTATGTTTTGAACTTGGGAATTTTTAATCAATTCATAAGATAACTGCGAATATTC
TCGCTGTTCTGATTTTGTAATAATCAGAGCAGGCTAAACATTCGCTATATTAAAATACCA
TGCATGTGTCCCCAGACCTAGTTCTTTCCCTAGATCTGGTTTTATAAATGCTGGGGATAA
ACCAAATCTGATTTGTCTGATGCATCTTATTTGGGAAATGTCTGTAACTCCAGGTATCTT
TGATCAATCTTAAGAAATGACAGCACAGCTAGTATAATAACTTTTGAAGATAACCACTGC
TAATTTGATGATTCAATGAATTGTAAAATTATTGTGTTTTATTTTCTAGGTGATTCTGAT
ATCATTAGAAGCATGCCAGAACAGACTGGTGAAAAGTAAATCATGCAAAATTTTTCTTTA
ATAAAACTGGCCAGAGCTTCTTTTAAAAACATTGTATCCATGTCAGTTATTTTCTTTAGA
TCTTTTTGTTTCAGTACACTTTCCTGAAAATAGGGCTAGAGAGGATGAGGCAGCTAGACG
TGGCAAGACTTCTGGGTTAAGAGGTATACATCCTAGTTTCTGTTTCCCGTTTTTGTAAGG
GGAGTGCACTGAGTTCCTTTCCTGTACTAGATTTTTAAGAGACTTAATTTTCATAATTCA
GTCTCAGGACATTGTTGGCATTTTATATTTGAAAATGCTTGACAGACAGCAAGATTCAAT
GCCCAGAATTGGAATTTATAGTCCTGCTTAAATCTACCAAATCTGAGTAGCAAAGAGCAT
TAAATGAAATATGTTCCCCATAGCCAAAATTCTGTCACAAGCTGAGAGAAACTCTGTTGA
ACTTTGATGAAGTAGGATCTTTCCTAAGGGTGTGCAGTGGTTGTGGATAAGAAATTTACT
TGGATAACTTCAGAATAATTCCACATGTTCAATGTGTTAAGTCCACAGTTGCCCAAAGTG
TGCTTATAATTTTAGCCCTAAAAGATACTGTGAGGTGTGCTCACTGTTCATATTTTTTAA
TGAAACTGCATACCGCATCTGAGTATGTCCTGTGGAATCCTTTTCCCACATCTGTTAATA
TCCTTTGGAACATTCAGAGGAATTAGTTCAGGGAAAAATAACTGATTTAGATACCTCTTG
ATTTAGAGAGTTGAATGGTGCTGGTAGGGTATACCCTACACAGTCTGTGCTGGGCTCTGA
GGCTGCAGAAGCATGAGAAATGACAGTATTCTTTTAACTTTAGAATCAGTCACTTCAGAT
AGGCAGTTTTTGGTGGTAGATGAATGAGGTGTAGGAGATAAGGATGCCTTCCATAACATT
ATCCAGTCAAGTGTGTATTGAACTTAAGAGTCAGAAGACTACTTACTTAATAAAAATAAC
CATGGGTGGGTCAAATCCCCAGTTTCACAGGTGAGGAATTTGTTTCTTTCAAGGAAACAT
TGTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1024, 1128..1180, 1446..1591, 3033..3163, 3889..3983
1160..1180, 1446..1591, 3033..3163, 3889..3935
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved